CN1895036A - Production of pectinid with thelykaryon development characteristic and construction of pectinid pure system - Google Patents
Production of pectinid with thelykaryon development characteristic and construction of pectinid pure system Download PDFInfo
- Publication number
- CN1895036A CN1895036A CNA2006100769442A CN200610076944A CN1895036A CN 1895036 A CN1895036 A CN 1895036A CN A2006100769442 A CNA2006100769442 A CN A2006100769442A CN 200610076944 A CN200610076944 A CN 200610076944A CN 1895036 A CN1895036 A CN 1895036A
- Authority
- CN
- China
- Prior art keywords
- scallop
- gynogenesis
- species
- pure lines
- carry out
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
- Y02A40/80—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in fisheries management
- Y02A40/81—Aquaculture, e.g. of fish
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
A method for culturing the scallop with gynogenesis characteristics and fast creating a pure scallop line includes such steps as choosing different kinds of health scallops with mature sex gland, regulating the mature periods of male and female parents for synchronizing their sexual maturities, drying in air for stimulating the generation of spermatozoa and ova, fertilizing, culturing the larvae with gynogenetic characteristics, and screening the young scallops with 38 normal chromosomes.
Description
Technical field
The present invention relates to the shellfish seeding technique, be specifically related to the method that a kind of production has gynogenesis feature scallop and sets up the scallop pure lines fast.
Background technology:
Gynogenesis has a wide range of applications in the shellfish breeding, at first can obtain pure shellfish line fast, the hereditary basis of artificial gynogenesis is mainly from female parent, therefore its descendant has very high homozygosity, through gynogenesis several times, its filial generation just can be used as the production that pure lines are used for breeding and crossbreed.In combination during breeding, because the offspring constantly separates, obtain a stable kind and often take time very longly, utilize hybrid first filial generation or hybrid second filial to carry out gynogenesis, only need two, the three generations just can obtain stable strain, significantly reduced the time of breeding.And the shellfish with gynogenesis characteristics is to studying biological genetic structure analysis, gene location, and construction of genetic atlas, the functional gene clone, and carry out the genetic control of shellfish sex and basic genetics research or the like very important meaning is all arranged.
General fish, amphibian animal and shellfish artificial gynogenesis are with gamma-rays, x ray or ultraviolet irradiation sperm, destroy the genetic material of sperm, make ovum fertilization with such sperm, make the sperm genetic inactivation that enters ovum, ovum is able to gynogenesis and becomes the dliploid individuality under artificial condition such as the inferior condition of physicochemical irritation.Owing to make the processing of staining of sperm body inactivation, tend to cause gene mutation and early stage death of embryo and offspring's the low phenomenon of survival rate occurs.Produce genetics research and the shellfish breeding that the shellfish with gynogenesis characteristics can not satisfy shellfish and produce needs with these methods, and do not see in the research at present that success cultivates the report with gynogenesis characteristics dliploid adult scallop.
Summary of the invention:
The purpose of this invention is to provide a large amount of fast production and have a kind of method of gynogenesis characteristics scallop, with genetics research and shellfish breeding and the production needs that satisfy shellfish.
Method of the present invention is: propagating artificially under the condition, choose individual health, the scallop of the different plant species of gonadal maturation such as chlamys farreri, Chlamys nobilis, bay scallop, Patinopecten yessoensis etc., at first adjust the ripe cycle of male and female parent's scallop not of the same race, make its synchronous maturation be used for hybridization, produce sperm and ovum by dry in the shade stimulation parent shellfish again, rapidly the smart ovum between the xenogenesis is fertilized respectively, can obtain the larva individuality of 3%-20% with gynogenesis characteristics, under 22 ℃ of-23 ℃ of cultivating conditions, cultivate larva, group is commissioned to train and is educated the homozygosity analysis that can carry out chromosome analysis and gene loci to the high 2-3cm of shell, carry out the screening of chromosome live body by flow cytometer again, have 38 normal juvenile mollusks of chromosomal growth among the selective staining body karyotyping result, and further by the polymorphism analysis detection scallop homozygosity of 10 little satellites (SSR) sites (as table 1) detection technique and AFLP gene, checking obtains the scallop with gynogenesis characteristics of 90%-100%.The application that has the method for gynogenesis feature scallop as production is a large amount of fast scallop pure lines of producing.
This method has simply, quick and characteristics of high efficiency, and the offspring individual quantity that has the gynogenesis characteristics in the filial generation is many, is convenient to further carry out breeding and genetics research.The method of the pure lines that the present invention obtains can shorten the time of scallop breeding, makes things convenient for the genetics research of scallop, and is significant for quick breeding growth vigor and anti-adversity.
Embodiment
Method of the present invention is to choose individual health earlier, the scallop of the different plant species of gonadal maturation, for example, chlamys farreri, Chlamys nobilis, bay scallop or Patinopecten yessoensis etc., adjust the ripe cycle of male and female parent's scallop not of the same race, make its synchronous maturation be used for hybridization, 14 ℃-18 ℃ temporary supporting, management condition is with general scallop breeding before the close shellfish hybridization.Before hybridization, select well-grown, the scallop individuality of the different cultivars that gonad development is synchronous, put into different clean Cultivation containers after half an hour respectively through dry in the shade stimulation, notice preventing that sperm, ovum or the fertilized egg of other shellfishes from sneaking into, 17 ℃-20 ℃ of control ocean temperatures, make male and female parent shellfish produce ovum or sperm respectively, rapidly sperm and ovum not of the same race mixed fertilization respectively then, after fertilization is with the unnecessary sperm flush away in ovum surface, hatch fertilized egg under 18 ℃ of-20 ℃ of conditions of water temperature, 22 ℃-23 ℃ scallop larvas of cultivating after the hatching.Can obtain the scallop hybrid larva that 3%-20% has the gynogenesis characteristics this moment, and therefrom filter out the individuality with gynogenesis characteristics.
Different scallop interspecifics, of the same race quadrature and reciprocal cross, and different environmental conditions and manual operation meeting are influential to the individual ratio that has the gynogenesis characteristics in the hybrid generation.From the larva of different kind scallop filial generations, filter out the method for individuality: when the scallop hybrid generation grows into the high 2-3cm of shell with gynogenesis characteristics, carry out the analysis of scallop genetic purity, the live body scallop gill filament that takes a morsel carries out the analysis of chromosome karyomorphism and carries out chromosome live body screening by flow cytometer and carry out karyotyping, selection has 38 chromosomal growths and becomes shellfish normally, the gene pure degree that goes on foot 10 little satellites (SSR) site (the site primer sequence sees Table 1) of carrying out chlamys farreri of going forward side by side is analyzed and the polymorphism analysis of AFLP gene is found finally can obtain the scallop that 90%-100% has the gynogenesis characteristics.
To scallop different plant species intermolecular hybrid, after production has the offspring individual of gynogenesis characteristics, can set up the scallop pure lines fast, its method is by different scallop species A ♀ and species B ♂ filial generation are screened, cultivation has the offspring individual A1 of gynogenesis characteristics, further hybridize after the A1 maturation, obtain the A2 colony that homologous chromosome isozygotys more with A1 ♀ and species B ♂; Further carry out mating with A2 ♀ and A2 ♂ and breed, its filial generation can be built up pure lines or near-isogenic line.A2 ♀ and B ♂ are further hybridized, produce the A3 that homologous chromosome isozygotys more, carry out mating with A3 ♀ and A3 ♂ and breed and obtain its filial generation, promptly build up and be sheerly or near-isogenic line.
Step 1: ♀ A x ♂ B
A1
Step 2: ♀ A1 x ♂ B
A2
Step 3:(can further be hybridized): ♀ A2 x ♂ B
A3
Produce pure lines ♀ A2 x ♂ A2 → A2 or ♀ A3 x ♂ A3 → A3
Embodiment 1
Under the manual control condition, with female chlamys farreri and male luxurious scallop hybridization, produced 18% the filial generation young among the offspring with gynogenesis characteristics, 30%～70% energy normal growth in these filial generation young, carry out chromosome live body screening by flow cytometer, choose and have 38 pairs of chromosomal individualities and cultivate.These have 38 pairs of chromosomal scallops further bring up 2～3cm above after, detect by 10 couples of little satellite SSR, find that 100% filial generation scallop has the gynogenesis characteristics; The female shellfish of the scallop with gynogenesis characteristics that produces with hybridization further hybridizes with luxurious scallop again, its hybrid generation is carried out the screening of chromosome live body by flow cytometer, choose and have 38 pairs of chromosomal individualities and cultivate, find by 10 pairs of little satellite SSR detection site situation of isozygotying when supporting after more than 2～3cm, the pure and mild degree of allelomorph of hybridization back scallop is higher, again with these scallop cultures after sexual maturity, the male and female individuality is hybridized, and its filial generation both had been the chlamys farreri pure lines.
Under the manual control condition, with female chlamys farreri and male Patinopecten yessoensis hybridization, in the offspring, produced 20% the filial generation young with gynogenesis characteristics, 40%～80% energy normal growth in these filial generation young, carry out chromosome live body screening by flow cytometer, choose and have 38 pairs of chromosomal individualities and cultivate.These have 38 pairs of chromosomal scallops and further bring the above back of 2～3cm up by 10 pairs of little satellite SSR detections, find that 100% filial generation scallop has the gynogenesis characteristics; The female shellfish of the scallop with gynogenesis characteristics that produces with hybridization further hybridizes with Patinopecten yessoensis again, its hybrid generation is carried out the screening of chromosome live body by flow cytometer, choose and have 38 pairs of chromosomal individualities and cultivate, find by 10 pairs of little satellite SSR detection site situation of isozygotying when supporting after more than 2～3cm, the pure and mild degree of allelomorph of hybridization back scallop is higher, again with these scallop cultures after sexual maturity, the male and female individuality is hybridized, and its filial generation both had been the chlamys farreri pure lines.
Embodiment 2
Under the manual control condition, with female chlamys farreri and male Patinopecten yessoensis hybridization, in the offspring, produced 20% the filial generation young with gynogenesis characteristics, 40%～80% energy normal growth in these filial generation young, carry out chromosome live body screening by flow cytometer, choose and have 38 pairs of chromosomal individualities and cultivate.These have 38 pairs of chromosomal scallops and further bring the above back of 2～3cm up by 10 pairs of little satellite SSR detections, find that 100% filial generation scallop has the gynogenesis characteristics; The female shellfish of the scallop with gynogenesis characteristics that produces with hybridization further hybridizes with Patinopecten yessoensis again, its hybrid generation is carried out the screening of chromosome live body by flow cytometer, choose and have 38 pairs of chromosomal individualities and cultivate, find by 10 pairs of little satellite SSR detection site situation of isozygotying when supporting after more than 2～3cm, the pure and mild degree of allelomorph of hybridization back scallop is higher, again with these scallop cultures after sexual maturity, the male and female individuality is hybridized, and its filial generation both had been the chlamys farreri pure lines.
Table 1 is used for the standard microsatellite marker that chlamys farreri germ plasm resource is analyzed
| The site title | Primer sequence (5 '-3 ') | Annealing temperature (℃) | Repetitive | Allelomorph magnitude range (bp) | The allelomorph number | PIC |
| CFMSP002 AY682108 CFMSP003 AY682109 CFMSP006 AY682118 CFMSP007 AY682116 CFMSP011 AY682110 CFMSP075 DQ022568 CFMSM009 DQ104704 CFMSM014 DQ104705 CFMSM020 DQ104709 CFSSR001 AY164680 | F：CAACTTCGTCAGACAAATG R：GTAAAAGAACCCAAACACC F：CGACTCTGCCCCTAGTGTCTTC R：AACAAGGGTACTTCACGGTCGG F：CAGACTGTCGGTACTTGTC R：AAAGTCTGTACCTCTCTG F：CTGACAACCTGGTCAAAC R：GCGTTATCACAAGGAGAC F：GCAAAACCAACTCCTTCACAAC R：GGCGATATTCCACCTGACC F：GAGAAAGACTTCGTTCGTCG R：GGGACTTTCGTTTGGTACAGC F：GTAGTCACATGATGACATAGAG R：CACAACTCCGTCAATCATTCTC F：CATCTGATATGGCAGCTGATAC R：GAACTAACGAGGAGACAACTG F：CAAAGGCATTTGTAGGAAGGC R：ACGGCACTTCGTTGATTAAC F：CAGGAGACTTGCGATTTTACG R：TATGTTTAGACCACCCAC | 49 52 54 50 62 54 56 60 62 54 | A 9(CA) 7A 6... (CAAA) 7 (AGC) 9 (AC) 11 (CA) 8 (ACAAA) 5 (AC) 10CT (AC) 6 (AG) 4G(AG) 5 ...(AG) 5 (AG) 10... (AC) 4 (CAC) 11 (TTTA) 5 | 140-175 80-101 97-111 170-182 174-204 160-194 203-217 230-256 167-191 170-190 | 6 8 3 6 6 12 6 13 7 5 | 0.72 0.82 0.48 0.56 0.66 0.79 0.39 0.91 0.82 0.62 |
Claims (5)
1 one kinds of productions have the method for gynogenesis feature scallop, it is characterized in that propagating artificially under the condition, choose individual health, the scallop of the different plant species of gonadal maturation, at first adjust the ripe cycle of male and female parent's scallop not of the same race, make its synchronous maturation be used for hybridization, produce sperm and ovum by dry in the shade stimulation parent shellfish again, rapidly the smart ovum between the xenogenesis is fertilized respectively, obtain the larva individuality of 3%-20% with gynogenesis characteristics, under 22 ℃ of-23 ℃ of cultivating conditions, cultivate larva, group is commissioned to train and is educated the homozygosity analysis that can carry out chromosome analysis and gene loci to the high 2-3cm of shell, carry out the screening of chromosome live body by flow cytometer again, have 38 normal juvenile mollusks of chromosomal growth among the selective staining body karyotyping result, and further by the polymorphism analysis detection scallop homozygosity of 10 microsatellite locus detection techniques and AFLP gene, checking obtains the scallop with gynogenesis characteristics of 90%-100%.
2 one kinds of productions have the method for gynogenesis feature scallop, it is characterized in that as the application that production has a method of gynogenesis feature scallop be a large amount of fast scallops pure lines of producing.
3 one kinds of methods of setting up the scallop pure lines fast, it is characterized in that hybridizing with different scallop species, the offspring individual that acquisition has the gynogenesis characteristics obtains pure lines, promptly by different scallop species A ♀ and species B ♂ filial generation are screened, cultivation has the offspring individual A1 of gynogenesis characteristics, further hybridize after the A1 maturation, obtain the A2 colony that homologous chromosome isozygotys more with A1 ♀ and species B ♂; Further carry out mating with A2 ♀ and A2 ♂ and breed, its filial generation can be built up pure lines or near-isogenic line.
4 a kind of methods of setting up the scallop pure lines fast as claimed in claim 2, it is characterized in that making A2 ♀ and B ♂ further to hybridize, produce the A3 that homologous chromosome isozygotys more, carry out mating with A3 ♀ and A3 ♂ and breed and obtain its filial generation, promptly build up and be sheerly or near-isogenic line.
5 a kind of productions as claimed in claim 1 have the method for gynogenesis feature scallop, and the scallop that it is characterized in that above-mentioned different plant species is chlamys farreri, Chlamys nobilis, bay scallop, Patinopecten yessoensis.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2006100769442A CN100420375C (en) | 2005-10-09 | 2006-04-11 | Production of pectinid with thelykaryon development characteristic and construction of pectinid pure system |
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN200510104270.8 | 2005-10-09 | ||
| CN200510104270 | 2005-10-09 | ||
| CNB2006100769442A CN100420375C (en) | 2005-10-09 | 2006-04-11 | Production of pectinid with thelykaryon development characteristic and construction of pectinid pure system |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1895036A true CN1895036A (en) | 2007-01-17 |
| CN100420375C CN100420375C (en) | 2008-09-24 |
Family
ID=37607806
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNB2006100769442A Expired - Fee Related CN100420375C (en) | 2005-10-09 | 2006-04-11 | Production of pectinid with thelykaryon development characteristic and construction of pectinid pure system |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN100420375C (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102217561A (en) * | 2010-04-13 | 2011-10-19 | 中国科学院海洋研究所 | Method for preparing male sterile bodies of argopecten irradians |
| CN101712992B (en) * | 2009-09-22 | 2012-10-31 | 中国科学院南海海洋研究所 | Chlamys nobilis molecular marker with orange shell color and identification method thereof and kit |
| CN108633799A (en) * | 2018-01-21 | 2018-10-12 | 青岛海弘达生物科技有限公司 | The breeding method of female Patinopecten yessoensis and male Alaska scallop first-filial generation commodity offspring seed |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP3635187B2 (en) * | 1997-03-29 | 2005-04-06 | 鳥取県 | Method of breeding flounder using completely homozygote, method of raising flounder and flounder |
| CN2633017Y (en) * | 2003-07-04 | 2004-08-18 | 中国海洋大学 | Ultraviolet radiator for shellfish sperm |
-
2006
- 2006-04-11 CN CNB2006100769442A patent/CN100420375C/en not_active Expired - Fee Related
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101712992B (en) * | 2009-09-22 | 2012-10-31 | 中国科学院南海海洋研究所 | Chlamys nobilis molecular marker with orange shell color and identification method thereof and kit |
| CN102217561A (en) * | 2010-04-13 | 2011-10-19 | 中国科学院海洋研究所 | Method for preparing male sterile bodies of argopecten irradians |
| CN102217561B (en) * | 2010-04-13 | 2013-12-18 | 中国科学院海洋研究所 | Method for preparing male sterile bodies of argopecten irradians |
| CN108633799A (en) * | 2018-01-21 | 2018-10-12 | 青岛海弘达生物科技有限公司 | The breeding method of female Patinopecten yessoensis and male Alaska scallop first-filial generation commodity offspring seed |
| CN108633799B (en) * | 2018-01-21 | 2021-09-10 | 青岛海弘达生物科技有限公司 | First-filial generation cultivation method for female patinopecten yessoensis and male alaska scallop |
Also Published As
| Publication number | Publication date |
|---|---|
| CN100420375C (en) | 2008-09-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102318571B (en) | Culture method of hybrid new variety of Argopecten irradias and Argopecten purpuratus | |
| CN102301971B (en) | Method for breeding novel hybrid scallop variety of Argopecten purpuratus and Argopecten irradians irradians | |
| CN102301968B (en) | Method for cultivating new variety of hybridized and backcrossed Argopecten purpuratus | |
| CN102308770B (en) | Breeding method for new marine backcrossed scallop variety | |
| Klekowski Jr | Genetic load in Osmunda regalis populations | |
| CN104255599B (en) | A kind of breeding method of Han Mo scallop hybrid | |
| CN105165679B (en) | The foundation of three supporting breeding lines of megalobrama amblycephala and selection | |
| CN104186388B (en) | The construction method of the purple scallop hybrid three series mating breeding system in sea and application | |
| CN114208735B (en) | Method for cultivating rapid-growth new strain of hong Kong oyster triploid by backcross breeding technology | |
| AU2021104593A4 (en) | Cultivation method of first-generation commercial seed hybrids of female Patinopecten caurinus and male Patinopecten yessoensis | |
| CN100420375C (en) | Production of pectinid with thelykaryon development characteristic and construction of pectinid pure system | |
| CN100425125C (en) | Laver quick breeding method | |
| CN104206334B (en) | The method of cultivation of a kind of ink Korea Spro's scallop hybrid | |
| CN102783445A (en) | Method for breeding full-feminization rainbow trout | |
| CN104304098B (en) | The construction method of purple extra large scallop hybrid restorer and application | |
| CN104160998B (en) | The construction method of purple extra large scallop hybrid male sterile line and application | |
| CN108522378B (en) | Cultivation method of first-filial-generation commercial offspring seeds of female Arragana scallop and male Patinopecten yessoensis | |
| CN104206325B (en) | The construction method of purple extra large scallop hybrid three series mating breeding system and application | |
| CN105746388A (en) | Double-screening and double-inducing technology system for building disease-resistant grass carp pure line | |
| CN108244007B (en) | Method for breeding new hybrid variety of female patinopecten yessoensis and male alaska scallop | |
| CN108541636B (en) | Method for breeding new hybrid variety of female Arragana scallop and male Patinopecten yessoensis | |
| CN116406649B (en) | Method for improving genetic diversity of oyster tetraploid and constructing tetraploid stable group line | |
| CN104206327B (en) | The construction method of purple extra large scallop hybrid maintainer and application | |
| CN104145861A (en) | Black sea bream and red porgy hybridization insemination method | |
| CN104255587B (en) | The construction method of the purple scallop hybrid maintainer in sea and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20080924 |