CS235069B2 - Method of cdna fragment cleaning with specific nucleotide sequence - Google Patents

Description

The invention relates to a method for purifying a specific sequence of nucleotides.

Proteins and peptides are synthesized in nearly infinite different forms by a variety of living organisms. Many of these proteins or peptides have a medical, industrial or agricultural meaning. Some proteins are enzymes that are specific catalysts for complex chemical reactions. Other proteins are hormones that affect the growth and development of the body or affect the function of specific tissues. Some proteins are important for the isolation and purification of various trace substances and for the removal of contaminants. Both proteins and peptides are composed of linear amino acid chains, the term peptides referring to shorter single chains, proteins to more complex and multiple chains. . The method of the invention can be used for both proteins and peptides.

Proteins and peptides are usually high molecular weight and each has a specific amino acid sequence. With the exception of very short peptides, chemical production of peptides and proteins is usually impractical due to the high cost and time loss and sometimes impossible. In most cases, it is necessary to isolate the desired protein from the organism producing it. Often, the desired protein is only present in very small amounts. Often, the organism that produces this protein cannot be obtained in sufficient quantities. This situation leads to the fact that many proteins are known for agricultural, industrial and medical use, but these proteins cannot be obtained in sufficient quantities.

It has now been found that microorganisms capable of rapid growth can be used for the synthesis of important proteins and peptides, regardless of their source in nature. In this way, it is possible to process the microorganism so that it is capable. synthesize a protein or peptide that is commonly produced in another organism. The method of the invention is based on the basic kinship that exists in all living organisms between genetic materials, usually desoxyribonucleic acid and the proteins produced by the organism. This relationship is that the amino acid sequence of the protein is reflected in the nucleotide sequence of the desoxyribonucleic acid. There are several sequences of trinucleotides that specifically relate to any of the twenty. amino acids that are in ^; protein most common. The specific relationship between the sequence of the trinucleotides and the corresponding amino acid is the genetic code 235069. This genetic code is the same or similar in all living organisms. As a result, the amino acid sequence in each protein or peptide is reflected in the corresponding nucleotide sequence, and moreover, the nucleotide sequence can be essentially transferred to any other living organism. Some of the genetic codes are listed in Table 1 below.

Table 1

Genetic code

Phenylalanine (Phe) TTK Leucine (Leu) XTY Isoleucine (Ile) ATM methionine (Met) ATG valine (Val) GTL Serine (Ser) QRS proline (Pro) CCL Threonine (Thr) ACL alanine (Ala) GCL Tyrosine (Tyr) SO termination signal TAJ termination signal TGA histidine (His) CAK glutamine (Gin) TEA asparagine (Asn) AAK Lysine (Lys) AAJ aspartic acid (Asp) GAK glutamic acid (Glu) GAJ cysteine (Cys) TGK Tryptophan (Try) TGG Arginine (Arg) WGZ glycine (Gly) GGL

Each of the three letters represents a desoxyrlbonucleic acid trinucleotide with a 5 'end on the left and a 3' end on the right. Individual letters mean purine or pyrimidine bases which form a sequence.

A = adenine

G = guanine

C = cytosine

T ~ thymine

J = A or G

K = T or C

L = A, T, C or G

M = A, C or T

X - T or C when Y is A or G

X = C when Y is C or T

Y = A, G, C or T when X is C

Y _ = A. or G when X is T

W - C or A when Z is A or G

W = C when Z is C or T

Z = A, G, C or T when W is C

Z - A or G when W is A QR - TC when S is A, G, C or T

QR = AG when S is T or C S = A, G, C or T when QR is TC

S = T or C when QR is AG.

The trinucleotides of Table 1, commonly referred to as columns, are trinucleotides occurring in desoxyribonucleic acid in the genetic material of living organisms. Protein synthesis requires the generation of messenger RNA (mRNA), which will be described below. The mRNA codons have the same sequence as the desoxyribonucleic acid codons in Table 1 except that they contain uracil instead of thymine. The complementary sequence of desoxyribonucleic acid reverse-polarity trinucleotides is functionally equivalent to the codons of Table 1. An important and well-known feature of the genetic code is that more than one nucleotide triplet can be used for most amino acids. That is, a number of different nucleotide sequences may code for the same amino acid sequence. These nucleotide sequences appear to be functionally equivalent because - when used, they produce the same amino acid sequence in all organisms, although in some strains the transfer of some sequences is more efficient than the transfer of other sequences. In some nucleotide sequences, a methylated derivative of purine or pyrimidine can be found, but methylation of this type has no effect on the transfer of the genetic code.

The way in which a micro-organism can be given the ability to produce a new protein consists of three general steps:

1) isolation and purification of a specific nucleotide sequence containing the genetic code for the amino acid sequence of the desired protein type,

2) recombining the isolated nucleotide and its sequence with the appropriate vector, usually a bacteriophage or plasmid desoxyribonucleic acid; and

3) transferring the vector to a selected microorganism and selecting a strain of the microorganism containing the desired genetic information.

The basic difficulty encountered in using the above general procedure is the first step, that is, isolating and purifying the desired specific genetic information. Desoixyribonucleic acid exists in all living cells in the form of nucleotide chains and extremely high molecular weight. A single cell can contain more than 10,000 structural genes that encode amino acid sequences in more than 10,000 specific proteins, for example, each gene consists of a sequence of several hundred nucleotides. In a large number of cases, all sequences form four basic nucleotide bases. These are adenine (A), guanine (G), cytosine (C) and thymine (T). As a result, long sequences, which are structural genes for specific proteins, are very similar in chemical composition and have similar physical properties. Thus, by separating one sequence from a large number of other sequences in the isolated desoxyribonucleic acid, conventional physical and chemical isolation procedures cannot be performed.

mRNA is the cornerstone in converting the information carried by the nucleotide sequence of desoxyribonucleic acid into the amino acid sequence of the desired protein. In a first step of this procedure, called transcription, a segment of desoxyribonucleic acid that contains a sequence of protein-specific nucleotides is transferred to a ribonucleic acid. This acid is a polynucleotide composition similar to desoxyribonucleic acid except that it contains ribose in place of desoxyribose and thymine instead of thymine. The bases in the ribonucleic acid may enter into the same relationships that exist between the complementary chains of desoxyribonucleic acid. Adenine and uracin or thymine are complementary and the same applies to guanine and cytosine. The nucleotide sequence transcript from desoxyribonucleic acid to ribonucleic acid will complement the transferred nucleotide sequence. This altered acid is called mRNA because it is the link between the cell's genetic system and protein synthesis. Usually, only the mRNA sequences that are present in the cell at any one time are the sequences that correspond to the proteins that are produced at that time. That is, a differentiated cell whose primary function is to produce a typical protein will contain predominantly a ribonucleic acid whose nucleotide sequence corresponds to that protein. In these cases, it will also be relatively easier to isolate and purify the nucleotide sequence which is the genetic code for this protein by isolating the mRNA from the differentiated cell.

The main disadvantage of the above process is that it can be used in relatively rare cases in which a specific cell produces predominantly a protein of one type. However, the vast majority of commercially important proteins are not synthesized in such a specialized way. The protein of interest is usually one of about a hundred different proteins that a cell produces at any given time. However, isolation of mRNA is fundamentally also applicable in this case, since the group of different ribonucleic acids present in the cell is usually only a fraction of the nucleotide sequence present in the desoxyribonucleic acid, so that its isolation already constitutes an initial purification step. However, if this step is to be utilized, it is necessary to devise a way to isolate nucleotide sequences of _f which occur in many amounts of several percent to a high degree.

SUMMARY OF THE INVENTION It is an object of the present invention to provide a method for isolating and purifying a nucleotide sequence even if the nucleotide sequence is only 2% in the mixture of different sequences contained in the mRNA. In addition, the method is to be combined with known methods of fractionating mRNA and a sequence of nuclides that are present in small amounts in the total amount of ribonucleic acid. The method of the invention is intended to be applicable to mRNA from any organism and thus to aid in the production of proteins of commercial and research interest in sufficient quantities.

Human growth hormone is of medical importance in those cases where the pituitary function is inadequate. The growth hormones of various animals have their use in veterinary medicine and in agriculture, especially when domestic animals are grown for feed and it is therefore desirable that they be as large as possible and soon mature. Human chorionic somatomammotropic hormone is of medical importance for its role in fetal maturation.

The method of the invention utilizes various structural properties of mRNA and desoxyribonucleic acid and utilizes various enzymatically catalyzed reactions. The nature of these reactions will be described below. The symbols and abbreviations to be used in the description of the invention are summarized in the following Table 2.

Table 2

DNA - desoxyribonucleic acid

RNA - ribonucleic acid cDNA - complementary DNA, enzymatically synthesized from mRNA sequence - RNA participating in messenger RNA dATP - desoxyadenosine triphosphate dGTP - desoxyguanosine triphosphate dCTP - desoxycytidine triphosphate

HCS - human chorionic somatomammotropin

TCA - trichloroacetic acid

HGH - human growth hormone

A - adenine

T-thymine

G - guanine

C - cytosine

U - urged

Tris-2-amino-2-hydroxyethyl-1,3-propanediol

EDTA - ethylenediaminetetraacetic acid

ATP - adenosine triphosphate dTTP - thymidine triphosphate

As a result of the known base pairing in DNA replication and transcription, isolating an mRNA that contains a nucleotide sequence that is the genetic code for an amino acid sequence in a protein is equivalent to isolating the same sequence or gene from the DNA itself. Upon retranscription of mRNA to complementary DNA (cDNA), the exact DNA sequence is reconstituted and can be appropriately incorporated into the genetic material of another organism. Thus, both complementary versions of a given sequence are interchangeable and functionally equivalent to each other.

The nucleotide subunits of DNA and RNA are linked to each other by phosphodiester linkages between the 5 * positions of the sugar-bound nucleotide and the 3 ‘position of the adjacent strand. Breaking these bonds results in a linear polynucleotide that is polar in the sense that one end of the polynucleotide can be distinguished from the other. In the 3-position, the free hydroxyl group may be or may be substituted with a phosphate moiety or a more complex moiety. The same applies to the 5 polohu position. In eukaryotic organisms, for example those having a distinct nucleus and mitotic apparatus, the synthesis of functional mRNA usually involves the addition of polyadenylic acid to the 3 ‘mRNA position. The altered mRNA can then be separated from another group of acids which are isolated from the eukaryotic organism by polythimidylic acid-coupled cellulose column chromatography as described in Aviv H. and Leder P., Proc. Nat. Acad. Sci. USA 69,1408 (1972). Other chromatographic techniques that utilize the affinity of polyadenylic acid for chromatographic materials and bases occurring in ribonucleic acids may also be used, such as oligo dT, U poles, and mixtures of T and U poles, such as U-Sepharose. .

The reverse transcriptase catalyzes the synthesis of DNA complementary to the RNA backbone in the presence of this RNA strand and another substance which may be any complementary oligonucleotide or polynucleotide having a hydroxyl group at the 3 ‘position and in the presence of the four desoxynucleoside triphosphates dATP, dGTP, dCTP and dTTP. The reaction is initiated by non-covalent binding of an oligodesoxynucleotide with a hydroxyl group near the 3 polohy position in the mRNA, followed by sequential binding of additional desoxynucleotides according to the nucleotide sequence of the mRNA, to the 3‘-terminus of the growing chain. The resulting molecule can be described as a hairpin shape structure in which the original RNA is complemented by a hydrogen bridge and a complementary DNA strand. The DNA and RNA strands are not linked to each other by covalent bonding. Reverse transcriptase can also catalyze a similar reaction using DNA with a single stranded hairpin structure as described in Aviv H. and Leder P., Proc. Naťl. Acad. Sci. USA 69, 1408 (1972) and Efstratiadis A., Kafatos F. C., Maxam A. M. and Maniatis T., Cell 7, 279 (1976).

Restriction endonucleases are enzymes that are capable of hydrolyzing phosphodiester bonds in DNA, so that the continuity of the DNA strand is interrupted. When the DNA is in the form of a closed loop, it creates an open structure. The basic principle of the action of a restriction enzyme is that its hydrolytic action only takes place at a site with a specific nucleotide sequence. It is a place where only a restriction endonuclease can act.

A number of restriction endonucleases have now been isolated from a variety of sources, all of which have been characterized by their site of action. When these enzymes act on double-stranded DNA, some of these enzymes hydrolyze phosphodiester bonds on both strands at the same site to form free ends. Another enzyme of this type hydrolyzes bonds that are separated from one another by a sequence of several nucleotides, thus forming free sequences of nucleotides. These free nucleotide sequences can complement and re-bind to each other, whereby the originally hydrolyzed DNA can be re-established. Since each DNA cleavable by an enzyme of this type must contain a site of its action, the same ends will always be formed so that heterogeneous DNA sequences that have been treated with restriction endonuclease can be bound to each other, as described in Roberts R.J., Crit. Roar. Biochem. 4,123 (1976).

It has been found that the sites of action of a given restriction endonuclease are relatively rare and unevenly distributed. First, it is always necessary to ascertain empirically whether there is a site of specific action for a given restriction endonuclease in a given segment. Recently, other restriction endonucleases isolated from different sources with different sites of action have been discovered, so it is increasingly likely that a suitable restriction endonuclease can be found for a given segment of long nucleotide sequence.

The invention relates to a novel method of purifying cDNA with a desired nucleotide sequence that is complementary to the corresponding mRNA. The method of the invention consists in cleaving the cDNA after transcription from a complex mRNA mixture after restriction endonuclease. In carrying out the method of the invention, it is not necessary to thoroughly purify RNA, but instead utilizes transcription of DNA into cDNA, specific fragmentation of the resulting cDNA by one or two restriction endonucleases, and fractionation of the resulting cDNA fragments based on their length. The restriction endonuclease treatment secretes segments of unequal length and results in the formation of fragments of the same length from different cDNAs containing at least two restriction endonuclease sites. Thus, from the originally heterogeneous cDNA mixture after transcription, fragments of the same length with a given nucleotide sequence may be obtained. These fragments may contain several hundred nucleotides and in some cases contain the entire structural gene for the protein of interest. The length of the fragments depends on the number of nucleotides that separate restriction endonuclease sites and will usually vary in different regions of DNA. Chain length fractionation allows purification of these fragments with the desired nucleotide sequence.

The fragments obtained will be of the same length and will be highly pure in terms of the desired nucleotide sequence. From the corresponding mRNA, routine separation and isolation of such fragments can be ensured if they form at least 2% of the RNA used in transcription. When using previously known RNA fractionation methods that allow pre-purification of mRNA prior to transcription, it will be possible to reduce this amount even below 2% of mRNA isolated from the organism.

The specific sequences purified by the method of the invention can be further purified by a second specific restriction endonuclease digestion capable of cleaving the desired sequence on the inside. This cleavage results in the formation of two subfragments of the desired sequence, and these subfragments can again be separated according to their length and, in addition, they can be separated from the uncleaved chain, which, although of the same length and isolated, but not containing the desired nucleotide sequence, and therefore was not cleaved at this second cleavage. This cleavage is based on the relatively rare occurrence of restriction endonuclease sites, so there is an extremely low probability that a contaminating chain of the same original length would be cleaved by the same enzyme into fragments of the same length as those resulting from cleavage of the desired strand.

After removal of the contaminating chains, subfragments of the desired chain can be recombined in a known manner to recover the desired chain. However, the resulting subfragments must not be joined in reverse order. The method according to the invention also proposes a method by which it is possible to ensure that the resulting subfragments are re-bound together in the correct order.

Various embodiments of the above processes may be used consecutively, yet different labeling procedures may be used and the purity of the isolated sequence accurately measured quantitatively. By using several purification steps, a desired sequence with a purity greater than 99% can be obtained.

The above-isolated and purified cDNA can be recombined with a suitable vector and transferred to a suitable microorganism by known methods. For this purpose, new plasmids have been created containing a nucleotide sequence that is the genetic code for human chorionic somatomammotropin and human growth hormone.

At the same time, new microorganisms have been grown that contain most of their genetic system - HCS and most of HGH. These methods can also be used for the isolation and purification of growth hormones of other animal species, and for obtaining new vectors for the transfer of these genetic codes as well as for the cultivation of microorganisms containing the transferred genes.

Accordingly, the present invention provides a method of purifying a cDNA fragment with a specific nucleotide sequence suitable for recombination with a vector for transferring DNA and transfer to a microorganism and a cDNA population heterogeneous in length and sequence, wherein the purified fragment contains a minor proportion of this material and a portion of the cDNA it contains the desired fragment, has at least two restriction enzyme sites, and is prepared from polyribonucleotides heterogeneous in length and sequence using a reverse transcriptase catalyzed reaction by subjecting the cDNA to enzymatic hydrolysis specifically at said restriction sites incubation in a reaction mixture containing the restriction endonuclease for which these sites are specific to form a cDNA fragment, after which the cDNA fragments are fractionated according to their length, followed by separation of the fragments into fractions containing fragments of homogeneous length, and the fraction containing the cDNA fragment with the desired sequence of specific desoxynucleotide is then isolated.

In carrying out the method of the invention, a polyadenylated, crude or partially purified mRNA is used as a starting material, which may be heterogeneous with respect to the sequence and size of the molecule. The selectivity of the pro- RNA isolation procedure is facilitated by any means that results in enrichment of the material with the desired mRNA in the heterodispersed isolated mRNA. Any known pretreatment method may be used for this purpose in conjunction with the method of the invention, provided that the pretreatment does not internally cleave the mRNA. Pre-selection of the appropriate tissue as a source for the desired mRNA is also important. Often, this choice is influenced by the fact that - only a specific tissue of a highly differentiated organism produces the desired protein. These are cases of hormones which are essentially peptide in nature, for example growth hormones or HCS. In other cases, it is usually found that different types of cells of microbial origin may be the source of the desired mRNA.

In these cases, at least a small number of preliminary attempts are usually required to safely identify the most advantageous source. Often, it can be found that

235009, it is possible to increase the proportion of the desired mRNA by subjecting the cell from which it is to be isolated to various external influences. For example, hormone treatment can provide increased production of the desired mRNA. Another possible way of influencing a cell is to grow at a certain temperature and to act with specific living substances or certain chemical compounds.

Pre-purification can also be used to enrich mRNA, which is usually performed by conventional methods used for fractionating RNA after isolation of the RNA from the cell. Again, any method that does not cause RNA degradation can be used. Particularly suitable methods are preparative sedimentation with increasing sucrose concentration and gel electrophoresis.

Isolation of mRNA from cells must be performed under conditions that preclude degradation of the desired mRNA. In particular, the action of the ribonuclease enzyme should be avoided since this enzyme is capable of hydrolytically cleaving the RNA nucleotide sequence. Hydrolysis of a single bond in a nucleotide sequence results in the interruption of this sequence and thus the loss of the entire RNA fragment containing the original 5 'end of the desired sequence. A suitable method for inhibiting ribonuclease during the extraction of ribonucleic acid from cells is the method described in US Patent No. 4,264,731. This method of ribonuclease inhibition consists in using 4 M cells during cell disruption during cell isolation of the ribonuclease. guanidinium thiocyanate and 1M mercaptoethanol. In addition, the process is preferably carried out at a lower temperature and at a pH of 5.0, since this further reduces the risk of degradation of the isolated RNA by nuclease.

Before carrying out the process of the invention, it is necessary to obtain mRNA substantially free of all contaminating proteins, DNA, polysaccharides and fatty substances. For this purpose, conventional methods known in the art for this type of purification can be used. The RNA thus isolated contains mRNA mixed with RNA. From this mixture, mRNA can be separated from eukarvotic cells by chromatography on an oligo-dT cellulose column or on a column of other materials substituted with another oligonucleotide, such as U-Sepharose, using the specificity of hydrogen bonds in the presence of polyadenylic acid at the 3 'position. in mRNA from eukaryotic material.

The initial step of the method of the invention is the generation of DNA complementary to the isolated heterogeneous mRNA sequence. The most suitable enzyme for this reaction is reverse transcriptase, although in principle any enzyme capable of producing DNA complementary to the base mRNA can be used. The reaction can be carried out under the conditions described in the letter of the art using starting mRNA and in addition a mixture of the four desoxynucleoside triphosphates dATP, dGTP, dCTP and dTTP as precursors to the resulting DNA strand. It is preferred to carry out the process so that at least one of the desoxynucleoside triphosphates is labeled with a radioisotope, for example, ³² P at the a position, to control the progress of the reaction and to label the product to facilitate its isolation during purification. The yield can also be quantitatively determined in this way, as described, for example, in Efstratiadis A. et al.

The resulting cDNA generated after transcription by reverse transcriptase is somewhat heterogeneous, particularly with respect to the sequences at the 5 'end and 3' end due to variations at both ends in transcription depending on the starting mRNA. Variations at the 5-terminus occur probably because the oligo-dT used to initiate synthesis can bind at a variety of sites in the polyadenylated region of the parent mRNA. The cDNA synthesis in transcription begins at an unspecified point in the polyadenylated region, so that the polyadenylated region of different length transcribes depending on the site where oligo-dT binds at the start of the reaction. It would be possible to avoid this heterogeneity by using a compound which, in addition to the oligo-dT chain, also contains one or two nucleotides which are simultaneously present in the nucleotide sequence of the RNA, so that the substance would have a predetermined binding or predetermined preferred a transcription initiation binding site.

Inaccuracies in binding to the 3‘-terminus of cDNA in transcription occur due to a variety of factors that affect the reverse transcriptase response and, in addition, the possible partial degradation of the original mRNA starting. Isolation of a specific cDNA after transcription at the maximum strand is usually facilitated when conditions that promote the formation of the longest strand, but also suppress the synthesis of short strand DNA, are chosen for the reverse transcriptase reaction. Preferred reaction conditions using reverse transcriptase and avian myeloblastosis virus are, for example, those set forth in the Examples section below. Specific parameters that can be varied to ensure maximum DNA production after transcription with the longest strand are changes in reaction temperature, changes in salt concentration, changes in the amount of enzymes, the ratio of binding substances to the original mRNA, and reaction time.

The temperature conditions and salt concentrations are selected to provide the most favorable conditions for the specific base pairing between the oligo-dT compound and the polyadenylated portion of the parent RNA. Under suitably selected conditions in this case, 235069 binds to the polyadenyl region of the parent RNA, but at the same time substantially prevents non-specific binding to various other sites of the parent compound, for example in the form of short chains rich in adenine residue. The effect of temperature and salt concentration is combined. At higher temperatures and lower salt concentrations, the bonding stability of specific bases decreases. The reaction time should always be as short as possible, since non-specific binding occurs with longer reaction time and degradation of the starting and final products can also occur. The reaction time depends on the temperature, at lower temperature a longer reaction time is required. At 42 ° C, reaction times of 1 to 10 minutes are sufficient. The oligo-dT parent compounds must be used in an excess of 50-500 mol% based on the parent RNA, and the enzyme must also be used in a similar molar excess relative to the parent RNA. Excess enzyme and oligo-dT support the growth of the cDNA strand. thus, it is possible to ensure cDNA formation after transcription with the longest strand with a relatively short incubation time.

In many cases, further purification will be possible by the method of the invention using single stranded cDNAs after transcription from mRNA. However, as already mentioned, the restriction enzyme may only act when double-stranded DNA is used. In this case, the cDNA obtained must be used as a basis for the synthesis of double-stranded DNA using DNA polyrnerase, for example reverse transcriptase and nuclease, which is capable of hydrolyzing single-stranded DNA. Methods by which double-stranded DNA can be prepared have been described, for example, in Ullrich A., Shine J., Chirgwin J., Pictet R., Tischer E., Rutter W. J. and Goodman ®. M., Science 196: 1313 (1977).

The heterogeneous cDNA prepared by transcription of the heterogeneous mRNA sequence is then treated with one or two restriction endonucleases. The choice of the endonuclease to be used depends primarily on the prior determination that the material contains sites for the next action of the enzyme and that the enzyme can be used. The cDNA to be isolated must contain two such sites. If these sites are identical, only one enzyme may be used. The desired sequence will be cleaved by this enzyme on both sides, while avoiding the possibility of chains of different lengths in the sequence, and at the same time a number of fragments will be formed which contain the sequence and are homogeneous with respect to the overall chain length. If the starting material contains two different sites for the action of the restriction endonuclease, two enzymes will be required to produce the desired fragments.

The choice of a restriction enzyme or enzymes capable of providing fragments with a sequence of nucleotides of optimal length and with a genetic code for the desired protein or at least a portion thereof must be made empirically. If the sequence of amino acids in the desired protein is known, the nucleotide sequence in the fragments of uniform length after restriction endonuclease treatment can be compared with the sequence of amino acids for which the fragments are genetic code using known relationships between the genetic codes as common to all life forms. Knowledge of the complete amino acid sequence, however, is not absolutely necessary in the desired protein, since a relatively precise identification can also be made on the basis of a partial amino acid sequence. If the sequence of amino acids in the desired protein is unknown, polynucleotides of the same chain length after restriction endonuclease treatment can be used as samples capable of identifying the synthesis of the desired protein in an appropriate in vitro system that produces the protein. It is also possible to first purify the mRNA by specific chromatographic techniques which involve specific binding.

The number of restriction endonucleases to be used in the method of the invention depends on whether single-stranded or double-stranded cDNA is used. Preferred enzymes are those which are capable of cleaving single-stranded DNA, since this acid is the immediate reaction product after transcription of the original mRNA. The number of restriction enzymes capable of cleaving single-stranded DNA is limited. Suitable known enzymes are currently Hae III, Hha I and Hin (f) I. In addition, in the case of single-stranded DNA, the enzyme Mbo II can also be used. However, it is very likely that further restriction enzymes will be detected in further experiments that will cleave single-stranded DNA and thus can be used as preferred enzymes. Other suitable enzymes are those that are specific for cleavage of the double stranded cDNA. However, the use of these enzymes is no longer so advantageous, since in any case additional reactions have to be used to produce double-stranded cDNA, but these reactions always result in the loss of additional strands and the risk of further losses and a reduced yield of the resulting product. The use of double-stranded cDNA represents another technical disadvantage, as subsequent nucleotide sequence analysis is more complex and laborious. For these reasons, it is far more advantageous to use single stranded cDNA, although the use of this double stranded material is in principle also possible.

It is also possible to label the cDNA with a radioactive isotope prior to treatment with the endonuclease, so that the resulting compound can be detected in subsequent isolation. Preferably, at position a, the radioactive element, e.g. ³² P, binds to one of the four desoxynucleoside triphosphates from which the chain is formed. The highest efficiency can be obtained when the concentration of the radioactive precursor is approximately the same as that of the non-radioactive form. In any case, the total concentration of any desoxynucleoside triphosphate used should be greater than 30 μπιοί in order to produce as the final cDNA product as long as possible after reverse transcriptase treatment. The above conditions have been described in detail in, for example, Efstratiadis A., Maniatis T., Kafatos FC, Jeffrey A. and Vournakis JN, Cell 4, 367 (1975). In order to determine in detail the nucleotide sequence of the cDNA, the 5 'end of the 32p radiolabel can be labeled in a polynucleotide kinase-catalyzed reaction as described, for example, in Maxam AM and Gilbert W., Proc. Nati. Acad. Sci. USA 74,560 (1977).

Fragments resulting from the action of a restriction endonuclease or a mixture of two of these enzymes can be separated from each other and from heterodisperse nucleotide sequences without interconnecting ends by any means by which polynucleotides can be separated by differences in their chain length. These include various electrophoretic techniques and various types of sedimentation, including the use of a centrifuge. The preferred method is gel electrophoresis, since the polynucleotides are best separated by length. Furthermore, this method allows rapid quantitative determination of the separated materials. Suitable methods for this use have been described, for example, in Dingman C.W., and Peacock A. C., Biochemistry 7, 659 (1968) and Maniatis T., Jeffrey A. and van de Sande H., Biochemistry 14, 3787 (1975).

Prior to restriction endonuclease treatment, the cDNA obtained from different sources has different chain lengths after transcription. Under the action of a well-chosen restriction endonuclease or a pair of endonucleases, polynucleotide chains containing the desired nucleotide sequence are cleaved from this starting material to produce polynucleotide fragments of the same length. Gel electrophoresis shows that these fragments form a distinctly separated band. Depending on the presence or absence of other restriction endonuclease sites on other strands, additional narrower bands may be observed, which are due to the presence of material having a different chain length from the desired nucleotide sequence. Thus, it is apparent that, after treatment with a restriction endonuclease, one or more bands are separated by gel electrophoresis, with the remainder of the cDNA remaining heterodispersed. If the desired cDNA contains a predominant amount of the desired polynucleotide, electrophoresis will be the strongest band produced by separation of this sequence.

Although it is highly unlikely that two different nucleotide sequences of substantially the same length will be generated by the restriction endonuclease treatment, it is desirable to use a method that can determine the purity of the desired fragment of a certain length. This electrophoretic strip analysis can be used to detect impurities that constitute at least 10% of the material contained in the strip. Procedures have also been developed to detect impurities of less than 10%, based on the same basic principle as the method for nucleotide sequence isolation. This method requires that the nucleotide sequence of interest contains a site at which a restriction endonuclease may act, which was not used in the initial isolation of the nucleotide sequence of interest. When a polynucleotide material obtained from a homogeneous electrophoretic band is subjected to a restriction endonuclease capable of acting within a desired nucleotide sequence, the desired sequence is cleaved into two subfragments likely to have different chain lengths. These subfragments form two separate bands in electrophoresis at positions corresponding to their length, the sum of the individual lengths of the resulting subfragments being equal to the original length of the polynucleotide chain. The contaminants, possibly present in the original band, are not subject to restriction endonuclease cleavage and can therefore be expected to be detected at the original site. Pollutants that contain one or more restriction endonuclease sites can also cleave to form two or more subfragments. Since the distribution of sites suitable for the action of endonucleases is irregular, there is very little probability that the contaminant will be split into subfragments of this length as subfragments of the desired nucleotide sequence. The amount of material present in any band of radiolabeled polynucleotide can be determined by quantitatively measuring the amount of radioactivity in the individual bands or by any other suitable means. Quantitative measurements of the purity of the desired fragment can be ascertained by comparing the relative amounts of materials present in the bands that correspond to the individual subfragments of the desired nucleotide sequence. The resulting measurement is made by comparing the above relative amounts to the total amount of the resulting material.

After the separation, the desired nucleotide sequence can be re-formed. For this purpose, a DNA ligase enzyme can be used to catalyze the splicing of individual fragments. The procedure is performed as follows. The method according to claim 1, wherein the bands formed by gel electrophoresis for the individual subfragments of the desired sequence are washed separately, and these bands are then reacted in the presence of DNA igase under appropriate conditions, such as. See, for example, Sgaramella V., Van de Sande, J. H. and Khorana H. G., Proc. Nati. Acad. Sci. USA 67, 1468 (1970). If the fragments do not have end-caps that do not bind to one another, E. coli ligase can be used as described by Modri P. and Lehman I. R., J. Bio-1. Chem. 245, 3626 (1970).

The efficiency of reconstitution of the original sequence from the obtained subfragments after restriction endonuclease treatment can be substantially increased in a way that prevents reconstitution in the wrong sequence. This undesirable result can be prevented by treating the fragment of homogeneous length with an agent that removes the 5‘-terminal phosphate groups of the cDNA before cleavage of the cDNA by restriction endonuclease. The preferred enzyme is alkaline phosphatase; 5‘-terminal phosphate groups are a prerequisite for the subsequent action of DNA ligase in the reconstitution of cleaved subfragments. DNA subfragments can only be attached to the 5‘-phosphate groups terminated by restriction endonuclease treatment of isolated DNA fragments. This is essentially the method described in U.S. Pat. No. 4,264,731.

Most of the cDNA after transcription under these conditions can be derived from an mRNA that contains the 5 'end of the original mRNA by specifically treating the fragment obtained after reaction with the restriction endonuclease. Thus, the method of the invention can be used not only to obtain fragments of a specific nucleotide sequence coding for a desired protein, but also to obtain the entire nucleotide sequence coding for a desired protein.

A method of purification with a very specific meaning is the cloning of human genes, which can be used to produce recombinant DNA and then for transfer to bacteria only if the genes have been pre-purified very thoroughly or when experiments are performed on a special device that eliminates the risk of [(PA) as stated in Federal Register, Vol. 41, No. 131, Jul. 7, 1967, pp. 27 902 to 27 943. Suitably pure human genes containing the major part of the HCS and HGH structure can be obtained by the method of the invention. Human genetic material isolated and purified as described above may be incorporated into recombinant plasmids or other vectors which can be used for transfer. In the same way, chemically synthesized double stranded oligonucleotide sequences containing a site suitable for the action of a restriction endonuclease can be attached to the isolated cDNA, thereby facilitating the subsequent enzymatic cleavage of the human gene from the DNA transfer vector as described by Scheller R. H. and. et al., Science 196, 177 (1977). The DNA transfer vector is changed from the loop form to the linear form by treatment with the appropriate restriction endonuclease. The ends formed in this way are then treated with alkaline phosphatase to remove the 5'-phosphate end groups, so that the original DNA transfer vector cannot recreate a continuous loop in the DNA-lase reaction without first incorporating the segment DNA of human origin. Then, the oligonucleotide-linked cDNA and the DNA transfer vector are mixed with the enzyme DNA-igase to bind the cDNA to the DNA transfer vector and form a continuous loop of the recombinant DNA vector with the incorporated cDNA. When plasmids are used as the vector, the closed loop will be the only form that can be transferred - to bacteria. In this case, transformation is a method by which extracellular DNA can be incorporated into a microorganism such that the material becomes part of the genetic machinery. microorganisms. Plasmid DNA in the form of a closed loop can be incorporated in this way into the microorganism under appropriate conditions. The plasmid DNA thus incorporated in the form of a closed loop. then it undergoes replication in the altered cell and the replicated DNA is then passed on in the event of cell division. As a result, new cell lines are produced which contain the above plasmid and transmit the genetic information mediated by the plasmid. Plasmid transformation in this way, in which plasmid genes are maintained in the cell line by replication, very often occurs when the plasmid DNA is in the form of a closed loop and does not occur or rarely occurs when linear DNA is used. Once the vector for the respective transfer has been generated, the transformation of the appropriate microorganism is very easy and it is also possible to easily isolate new microbial strains containing human genes using appropriate selection procedures known in the art.

Using the above purification and analysis methods, the desired nucleotide sequence containing most of the HCS structural gene with a purity greater than 99% could be isolated. The structural gene for HGH was isolated with similar purity. - New plasmids containing an isolated sequence for HCS and HGH were also synthesized. In addition, new microorganisms were produced which contained isolated sequences for HCS and. HGH as part of its genetic machinery.

BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 is a diagram showing the autoradiogram of ³² P-labeled cDNA electrophoresis as will be described in more detail in Example 1 below; FIG. 2 is a schematic representation of the HCS nucleotide sequence along with the sites suitable for restriction endonuclease treatment, as described in more detail in Example 1, FIG. 3 is a diagrammatic diagram of a 32p-labeled autoradiogram of cDNA as described in more detail in Example 2, and FIGS. ³² P gel-labeled cDNA electrophoresis autoradiograms as described in more detail in Example 3.

The invention will be further described by way of example.

Example 1

The general procedure for isolating a specific cDNA sequence can be described by isolating a sequence that contains part of the HCS code by extraction from placental tissue.

Extraction of mRNA from placenta

Human mature placentas obtained by caesarean section are rapidly frozen in liquid nitrogen and stored at -60 ° C. After RNA extraction, 40 g of frozen tissue is crushed into small pieces and dissolved in 140 ml of freshly prepared 7 M guanidinium hydrochloride [Cox, RA, Methods in Enzymology 12, 120 (1968)], 20 mmol of tris-HCl at 40 DEG C. pH 7.5 1 mmol EDTA and 1% sarcosyl (surfactant N-acylated N-methylglycines) at 0 ° C. 0.5 ml CsCl was added to each ml and the dark brown solution was then heated at 65 ° C for 5 minutes, cooled rapidly in crushed ice and layered on 5 ml of 5.7 M CsCl solution, 10 mmol trls-HCl. pH 7.5 and 1 mmol ethylenediaminetetraacetic acid in 2.5 x 9 cm nitrocellulose tubes, then centrifuged at 27,000 rpm for 16 hours at 15 ° C as described in Glisin V., Crkvenjakov R. and Ryus C., Biochem. 13, 2633 (1974). After centrifugation, the supernatant is decanted, the tubes are rinsed and the 1/2 cm sediment containing pure RNA is separated by a razor blade. This. transfer a portion of the tube into a sterile Erlenmeyer flask and dissolve in 20 ml with 10 mmol tris-HCl pH 7.5, 1 mmol ethyl endiaminetetraacetic acid, 5% sarcosyl and 5% phenol. The solution is then made up to 0.1 M with sodium chloride and shaken vigorously with 40 ml of a 1: 1 mixture of phenol and chloroform. RNA is precipitated from the aqueous phase with ethanol in the presence of 0.2 M sodium acetate at pH 5.5. The RNA was then washed with 95% ethanol, dried and dissolved in sterile water. Approximately 30 mg of RNA is obtained from 40 g of placental tissue, from which approximately 300 µg of polyadenylated RNA is obtained after double-chromatography on oligo-dT-cellulose as described in Avíva and Leder, supra.

Synthesis of cDNA

Analytical reactions were performed on samples of 5 μ1 containing 50 mmol tris-HCl at pH 8.3, 0.1 mmol ethylenediaminetetraacetic acid, 7 mmol MgCl2, 20 mmol KCl, 10 mmol β-mercaptoethanol, 40 μπιοί dCTP containing ^{: 12} P 500 µmol dCTP, dATP and dTTP, 100 µg / ml polyadenylated RNA, 20 µg / ml oligo-dT | ₂ . t8 and 100 units / ml reverse transcriptase isolated from avian myeloblasts virus. The enzyme can be obtained commercially [produced by the method described by Kacian DL and Spegelman S. in Methods in Enzymology 29, L. Grrosman and K. Moldave, eds., Academic Press, NY (1974), p. 150]. The reaction is initiated by the addition of the enzyme at a temperature of 0 ° C, followed by a synthesis of 6 minutes at 42 ° C.

Under these conditions, approximately 50 ng of cDNA can be obtained from each <g of RNA. In order to obtain sufficient cDNA for sequence analysis, the reaction volume had to be increased to 100 µl and the dCTP had to be used at a concentration of 250 µmol.

Effect of restriction endonuclease.

Under restriction endonuclease, the analytical reactions are stopped by the addition of 20 μ vody ice water, then boiled for 2 minutes, cooled rapidly in ice and magnesium chloride to a concentration of 7 mmol. 5 µl of the samples were then treated with an enzyme using an excess of Hae III or Hha I or both for 1 hour at 37 ° C. Hae III was prepared according to the method of Middleton J. H., Edgell Μ. H. and Hutchinson C.A. III, J. Virol, 10, 42 (1972).

Hha I and Hpa II are available enzymes as well as Hae III. The amount of enzyme used was determined experimentally so that the enzyme was in excess and the digestion of an equivalent amount of DNA under the same reaction conditions was complete. The reaction is stopped with 5 μΐ of solution. 20 mmol of ethylenediaminetetraacetic acid with 20% sucrose and 0.05% bromophenol blue, heated to 100 ° C for 1 minute, then carried out. polyacrylamide gel electrophoresis. Products are divided into

4.5% polyacrylamide gel for 2.5 hours at 150 volts in a buffer containing tris-buffer, borate, and ethylenediaminetetraacetic acid as described in Dingman and Peacock, above, and autoradiography dried.

FIG. 1 is a diagram showing the results of ³² P-labeled cDNA electrophoresis prepared as described above. The samples are applied initially and electrophoresed on 4.5% acrylamide and then on 10% acrylamide. On the left side of the figure, a bar is placed to indicate the interface between the two gel concentrations. Region A depicts cDNA electrophoresis. Section V depicts cDNA electrophoresis after treatment with Hha I. Section C depicts electrophoresis of the same material after treatment with Нае III and section D electrophoresis after treatment with Hha I and Нае III. Section E depicts electrophoresis of material isolated from the main strand of section C. Section F depicts electrophoresis of material obtained from the main strand of section C after treatment with Hha I. Section G shows electrophoresis of DNA from single-stranded phage M13 at ³² P at 5'- ending after cleavage of Na III as standard by the method of Horiuchi

К. and Zinder N. D., Proc. Nat. Acad. Sci. USA 72, 2555 (1975). The approximate length of the nucleotide chains of these DNA fragments will be indicated by the numbers on the right, the numbers indicating the number of nucleotides.

The results obtained from region A show that cDNA after transcription of plasmid mRNA is heterodispersed. Upon the action of Hha I in the В or Нае III region in the C region, an accumulation of polynucleotides of different lengths is formed which can be separated. The formation of these bands demonstrates the presence of heterogeneous cDNA after transcription with at least one sequence and two sites suitable for Hha I and Na III treatment. By digesting Hha I, a fragment of about 470 nucleotides is obtained, and after digestion with Na III, a fragment of about 550 nucleotides is obtained. If both enzymes were used, three fragments were obtained, A, 90 nucleotides long, D, 460 nucleotides long, and C, 10 nucleotides long.

Due to its small size, fragment C traveled from the gel used in FIG. The material that can be seen at the 10% and 4.5% gel interface is a heterogeneous material whose molecules are too large to enter the 10% gel and therefore accumulate at its boundary. As can be deduced from a single band in region D, fragments A and V appear to have their origin in the same cDNA molecule. This assumption was confirmed by the elution of the fragment after treatment with Na III from the gel, as evident from section E after repeated treatment with Hha I. This procedure yields two fragments that travel in a similar way to bands released by both enzymes digested as digested. Comparison of Sections D and Г When cDNAs are treated, as shown in Section D, autoradiography, which is a measure of total radioactivity, is stronger for fragment A than for fragment B, although the opposite would be expected due to the difference in molecule dimensions ratio. This observation suggests that fragment A results from transcription of a region closer to the 3‘-terminus in the mRNA than from a region whose transcription produces fragment B.

Figure 2 is a schematic representation of a cDNA molecule with sites suitable for the action of the restriction enzymes Nα III and Hha I. DNA fragments A and B derived from the same cDNA molecule were shown based on their relative intensity in the autoradiogram as shown in FIG. The presence of DNA fragment C was plotted on the basis of the electrophoretic mobility of the band which can be seen in the region V and the region D in FIG. 1. The size of the DNA fragment A is known precisely from nucleotide sequence determination as described above. Maxam and Gilbert. The size of the DNA fragment V was determined by comparison with the DNA from M13 as can be seen from the designation in FIG. 1 in section G.

The sequence of nucleotides in the DNA fragment A and the 5‘-terminal part of fragment В was determined by the method of Maxam and Gilbert, supra. Since the amino acid sequence in HCS is known, it was possible to compare the nucleotide sequence from both fragments to the amino acid sequence using known genetic code relationships. Based on these relationships, it was also possible to demonstrate that the specific sequences are codes for portions of the HCS molecule and, in addition, the inclusion of these fragments in Figure 2 could be confirmed.

Example 2

The applicability of the method of the invention to purify the desired nucleotide sequence, which is only contained in a small amount in the mixture of other sequences, can be demonstrated as follows. Apply a defined RNA mixtures containing purified rabbit globin RNA from human placenta in polyadenylated form as a template for reverse transcriptase to the presence of dCTP labeled with ³² in position P. Loi

The resulting cDNA was digested with Нае III endonuclease and the products were digested on 4.5 and 10% polyacrylamide gel. The cDNA fragments can be elucidated by autoradiography of the dried gel.

Fig. 3 shows the results of these experiments as a diagram. The experiments were carried out in approximately the same manner as in Example 1. Labels were used which correspond to the digestion of the DNA from M13 by endonuclease Нае III, indicating the ³² P 5'-end of the fragments thus obtained. Sections A and H were used for these experiments,

The approximate nucleotide length of these DNA fragments is shown by the numbers on the left. Sections D to G show the results of electrophoresis performed on mixtures of RNA from globin and RNA from placenta in varying proportions as shown in the table:

Osek RNA from globin ng Placental RNA ng (B) 300 0 C 60 240 D 30 270 E 15 Dec 285 F 7.5 .. 292.5 G 0 300

Obviously, the 320 nucleotides Hae III fragment was derived from globin cDNA. cDNAs after transcription can also be detected when globin RNA makes up only 2-5% of total RNA. In case the RNA is present in such a small amount that it is over. transcription by this method of analysis is not detectable, it can first be partially purified by any conventional RNA purification method until it is at least 2 to 5% of the mixture.

Example 1 a d 3

This example describes the purification of a nucleotide fragment of about 550 base pairs in length, which fragment contains part of the HCS code. At the same time, the purity of the isolated sequence can be measured. The purified fragment was found to have a purity of greater than 99%.

Purification of cDNA from HCS

The placental polyadenylated RNA isolated by the method of Example 1 is enriched for HCS mRNA by sedimentation in a sucrose gradient of 5 to 20% (w / v) at 4 ° C in an ultra centrifuge at 25,000 rpm for 16 hours.

The 11S to 14S gradient axis is pooled and 100 µg of this RNA is used for the synthesis of double stranded cDNA according to Ulrich et al., Supra. The second chain synthesis was stopped by extracting the reaction mixture with an equal volume of ethanol at -70 ° C. Hae III endonuclease digestion is carried out in 50 μΐ 6 mmol tris-HCl pH 7.5, 6 mmol MgCl 2 and 6 mmol β-mercaptoethanol with 2 units of Hae III at 37 ° C for 2 hours, then added bacterial alkaline phosphatase (units are defined by the manufacturer), then digested at 60 degrees Celsius for 10 minutes, then extracted with an equal volume of phenol / chloroform, the DNA precipitated with 2 volumes of ethanol at -70 ° C, dissolved in 20 μΐ 10 mmol Tris-HCl pH 8 with 1 mmol ethylenediaminetetraacetic acid and subjected to% (w / v% / w / v) polyacrylamide gel electrophoresis Figure 4 (F) shows the electrophoresis of the above reaction mixture This fragment is excised from the gel and subjected to further electrophoretic separation, the results of which are shown in FIG. 4 (Ej.

The remaining material corresponding to the 550 base pair fragment of Figure 4 (EJ was digested with 4 units of Hha I endonuclease in 50 μΐ of the same buffer as for Hae III endonuclease digestion at 37 ° C for 2 hours. of chloroform after ethanol precipitation, the cleavage products are removed by polyacrylamide gel electrophoresis at a concentration of 6% (w / v%) as shown in Figure 4 (D).

Both fragments are washed, decanted and re-coupled by incubation in 20 μΐ 66 mmol tris-HCl pH 7.6, 6 mmol MgCl 2, 15 mmol dithiotheitol, 1 mmol ATP containing 20 µg / ml T4 DNA igase at 15 ° C for 2 hours. The reaction mixture was then diluted to 200 µl by the addition of 0.1 M sodium chloride, extracted with 1 volume of phenol / chloroform, and the DNA precipitated with 2 volumes of ethanol. The material is resuspended in 20 μΐ 10 mmol of tris-HCl, pH 8 with 1 'mmol of ethylenediaminetetraacetic acid, and the products are separated by 6% w / v polyacrylic gel electrophoresis (w / v%). Fig. 4 (CJ) The results of Fig. 4 (C) show that the 550 nucleotide fragment was reconstituted by this procedure. By pretreating with alkaline phosphatase, it was ensured that the two fragments were recombined after Hha I treatment in the original sequence. Other bands that can be seen in Figure 4 (C) were formed due to the formation of dimers between the fragments after Hha I digestion, since the formation of dimers cannot be prevented by alkaline phosphatase.

The band containing the 550 nucleotide fragment after reconstitution is excised from the gel and subjected to electrophoresis. Electrophoresis results are shown in Figure 4 (B). Figure 4 (A) shows double-stranded M13 DNA electrophoresis after Hae III digestion and 3-β labeling. Electrophoresis was performed on a 6% (w / v) polyacrylamide gel in 50 mM Tris-borate buffer pH 8 with 1 mmol ethylenediaminetetraacetic acid at 100 V for 2 hours. After electrophoresis, the gel is dried and autoradiography is performed.

Purity of the reconstituted 550 nucleotide HCS cDNA fragment

Isolated reconstituted HCS cDNA fragments after Hae III digestion were labeled 32p at the 5'-end using E. coli polynucleotide kinase enzyme after infection with bacteriophage T4 as described by Panet A. et al. Biochemistry 12, 5045 (1973). Polynucleotide kinase can be conveniently obtained. The fragment is then digested with Hha I or Hpa II in 50 μΐ with 6 mmol Tris-HCl, pH 7.6, 6 mmol MgCl ₂ , 6 mmol (mercaptoethanol at 37 ° C for 2 hours).

After subsequent extraction with an equal volume of phenol / chloroform, the DNA is precipitated with 2 volumes of ethanol at -70 ° C, resuspended in 20 μl of 10 mM Tris-HCl pH 8 and 1 mmol of ethylenediaminetetraacetic acid, followed by electrophoresis and the gel is deposited on an X-ray-sensitive film to detect the labeled fragments as described above.

The results are shown in FIG. 5 as a diagram. Figures 5 (B) and 5 (E) show the results obtained using 2 samples of a fragment of 550 nucleotides in length prior to treatment with a restriction enzyme. Figure 5 (C) shows the electrophoresis after Hpa I digestion and Figure 5 (D) shows the electrophoresis after Hpa II digestion.

The purity of the 550 nucleotide fragment was measured according to the intensity of the autoradiogram after restriction enzyme digestion and the quantitative determination of the radioactivity distribution in each of the two bands formed after digestion with two enzymes. . This measurement showed that purified reconstituted human HCS cDNA fragments after Hae III digestion had a purity of greater than 99%.

Example 4

This example describes the synthesis of a plasmid containing a nucleotide of 550 base pairs and containing most of the HCS code.

A 550 nucleotide HCS cDNA fragment was prepared with a purity greater than 99% as described in Example 3. The terminal 5'-phosphate groups were recovered in a reaction mixture containing 50 mmol of tris-HCl pH 8.5, 10 mmol MgCl ₂ , 0.1 mmol spermidine, 5 mmol / 3-mercaptoethanol, 5% glycerol [w / v] %) 333 pmol ATP, 5 units of T4 polynucleotide kinase, incubate the reaction mixture at 40 μΐ at 37 ° C for 2 hours. DNA was isolated from this reaction mixture by phenol extraction followed by ethanol precipitation. Specific decanucleotides are then ligated with EcoRI sites and the 5'-CCGAATTCGG-3 'sequence, prepared according to the above Scheller publication, to HCS DNA at a molar ratio of approximately 50: 1 in a mixture of 50 μ 66 mmol tris-HCl pH 7.6, 9 mmol MgCl ₂ , 15 mmol dithiothreitol, 1 mmol ATP and 20 µg / ml T4 DNA igase.

These decanucleotides are commonly obtainable. The mixture was incubated at 4 ° C for 18 hours, after which the reaction was stopped by extraction of a mixture of phenol and chloroform. The products obtained are precipitated with ethanol, redissolved in 50 μΐ 100 mmol NaCl, 50 mmol tris-HCl pH 7.6, 7 mmol MgCl ₂ , followed by digestion with 50 units of EcoRI endonuclease at 37 ° C for 2 hours. hours.

As a result of the action of this endonuclease, the decamers are cleaved at EcoRI sites, resulting in HCS cDNAs terminated by said cleavage, and, in addition, unreacted decanucleotides and decanucleotides that bind to each other. Since the digested decamers also contained EcoRI-terminated ends, so that recombination would compete with HCS cDNA, it was necessary to isolate the HCS cDNA by gel electrophoresis prior to reaction with the vector selected for transfer. The use of the aforementioned decanucleotides has the advantage that the HCS cDNA fragment can be isolated again from the plasmid in a form that is identical to the original fragment.

The vector to be used in this case was the bacterial plasmid pMB-9 with a molecular weight of 3.5 x 10 6 _{with a} single EcoRI site, prepared by the method described by Rodriguez RL, Bolivar. F., Goodman HM, Boyer HW and Betlach M. in ICN — UCLA Symposium Gn MoJecular and Genetic Biology, DP Wierlich, WJ Rutter, and CF Fox, Eds. (Cademic Press, New York, 1976), pp. 471-477.

Plasmids pMB-9 and pBR-322. used in Example 5 can be obtained in a conventional manner. Infection with E. coli pMB-9 means obtaining resistance to tetracycline. The incorporation of DNA into a site suitable for EcoRI treatment in pMB-9 does not affect tetracycline resistance or any other property of the plasmid. As a result, there is no genotypic difference between the recombinant and normal plasmid. The procedure is carried out by treating pMB-9 after treatment with EcoRI with alkaline phosphatase in the manner described in more detail in U.S. Pat. No. 4,264,731 and also in Ullrich et al., Supra.

Alkaline phosphatage acts to remove 5'-phosphate groups at the ends resulting from the EcoRI plasmid cleavage and thus cannot bind the plasmid DNA to each other, thereby ensuring that the ring structure and the desired transformation are only dependent upon to incorporate a DNA fragment containing a 5'-phosphorylated tail. Treatment with alkaline phosphatase is carried out in the reaction mixture using one enzyme unit per mg of plasmid DNA in 25 mmol of 1'ris-HCl pH 8 for 30 minutes at 65 ° C followed by phenol extraction to remove the phosphatase, the DNA then precipitated with ethanol . The binding of HCS cDNA to pMB-9, pretreated as above, is carried out in a 50 µl reaction mixture containing 60 mmol of tris-HCl pH 8, 10 mmol of O-mercaptoethanol, 8 mmol of MgCl ₂ , 10 to 50 ng of purified HCS cDNA and about 500 ng of plasmid DNA after digestion with EcoRI with 5'-dephosphorylated. ending. The reaction is initiated by addition of 5 µg / ml T4 DNA ligase and allowed to proceed at 15 ° C for 1 hour, then diluted to 0.25 ml with 120 mmol NaCl and 1 mmol ethylenediaminetetraacetic acid.

The diluted reaction mixture was then directly used to transform E. coli C-1776.

E. coli C-1776 is a strain that has been developed to work with recombinant DNA and has been confirmed by NIH as EK-2 under US state regulations. The strain can be conveniently obtained. Bacteria are grown in 150 ml of broth supplemented with 100 µg / ml diaminopimelic acid and 40 µg / ml thymine to a cell density of approximately 2 x 108. cells / ml. The cells are separated by centrifugation and washed with 60 ml of 10 mmol NaCl, centrifuged again and resuspended in 60 ml of transformation buffer consisting of 10 ml. mmol of tris-HCl pH 8, 140 mmol of NaCl, 75 mmol of CaCl ₂ . The cell suspension was maintained in ice for 15 minutes, the cells separated by centrifugation and resuspended in 1.5 ml of the same buffer. 0.5 ml of the cell suspension is then added to 0.25 ml of the diluted reaction mixture after binding and the resulting mixture is incubated for 15 minutes on ice, then transferred to 25 ° C for 4 minutes and then again. keeps 30 minutes in crushed ice. Then, 0.2 ml of cell suspension is applied directly to nutrient agar plates supplemented with 100 µg / ml DAP, 40 µg / ml thymine and 20 µg / ml tetracycline. In this way, 4 transformed colonies are obtained, all containing a 550 nucleotide stretch which has been released from the plasmid DNA by EcoRI or Hae treatment.

III.

The transformed clone, which was designated pHCS-1, was selected for sequence analysis. E. coli C-1776-pHCS-1 is grown for this purpose on a suitable nutrient medium, then plasmid DNA is isolated and digested with EcoRI endonuclease. A 550 base pair region was isolated from linear pMB-9 by electrophoresis on a 6% polyacrylamide gel and subjected to DNA sequence analysis as described in Maxam and Gilbert, supra. DNA subfragments from HCS were prepared by incubation with the restriction endonuclease Hpa II and the 5 'ends were labeled using ATP, labeled with z-р under the action of polynucleotide kinase. Following sequence analysis by the Maxam and Gilbert method, the nucleotide sequence of the HCS clone DNA is also determined. By comparing the known HCS amino acid sequence, it can be shown that the nucleotide sequence of 557 nucleotides is. part of the HCS mRNA code from. amino acids 24 to 191 and additionally contains 50 nucleotides of the 3'-untranslated region. The results of this procedure can be compared to those of Niall, H. D., Hogan, M. L., Sauer, R., Rosenblum, I.Y., and Greenwood, F. C., Proc. Nat. Acad. Sci. USA 68: 866 (1971). The primary structure of HCS mRNA by determining the DNA sequence of the cloned pHCS-1 fragment is shown in Table 3 along with the amino acid sequence, depending on the known genetic code. The amino acid sequence as it is derived from the nucleotide sequence is identical to the previously published amino acid sequence as determined by chemical means.

In this manner . It can be shown that the transfer of originally isolated HCS mRNA in vitro can be carried out very precisely and that the cloned HCS DNA fragment can also be subjected to very precise replication in the transformed bacterium.

Table 3 shows the nucleotide sequence of a single strand of HCS DNA from cloned pHCS-1. The numbers refer to the amino acid sequence starting at the amino-terminus. The DNA sequence corresponds to the HCS mRNA sequence except that the U site must be used in place of T in the mRNA. The position of amino acids 1 to 23 is also shown.

al-Gin-Thr-Val-Pro-Leu-Ser-Arg-Leu-Phe-Asp-His-Ala-Met-Leu-Glu-Ala-His-Arg-Ala-His-Gin-Leu

_Л 0 0 U 0 0 O) < CD 0 φ 0 <0 O) H O) < (Ό IH OT < 00 i <0 > < ii 0 E 0 0 < << 3 0 _f 0 3 0 Φ 0 7! <£ CD 0 0 O 0 Q 0 0 CD O ň < CD 0 0 H < 0 0 0 H ⁰⁰ Pm h C 0 0 0 0 ⁰ Φ 0 0 0 0 0 ot h H < <0 0 0 3 * £ 71 0 >> < ₇ ~! «Ϊ́ ® h H 0 0 0 > 0 ot 0 3 0 o 0 > < 0 0 0 < ⁰ 0 0 0 d O Φ ⁰ 0 0 73 ⁰ 0 ⁰ 0 00 Д ω 3 ⁰ ω <7 (Л < CD 0 <0 << 0 0 сл 0 0 0 00 X Φ 0 0 0 0 < ω h H 0 O 0 0 n 0 0 0 0 φ ο 0 Q 0 0 О) 0 0 < 3 0 H g 41 0 H < ⁰ 0 0 H 0 ⁰ Φ 0 >> < 0 0 - Η H 0 CL č ⁴ <

3 < 0 0 0) 0 ^-4 < > < % 0 0 0 Hh << 3 0 0 0 Φ 0 7h <C 0 0 0 0 ⁰ 0 0 0 3 <0 «0 O) U Φ 0 > 0 0 0 0 0 00 Cli 0 Q O) 0 0 o > < Λ < <0 0 ⁰ < η Η

CD

CD

0) ot 0 3 0 3 U> <Φ 0 φ 0 <0 0 0 U <

<o

0 ω

ω <

<O

OT <C <C <C 0 κ S?

Φ 0 O) <

ω <

<0 ot Εη <8 0 “<

<

0> .0 71 ⁰ ° а д ⁰ < ⁰ m0 <0 y φ 0 ot <

>, 0 ⁰

O

CD

Ή

CD ". 0 0 g

н <

> * <

<

O

H

O

H

O

C o

OD 0 o oo <0

0 0 Η 3 0 0 0 07 / no 41 0 Η Φ Η Φ 0 «< £ < Η < ~ < 0 0 0) 0 <0 <0

0) 0

- <5

3 0 0 (5 0 0 0 3 <7 41 < Φ 0 Φ 0 Λ Q 77 < 0 0 ω Η 01 0 Η < 0 0 3 <7 00 3 0 00 3 0 η < ⁰ ο <2 <ο <0 со Ρ 0 μΡ 0 <0 φ h 0 0 Φ Η 0 < 0 0 Ο ⁰ 41 Ε ⁴ Ά 0 Φ 0 >> < 0 0 0 Η ω 0 ω Ε — ι Η 0 <<C 3 0 φ 0 0 g 0 ьн < я ⁰ > 0 0 0 41 0 30 0 > 0 η ⁰ 0

0 0 φ 0 3 0 Я Д 0 3 > < 43 0 Φ 0 Я £ φ ⁰ 0 CL 0 0 0 ⁰ << 0

> 0 0> 0 0 0 <

^-1 C ^-1 !> 0

0 CD Q ω p

> 0 0 Η ω

<

O> 0.

• w 0 Φ Η S <

ot A h7 <7 0 0

O <

<<

0) 0 <

0 CD g ^ 0

0 Φ Eh 0 0

Φ 0 0 H P-ι 0

C <7

—0 ω <7m <<> 0

ω 0

X

7 <7

со 0> <bJ <

TAG GTGCCCGACTAGCATCCTGTGACCCCAGTGCCTCTCCTGGCC

Example 5

Describing . DNA purification in which the nucleotide sequence comprises the bulk of the code for HGH, together with the synthesis of a plasmid vector containing purified DNA and culturing a microorganism containing the DNA as part of its genetic machinery. In this case, HGH was purified in a manner essentially described for HCS in Example 3, with the exceptions set forth below.

Five benign human pituitary tumors were used, which were rapidly frozen in liquid nitrogen after surgical removal, tumors weighed 0.4 to 1.5 g, and after thawing homogenized in 4 M guanidinium thiocyanate containing 1 M mercaptoethanol using a buffer mixture maintained at pH 5.0 and at 4 ° C. The obtained homogenate was layered on 1.2 ml of 5.7 M CsCl containing 100 mmol of ethylenediaminetetraacetic acid and the resulting material was centrifuged at 37,000 rpm for 18 hours using an ultra centrifuge at 15 ° C.

During centrifugation, RNA settles at the bottom of the tube. Further purification using an oligo-dT column followed by sedimentation in a sucrose gradient is performed as follows. as described in Examples 1 and 3. Approximately 10% of RNA isolated in this way is a growth hormone code, as judged by incorporating a radioactive amino acid precursor into a material containing a growth hormone precipitating agent in a cellular system derived from wheat keys as described in Roberts Β. E. and Patterson Β. M., Proc. Nat. Acad. Sci. USA 70, 2330 (1973). Then, the single-stranded cDNA and the double-stranded cDNA were synthesized according to the method of Example 3.

Treatment with Hae III restriction endonuclease and alkaline phosphatase was then carried out as in Example 3. HGH cDNA, the obtained material was subjected to fractionation by gel electrophoresis. In this way a distinctly separated band is obtained at a position corresponding to a chain length of 550 nucleotides, which band is separated for further purification.

For further purification, the above method of dividing DNA into subfragments, each of which is purified separately, is used. Subsequently, the subfragments thus obtained are recombined as above, except that in the case of HGH, a Pvu II endonuclease is used to produce two subfragments of approximately 490 and 60 nucleotides in length. All of these restriction enzymes can be obtained in a conventional manner. After reconnection of both subfragments,. yields a product with a length of approximately 550 base pairs, the purity of the product being greater than 99%, as determined by further fractionation using four different restriction endonucleases.

The synthesis of the recombinant vector containing the HGH DNA to be transferred is essentially carried out. in the manner described in Example 4 except that different decanulootides and a different plasmid were used for this purpose. A decanucleotide with a Hind III site suitable for the sequence 5'-CCAAGCTTGG-3 'was used. After treatment with Hsu I, HGH cDNAs with corresponding ends could be obtained. Hsu I and Hind III have the same sites of action and are interchangeable. In this case, plasmid pBR-322 was used as the transfer vector. This plasmid confers resistance to the antibiotics ampicillin and tetracycline. In the case of the cleavage site. the enzyme Hind III incorporates DNA, reducing or disappearing resistance. against tetracycline. Thus, the recombinants for further growth on the plates were selected such that the plates contained ampicillin, whereas the recombinants did not grow on tetracycline at a concentration of 20 µg / ml. HGH cDNA was recombined with pBR-322 after treatment with alkaline phosphatase and digestion with Hsu I under conditions substantially identical to that of Hsu I. conditions described in Example 4.

The products of this reaction were used to transform E. coli C-1776 under the conditions described in Example 4. Seven colonies were isolated based on their ability to grow in the presence of ampicillin and their inability to grow in the presence. tetracycline, 5 of these 7 colonies contained the recombinant plasmid in which it was incorporated. a region of approximately 550 base pairs of HGH DNA. One of these. bacterial strains with pI-IGH-1, which contained HGH DNA as part of its genetic system, were grown in sufficient quantities to become a source of plasmid DNA, from which HGH DNA could be recovered by Hind III or Hsu I enzymes.

The HGH DNA thus isolated was subjected to sequence analysis after many replications as described in Example 4. The results are shown in Table 4 below.

Table 4 shows the sequence of nucleotides in a single strand of HGH DNA cloned by pHGH-1. The numbers refer to the amino acid sequence of HGH, starting at the amino-containing end. The DNA sequence corresponds to the mRNA sequence for HGH, with the difference that U must be used instead of T in mRNA.

oo

Mi ω <<<

Д ϋ 3ο gg ^J u φ 0 л Η Рн Ε ⁴ <0 Ε-ι

Η ng <

<

Гн Ф ω

Гн.

W Т-Н> 4 <ηΊ '

O

H

.. <> <

Гн φ GQ

СЛ

S <

0 а <

<о до _ Η <

<ο <0 0

000 ω ο <<

2η 2

Φ 0 ω <

000 °

<<

Й 0 φ Η 0 φ 0 £ 3 Η Рн η s4 0 0

Η 0

Ο Ο ω <

cd>

о Гн Рн os

Q <

<Н О

Φ kJ ω <<0 £ 0 >>< ⁿ <

<H 0 o

Ф ф h-q м

cd й

гП cd

Η

Μ со

£ у а О r-J < сл < ф н 0 0 << 0 0 сл 0 Гн 0 ·>? < Ф Q _г 5н 0 < сл н н н О * ^ О Гн 0 Гн О Гн О Ф О Рн č Рн 0 сл н Гн < « 2 н о £ ° 2 <со ь < 0 о Гн Н о сэ Ф о >> <н Ь Гн о Рн Q 0 н < cd ω Е- ^ а 0 2 н ф н <о НН < 0 Гн и д о < ф о Ф н 0 0 СЛ Н > -q ω Й < 3 о ^ω 0 3 3 О Ф н 00 0 О Ф Н Гн < гн ω £ 1 Н 2 ω Ф о PLI Н ^м н СЛ н

Ф kJ сл <<0

Гн Е ~ Н

НИ £ g> 0

СЛ <<<

Гн 0

Ф 0 CO <£

С0 СЛ <<0 t-4 Н

Ф 0 ω _н <0> 40

СО ° (3 µ, ω н

Μ

CM <

0 α

[Η 0 eg

Г Ο £ η 0 Η <

OU <2 <

<0

- Η <0

Рн

S ^с Рн Η ω Ei> s0 ^% H

H 0

C-ι

Л СЛ

O 0 H

ΪΗ

Η <

<

ω ο и .s о Гн Рн

Η <

οο Ο Γη ‘<

О Η

О

Η <

е <φ Η 0

ЙО ω <<<

>> <

^Γ 'Η

Η 0

Η Ο

Ο <<

ω <

<<

cd ω <0

Φ 0 Χ5 Η Рн Η cd η> 0 cd>

φ.-1

О

СМ г-1

Гн 0> 4 <н н

Й ° £ ° ь <

Й

0 сл 0 j <

- ²³ <

ω 0 £ н Н Рн [”<

2н - <

а <0 0> 40 0 0

Н 0 <

000 <8 о

Рн 0

Гн 0

Ф 0 СЛ <5 ^

0

Λ0

SS о о

0

Ф н

Гн 0 <<

⁰

0 + - · 0

Ф r <

OJ 0 φ '|

Price £ 3

H o ω

<

о со

000 2 0 <<

Φ и Д Η Рн η слΟ >> 0 ω η г

>> <Η ω н 0

40 й φ κ кД> 40 ^{θ ϋ} 0 ι <

<<

СЛ 0 сл

Ф kJ <

Η 0 <

Η <ο <0 ρυ ω <

<0

Η <

(Л £ 3 д сл <<

сл О

К 0

Гн Ф ω <Ο Η

- <<<

γ <<Д 0 Η <

Ο <0 ω <<0

Ο Ο £ 3 Η Ρπ η ω9 <

Ο

С сл »<rJ '

ÍH φ ^ω <

о оо ф 0 д н Рн н> 4 ^ я ° о о

СЛ н >> 0 0 Ь

Ф 0 ω <

О0 с · ² > о

Гн Е ~ <Ф QW н οο0 2 ° <0 ω Ο >> 0 0η _ώ ω Ο Ο - ° я Η> 0

Φ 0 <000 <0

Η

Η Η ~ <Η <

<

0> 0 сл 0 >> <

<00 сл <<0 sg <<<<<0 >> <

Ф кД φ £ ч Рн

Гн cd

Ο 0 0 Η Ο 0 Η 0 Η ω ο 0 <ο ω ω ω Η ο ο ο ο <0 Η 0 Η ω ο ο ο

0 Η 0 0 0 Ο 0 0 0 Η 0 <Η

The method of the invention first discloses the possibility of purifying a specific nucleotide sequence. These sequences are. can be isolated depending on the production of specific proteins of commercial or medical importance. By the method of the invention, it is possible to purify the nucleotide sequence, which may be a fragment of a longer sequence which encodes the desired protein. The method of the invention may be used in combination with known methods to produce a whole nucleotide sequence that is the genetic code for a particular protein.

In addition, the nucleotide sequence of a specific length derived from any material can be purified by the method of the invention. The purification can be carried out to a high degree and at the same time the purity of the fragment can be determined. The nucleotide sequence, which is the genetic code for a portion of human HCS, was isolated and purified by the method of the invention, and after purification the purity of the product was greater than 99%.

The method according to the invention also

Claims (2)

Subject A method of purifying a cDNA fragment having a specific nucleotide sequence suitable for recombination with a vector for transferring DNA and transfer to a microorganism from a population of cDNAs heterogeneous in length and sequence, wherein the purified fragment contains a minor proportion of the material and a portion of the cDNA containing the desired fragment has at least two restriction enzyme sites and is prepared from polyribonucleotides heterogeneous in length and sequence using a reverse transcriptase catalyzed reaction, characterized in that the cDNA is subjected to enzymatic hydrolysis specifically at said restriction sites by incubation in the reaction a blend containing a restriction endonuclease for which these sites are specific to form a cDNA fragment, after which the cDNA fragments are fractionated according to their length, followed by separation of the fragments into fractions containing fragments of homogeneous length, and then the fraction containing a cDNA fragment with the desired sequence of a specific desoxynucleotide. 2. The method of item 1 for purifying a cDNA fragment having a specific desono sequence to synthesize vectors to be transmitted comprising a major portion of the nucleotide sequence for HCS and a major portion of the nucleotide sequence encoding HGH. It is also possible to grow new strains of the micro - organism,. which contain the aforementioned genes or portions thereof. After many replication cycles, the above nucleotide sequences can be recovered from the microorganism, the sequences being substantially identical to the nucleotide sequences that exist in the organism that was the source of the sequence. Based on the genetic code, there is a limited number of nucleotide sequences that can be the genetic code for a given amino acid sequence. All of these equivalent nucleotide sequences can be used since each produces the same protein hormone with the same amino acid sequence during transcription and in vivo transfer. Accordingly, all variants of this type fall within the scope of the invention. ynAlezu of a xynucleotide containing a restriction site suitable for recombination with a vector for transferring DNA followed by transfer to a microorganism in which. starting from a fraction of fragments of homogeneous length and predominantly containing a cDNA fragment having a specific nucleotide sequence, characterized in that the 5'-phosphate end groups of the cDNA fragment are still hydrolyzed, then the cDNA fragments are enzymatically hydrolyzed specifically at restriction sites by incubating the reaction mixture containing of these restriction endonuclease fragments for which the sites are specific, the fractions of subfragments formed are fractionated according to their length, fractions containing both subfragments of the desired specific sequence of desoxynucleotides are isolated, and then the two subfragments are enzymatically recombined covalently. by binding the subfragment by incubating the reaction mixture containing DNA-11gase, ATP and both subfragments to form a cDNA fragment with a specific desoxynucleotide sequence and a ligase-treated cDNA is subjected to length fractionation followed by isolation of a fraction containing cDNA fragments with a specific nucleotide sequence.