CN1803834A - Antibacterial peptide of brown-spotted torrential frog, its gene and application in drug preparation - Google Patents
Antibacterial peptide of brown-spotted torrential frog, its gene and application in drug preparation Download PDFInfo
- Publication number
- CN1803834A CN1803834A CN 200610010627 CN200610010627A CN1803834A CN 1803834 A CN1803834 A CN 1803834A CN 200610010627 CN200610010627 CN 200610010627 CN 200610010627 A CN200610010627 A CN 200610010627A CN 1803834 A CN1803834 A CN 1803834A
- Authority
- CN
- China
- Prior art keywords
- antibacterial peptide
- amolops loloensis
- loloensis
- amolops
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Peptides Or Proteins (AREA)
Abstract
The invention relates to an Amolops loloensis antibiotic peptide, its genes and use in pharmacy, wherein the antibiotic peptide is a single-chain polypeptide encoded by Amolops loloensis gnens, a Chinese amphiphyte, the molecular weight is 2666.4 Da, the isoelectric point is 9.70, the primary structure of the polypeptide sequence is: Phe Leu Pro Met Leu Ala Gly Leu Ala Ala Asn Phe Leu Pro Lys Leu Phe Cys Lys Ile Thr Lys Lys Cys-AMID. The gene that encodes the Amolops loloensis antibiotic peptide comprises 442 nucleotides, among which position No:247-318 nucleotides encode the ripened Amolops loloensis antibiotic peptide. The artificially synthesized Amolops loloensis antibiotic peptide has appreciable actions for inhibiting growth of bacteria and fungus, thus can be used as the medicament for treating diseases infected by pathogenic microorganism.
Description
Technical field:
The present invention relates to a kind of amolops loloensis (Amolops loloensis) antibacterial peptide and gene and the application in pharmacy, belong to biomedical sector.
Background technology:
Since the microbiotic invention, the mankind have obtained bigger achievement in control and treatment infected by microbes disease.But the lasting use along with " traditional microbiotic " constantly produces many new problems.At present, the microorganism resistance has become the significant problem that Clinical microorganism catches and treats, to such an extent as to some pathogenetic bacteria has not had a line medicine of clinical treatment.It all is worldwide clinical difficult problems at present that the staphylococcus of vancomycin resistance, faecalis and other Gram-negatives catch, three classes cause that mainly strong resistance has also appearred in meningitic bacterium clinically, anti-penicillin, paraxin meningococcus, streptococcus pneumoniae, antibiotic streptococcus pneumoniae also extensively occurs the antagonism cephalosporin.Therefore the antibiotic development of new class has become the task of top priority and international focus.Discover that peptide antibiotics has broad-spectrum antibacterial activity, have " traditional microbiotic " incomparable superiority simultaneously: as when the least action concentration, fast and wide spectrum ground killing microorganisms (comprising present clinical anti-medicine bacterium); Fungi also there is restraining effect; Can not induce the generation of drug resistance strain; All effective for local infection and systemic infection, promise to be antiseptic-germicide of new generation, its development is subjected to extensive attention at present.
A lot of amphibian animals belong to traditional Chinese medicine and national medicine and widespread use in China, as Chinese toad (Bufo gargarizans), Bombina maxima (Bombina maxima), Rana nigromaculata (pelophylaxnigromaculata), Rana guentheri (Hylarana guentheri) and rana limnocharis (Euphlyctislimnocharis) etc.The skin of these amphibian animals and internal organ have pharmacologically active and clinical efficacy widely.Reported that pharmacologically active has wide spectrum anti-microbial effect, antitumor, analgesia, toponarcosis, immunomodulatory, cardiovascular systems effect etc.Abroad, the searching of the specific pharmacology reactive monomer of batrachians skin compound has been the focus of new drug invention.According to domestic and foreign literature, separated obtaining different antibacterial peptides from various biogenetic derivations, and some has entered clinical treatment.Antibacterial peptide Magainin tool wide spectrum anti-microbial effect as obtaining from Xenopus laevis (Xenopus laevis) skin juice has anti-tumor activity simultaneously, has got permission as extensive pedigree antibiotic in the U.S., and it is clinical that its gene engineering product entered for three phases; The antibacterial peptide IB-367 that Intrabiotics company produces has got permission to be used for the treatment of cancer patient and has infected stomatocace one clinical trial phase that causes because of various bacteria; Applied Microbiology company and the cooperation of Astra company also obtain good curative effect with the clinical trial of antibacterial peptide nisin treatment stomach ulcer.
There is long history in China to the application of batrachians medicine, but the research of its activeconstituents and pharmacological properties is mainly concentrated on organic molecules such as alkaloid, and is few to its skin activity peptide matters research.Amolops loloensis (Amolops loloensis) mainly is distributed in Sichuan, Yunnan Province, is one of China characteristic resources animal.
The contriver searches comparison with amolops loloensis antibacterial peptide complete sequence amino acid structure of the present invention through Protein Data Bank, finds no any phase homopolypeptide.The contriver searches comparison with amolops loloensis antibacterial peptide encoding gene of the present invention through gene database, finds no any homologous genes.
Summary of the invention:
The object of the present invention is to provide a kind of new the amolops loloensis antibacterial peptide with wide spectrum antimicrobial (comprising gram-negative, positive bacteria, fungi) and gene and the application in pharmacy.
In order to realize purpose of the present invention, the invention provides following technical scheme:
The amolops loloensis antibacterial peptide:
The amolops loloensis antibacterial peptide is a kind of single chain polypeptide of Chinese batrachians amolops loloensis antibacterial peptide gene coding, molecular weight 2666.4 dalton, iso-electric point 9.70, polypeptide complete sequence primary structure is: Phe Leu Pro Met LeuAla Gly Leu Ala Ala Asn Phe Leu Pro Lys Leu Phe Cys Lys Ile Thr Lys Lys Cys-AMIDATION.
The clone of amolops loloensis antibacterial peptide gene comprises:
The total RNA of amolops loloensis skin extracts, the mRNA purifying, and mRNA reverse transcription and cDNA library construction, the design primer utilizes PCR method screening amolops loloensis antibacterial peptide gene.Amplimer length is 25 Nucleotide, and its sequence is 5 ' ATAAGACATCTGATGTGCATTTAGC 3 ', and another amplimer of PCR is the SMART of CLONTECH company
TM5 ' PCR Primer primer among the cDNA Library Construction Kit, its sequence is 5 ' AAGCAGTGGTATCAACGCAGAGT 3 '.The positive monoclonal that obtains carries out gene nucleotide series and measures.Gene sequencing result shows that the gene of coding amolops loloensis antibacterial peptide is made up of 442 Nucleotide, holds to 3 ' terminal sequence from 5 ' to be:
taagcagtgg tatcaacgca gagtggccat tacggccggg ggagacctcc actgaagtct 60
tccagctctc tacattctca gcaccaactg aaccacccga gcccaaagat gttcaccttg 120
aagaaatcca tgttactcct tttcttcctt gggaccatca acttatctct ctgtgagcaa 180
gagagaaatg cagatgagga agaaagaaga gatgatgatg aaatggatgt tgaagtggaa 240
aaacgatttt taccaatgtt ggccggtctg gctgctaatt tcttgccaaa attattttgt 300
aaaataacca aaaaatgttg aaactctgga attggaaatc atctgatgtg gaatatcatt 360
tagctaaatg cacatcagat gtcttataaa aaaataaaga tatctcaaac atcaaaaaaa 420
aaaaaaaaaa aaaaaaaaaa aa 442
The ripe antibacterial peptide of coding amolops loloensis is a 247-318 position Nucleotide, and its aminoacid sequence is:
Phe Leu Pro Met Leu Ala Gly Leu Ala Ala Asn Phe Leu Pro Lys Leu Phe
1 5 10 15
Cys Lys Ile Thr Lys Lys Cys-AMIDATION。
20
The amolops loloensis antibacterial peptide gene prepares the application of amolops loloensis antibacterial peptide as genetically engineered.
The preparation method of amolops loloensis antibacterial peptide:
Infer according to the gene of coding amolops loloensis antibacterial peptide and the aminoacid sequence of amolops loloensis antibacterial peptide to synthesize its complete sequence with automatic multi-joint synthesizer.By the anti-phase C of HPLC
18Column chromatography desalination, purifying.Identify its purity with the HPLC method then, molecular weight determination adopts fast atom bombardment mass spectroscopy(FABMS) method (Fast atom bombardmentmass spectrometry, FAB-MS), isoelectric focusing electrophoresis is measured iso-electric point, measures the aminoacid sequence structure with automatic Protein Sequencer.
The amolops loloensis antibacterial peptide has the effect of significant inhibition bacterium and fungal growth, can be used as preparation cause pathogeny imcrobe infection treatment of diseases medicine and is employed.
Beneficial effect of the present invention is:
By amolops loloensis antibacterial peptide encoding gene its amino acid structure of deriving, synthetic amolops loloensis antibacterial peptide has the effect of significant inhibition bacterium and fungal growth.The beneficial features that this amolops loloensis antibacterial peptide has is simple in structure, synthetic convenient, antibiotic pedigree is wide.
Embodiment:
Embodiment one:
Amolops loloensis antibacterial peptide gene clone:
I, the total RNA of amolops loloensis skin extracts:
A. live body amolops loloensis water cleans up, and puts into the liquid nitrogen quick-frozen 4 hours, gets skin histology, weigh, get the 300mg skin histology, add the total RNA of 10ml and extract damping fluid (Trizol solution, U.S. GIBCOBRL company product), homogenate is 30 minutes in the 20ml glass homogenizer
B. add equal-volume phenol/chloroformic solution,, violent mixing, room temperature was placed 10 minutes, and 4 ℃, centrifugal 10 minutes of 12000rpm, reject precipitation.
C. supernatant adds isopyknic Virahol, and room temperature was placed 10 minutes, and 4 ℃, centrifugal 10 minutes of 12000rpm, precipitation is washed once with 75% ethanol, dries, and pipe end throw out is the total RNA of amolops loloensis skin.
II, the purifying of amolops loloensis skin mRNA:
The PolyATtract of U.S. PROMEGA company is adopted in amolops loloensis skin mRNA separation and purification
MRNA Isolation Systems test kit.
A. get the total RNA 500 μ g of amolops loloensis skin and be dissolved in the 500 μ l DEPC water, put into 65 ℃ of water-baths 10 minutes, add Oligo (dT) probe and 13 μ l, the 20 * SSC solution of people 3 μ l, mixing is placed the room temperature cooling, is called A liquid.
B. magnetic bead (the washing of (SA-PMP): magnetic bead is flicked mixing,, abandon supernatant, add 0.5 * SSC 0.3ml,, add 0.1ml 0.5 * SSC at last and suspend, be referred to as B liquid to magnetic force frame absorption 30 seconds to magnetic force frame absorption 30 seconds.
C. A liquid is added in the B liquid, room temperature was placed 10 minutes, to magnetic force frame absorption 30 seconds, abandon supernatant, with 0.1 * SSC washing 4 times, abandon supernatant at last, add 0.1ml DEPC aqueous suspension, to the magnetic force frame, adsorbed 30 seconds, supernatant is moved to new test tube, add 0.15ml DEPC water again and suspend again, to magnetic force frame absorption 30 seconds, moving supernatant to above-mentioned test tube, then is the amolops loloensis skin mRNA of purifying in the supernatant.
D. add 1/10 volume 3M sodium acetate, pH5.2, the equal-volume Virahol, in-70 ℃ of placements 30 minutes, 4 ℃, centrifugal 10 minutes of 12000rpm abandoned supernatant, and resolution of precipitate is in 10 μ l DEPC water.
III, amolops loloensis skin cDNA library construction:
Adopt the CLONTECH Creator of company
TMSMART
TMCDNA Library Construction Kit Construction of Plasmid cDNA Library test kit.
A.cDNA first chain synthesizes (mRNA reverse transcription):
1. add 1 μ l amolops loloensis skin mRNA, 1 μ l SMARTIV oligonucleotide, 1 μ l CDS III/3 ' PCR primer at the aseptic centrifuge tube of 0.5ml, add 2 μ l deionized waters and make cumulative volume reach 5 μ l.
2. the reagent in the mixing centrifuge tube is also of short duration centrifugal, and 72 ℃ are incubated 2 minutes.
3. centrifuge tube was hatched on ice 2 minutes.
4. in centrifuge tube, add following reagent 2.0 μ l 5 * the first chains buffering, 1.0 μ l 20mM dithiothreitol (DTT), 1.0 μ l 10mM dNTP mixtures, 1.0 μ l PowerScript ThermoScript II.
5. reagent and of short duration centrifugal in the mixing centrifuge tube is incubated 1 hour at 42 ℃.
6. centrifuge tube is placed and end the synthetic of first chain on ice.
7. it is standby to get the 2 synthetic cDNA of μ l institute, first chain from centrifuge tube.
B. adopt long terminal polymerase chain reaction (LD-PCR) method second chain that increases
1.95 ℃ preheating PCR instrument.
2. 2 μ l cDNA, first chains (mRNA reverse transcription), 80 μ l deionized waters, 10 μ l, 10 * Advantage 2PCR buffering, 2 μ l, 50 * dNTP mixture, 2 μ l, 5 ' PCR primer, 2 μ l CDS III/3 ' PCR primers and 2 μ l Escherichia coli polymerase centrifuge tubes are reacted.
3. in the PCR instrument, increase by following program:
1. 95 ℃ of 20 second
2. 22 circulations:
95 ℃ of 5 second
68 ℃ 6 minutes
4. after the loop ends, synthetic cDNA two strands in the centrifuge tube is carried out extracting.
The C.PCR product Wizard of PROMEGA company
SV Gel and PCR Clean-UpSystem test kit carries out extracting and reclaims, and step is as follows:
1. will put upside down mixing by the isopyknic film binding buffer of the double-stranded adding of the cDNA that PCR obtains, will mix liquid then and change the centrifugal purification post over to, room temperature left standstill 5 minutes, and DNA is fully combined with pellosil.16, centrifugal 1 minute of 000g outwells the waste liquid in the collection tube.
2. the elutriant (containing ethanol) that adds 700 μ l in the centrifugal purification post, 16, centrifugal 1 minute of 000g outwells the waste liquid in the collection tube.
3. repeating step 2.
4.16, centrifugal 5 minutes of 000g.
5. the centrifugal purification post is placed new centrifuge tube.
6. add 30 μ l ultrapure waters, at room temperature left standstill 5 minutes.
7.16, centrifugal 1 minute of 000g, pipe end solution is the cDNA two strands of purified mistake.
D. the preparation of bacillus coli DH 5 alpha competent cell:
1. the single DH5 α of picking bacterium colony is inoculated in 3ml and does not contain in the LB substratum of penbritin, and 37 ℃ of overnight incubation are got above-mentioned bacterium liquid next day and are inoculated at 1: 100 in proportion in the 50ml LB nutrient solution, and 37 ℃ vibrated 2 hours.Work as D
600Value reaches at 0.35 o'clock, the results bacterial cultures.
2. bacterium is transferred in aseptic, disposable, the ice-cold 50ml polypropylene tube, 10min puts in the side on ice, makes culture be cooled to 0 ℃.
In 4 ℃ with the centrifugal 10min of 4100r/min, to reclaim cell.
4. pour out nutrient solution, pipe is inverted 1min so that last trace nutrient solution flows to end.
5. the 0.1mol/L CaCl of every 50ml initial incubation liquid and 30ml precooling
2-MgCl
2Solution (80mmol/L MgCl
2, 20mmol/L CaCl
2) resuspended every part of cell precipitation.
In 4 ℃ with the centrifugal 10min of 4100r/min, to reclaim cell.
7. pour out nutrient solution, pipe is inverted 1min so that last trace nutrient solution flows to end.
8. every 50ml initial incubation thing ice-cold 0.1mol/L CaCl of 2ml
2Resuspended every part of cell precipitation, standby after the packing.
E. the enzyme conversion cutting, connect and connect product:
1. add 1 μ l Takara pMD18-T carrier, the double-stranded solution of 4 μ l amolops loloensis cDNA in Eppendorf tube, full dose is 5 μ l.
2. the ligase enzyme buffer mixture that adds 5 μ l (equivalent).
3.16 ℃ reaction 2 hours.
4. full dose (10 μ l) is added in the 100 μ l DH5 α competent cells, places 30 minutes in the ice.
5.42 after 90 seconds of ℃ heating, in ice, placed 1 minute again.
6. add 37 ℃ of LB substratum 890 μ l of bathing of temperature, 37 ℃ of slow shaking culture 60 minutes.
7. get 200 μ l and coat on the LB substratum that contains X-Gal, IPTG, Amp 37 ℃ and cultivated 16 hours, form single bacterium colony.
8. each LB plate washs bacterium colony with 5ml LB liquid nutrient medium, and it is frozen to add 30% glycerine.The cDNA that makes up approximately contains 1 * 10
6Individual independent clone.
IV, amolops loloensis antibacterial peptide gene colony screening:
Amplimer length is 25 Nucleotide, and its sequence is 5 ' ATAAGACATCTGATGTGCATTTAGC 3 ', and another amplimer of PCR is the SMART of CLONTECH company
TM5 ' PCR Primer primer among the cDNA Library Construction Kit, its sequence is 5 ' AAGCAGTGGTATCAACGCAGAGT 3 '.
The PCR reaction is carried out under the following conditions: 94 ℃ of 30 second, 52 ℃ of 45 second and 72 ℃ of 2 fens 30 seconds, 35 circulations.
The bacterium cDNA library that makes up of titration at first, be diluted to suitable bacterial concentration (about 5000 bacteria/milliliters with the LB substratum that contains 100 μ g/ml penbritins then, be respectively applied for first run screening second with 30 bacteria/milliliters and take turns screening), on 96 well culture plates by 8 * 8 matrix bed boards (totally 64 holes, every hole 100 μ l), 37 ℃ of incubated overnight.Merge inoculum respectively by row, column, have 16 samples to carry out PCR and identify that the positive hole bacteria samples of intersecting enters second and takes turns screening.
V, amolops loloensis antibacterial peptide gene sequencing and result:
Extract plasmid DNA and measure nucleotide sequence with dideoxy method, use instrument to be the full-automatic nucleotide sequencing instrument of U.S. AppliedBiosystems373A, sequencing primer is BcaBEST
TMSequencingPrimer RV-M and BcaBEST
TMSequencing Primer M13-47.BcaBEST
TMSequencingPrimer RV-M sequence: 5 ' GAGCGGATAACAATTTCACACAGG 3 ', BcaBEST
TMSequencing Primer M 13-47:5 ' CGCCAGGGTTTTCCCAGTCACGAC 3 '.Gene sequencing result from 5 ' end to 3 ' terminal sequence is:
taagcagtgg tatcaacgca gagtggccat tacggccggg ggagacctcc actgaagtct 60
tccagctctc tacattctca gcaccaactg aaccacccga gcccaaagat gttcaccttg 120
aagaaatcca tgttactcct tttcttcctt gggaccatca acttatctct ctgtgagcaa 180
gagagaaatg cagatgagga agaaagaaga gatgatgatg aaatggatgt tgaagtggaa 240
aaacgatttt taccaatgtt ggccggtctg gctgctaatt tcttgccaaa attattttgt 300
aaaataacca aaaaatgttg aaactctgga attggaaatc atctgatgtg gaatatcatt 360
tagctaaatg cacatcagat gtcttataaa aaaataaaga tatctcaaac atcaaaaaaa 420
aaaaaaaaaa aaaaaaaaaa aa 442
The sequence table of amolops loloensis antibacterial peptide gene Nucleotide is: sequence length is 442 bases, sequence type: nucleic acid, chain number: strand, topology: straight chain shape, sequence kind: cDNA, source: amolops loloensis skin.
The ripe antibacterial peptide of coding amolops loloensis is a 247-318 position Nucleotide, and its aminoacid sequence is:
Phe Leu Pro Met Leu Ala Gly Leu Ala Ala Asn Phe Leu Pro Lys Leu Phe
1 5 10 15
Cys Lys Ile Thr Lys Lys Cys-AMIDATION。
20
The amolops loloensis antibacterial peptide has the effect of significant inhibition bacterium and fungal growth, can be used as preparation cause pathogeny imcrobe infection treatment of diseases medicine and is employed.
Embodiment two:
Preparation amolops loloensis antibacterial peptide:
The preparation method of I, amolops loloensis antibacterial peptide: infer according to the gene of coding amolops loloensis antibacterial peptide and the aminoacid sequence of amolops loloensis antibacterial peptide to synthesize its complete sequence with automatic Peptide synthesizer.By the desalination of the anti-phase C18 column chromatography of HPLC, purifying.
II, molecular weight determination adopt the fast atom bombardment mass spectroscopy(FABMS) method, and (Fast atom bombardment massspectrometry, FAB-MS), with glycerine: m-nitrobenzyl alcohol: methyl-sulphoxide (1: 1: 1, V: V: V, volume ratio) is a substrate, Cs
+As projectile, electric current is 1 μ A, and emission voltage is 25Kv.
The amolops loloensis antibacterial peptide of III, purifying is identified its purity with the high-efficient liquid phase chromatogram HPLC method, and molecular weight determination adopts the fast atom bombardment mass spectroscopy(FABMS) method, and isoelectric focusing electrophoresis is measured iso-electric point, measures the aminoacid sequence structure with automatic Protein Sequencer.
The amolops loloensis antibacterial peptide is a kind of single chain polypeptide of Chinese amphibian animal amolops loloensis antibacterial peptide gene coding, molecular weight 2666.4 dalton, iso-electric point 9.70, polypeptide amino acid complete sequence primary structure is: Phe-Leu-proline(Pro)-methionine(Met)-leucine-L-Ala-glycine-leucine-Ala-Ala-l-asparagine-phenylalanine--leucine-proline(Pro)-Methionin-Isoleucine-Threonine-Methionin-Methionin-amidation halfcystine (Phe Leu Pro Met Leu Ala Gly Leu Ala Ala Asn Phe Leu Pro Lys Leu PheCys Lys Ile Thr Lys Lys Cys-AMIDATION).
Embodiment three:
The effect of amolops loloensis antibacterial peptide bacteria growing inhibiting:
Anti-microbial activity detects, and adopts cylinder plate method, and substratum is the plain agar substratum.The substratum 20ml that injects heating and melting respectively as bottom, makes its even stand cloth at the bottom of the ware, after solidifying in plate, after other gets an amount of heating and melting of substratum, in every ware, add the 5ml bacteria suspension respectively, shake up, make it on bottom, evenly spread out cloth, as the bacterium layer.After the cooling, evenly put into 6 of disinfectant stainless steel cups in the plate moderate distance.First steel bowl adds the testing compound solution 0.1ml of 0.1-0.3mg/ml concentration, and all the other steel bowls adopt doubling dilution to add sample liquid, and the inhibition zone size is observed in 37 ℃ of cultivations.Inhibition zone 10mm above as minimal inhibitory concentration (minimal inhibitory concentration, MIC).Bacterial isolates derives from No.1 Hospital Attached to Kunming Medical College, and this test repeats four times, averages result such as table 1.
Table 1, the effect of amolops loloensis antibacterial peptide bacteria growing inhibiting:
| Bacterial strain | Minimal inhibitory concentration (ug/ml) |
| The amolops loloensis antibacterial peptide | |
| Intestinal bacteria ATCC25922, (Escherichia coli ATCC25922) streptococcus aureus ATCC2592, (Staphylococcus auneus ATCC2592) | 4.2 21.5 |
| Pseudomonas aeruginosa CMCCB10104 (Pseudomonas aeruginosa CMCCB10104) pneumococcus (Klebsiella pneumoniae) bacillus megaterium (Bacillus megaterium) hay bacillus (Bacillus subtilis) | 9.5 25.4 15.6 3.5 |
By table 1 as seen, synthetic amolops loloensis antibacterial peptide has the effect of significant bacteria growing inhibiting.
The amolops loloensis antibacterial peptide suppresses the effect of fungal growth:
Anti-mycotic activity detects and adopts cylinder plate method, and substratum is improvement husky Bao Shi (Sabousand) substratum.Inject respectively substratum 20ml that heating dissolves in plate as bottom, make its even stand cloth at the bottom of ware, get an amount of heating of substratum after solidifying in addition and dissolve, in every ware, add the 5ml bacteria suspension respectively, shake up, make its even stand cloth on bottom, as the bacterium layer.After the cooling, put into 5 of disinfectant stainless steel cups in the plate moderate distance.First steel bowl adds the testing compound solution 0.1ml of 0.3mg/ml concentration, and all the other steel bowls adopt doubling dilution to add sample liquid, and the inhibition zone size is measured in 37 ℃ of cultivations behind the 24h-48h.Inhibition zone 10mm above as minimal inhibitory concentration (minimal inhibitory concentration, MIC).Bacterial isolates derives from institute of microbiology of Yunnan University, this experiment do three parallel, get geometrical mean, result such as table 2.
Table 2. amolops loloensis antibacterial peptide suppresses the effect of fungal growth:
| Bacterial strain | Minimal inhibitory concentration (ug/ml) |
| The amolops loloensis antibacterial peptide | |
| Candida albicans ATCC2002 (Candia albicans ATCC2002) aspergillus flavus IFFI4015 (Aspergillus flavus sp ATCC2592) mould IFFI2002 (Penicillium sp CMCCB10104) Mucor pusillus (Mucor pusillus) brewer's yeast (Sacharomyces cervisiae) | 19.1 6.2 18.6 14.2 9.8 |
By table 2 as seen, synthetic amolops loloensis antibacterial peptide has the effect of significant inhibition fungal growth.
Amolops loloensis antibacterial peptide and gene thereof and the application in pharmacy-sequence generates table
SEQUENCE LISTING
＜110〉Agricultural University Of Nanjing
＜120〉amolops loloensis antibacterial peptide and gene thereof and the application in pharmacy
<130>1
<160>2
<170>PatentIn version 3.3
<210>1
<211>442
<212>DNA
＜213〉amolops loloensis (Amolops loloensis)
<400>1
taagcagtgg tatcaacgca gagtggccat tacggccggg ggagacctcc actgaagtct 60
tccagctctc tacattctca gcaccaactg aaccacccga gcccaaagat gttcaccttg 120
aagaaatcca tgttactcct tttcttcctt gggaccatca acttatctct ctgtgagcaa 180
gagagaaatg cagatgagga agaaagaaga gatgatgatg aaatggatgt tgaagtggaa 240
aaacgatttt taccaatgtt ggccggtctg gctgctaatt tcttgccaaa attattttgt 300
aaaataacca aaaaatgttg aaactctgga attggaaatc atctgatgtg gaatatcatt 360
tagctaaatg cacatcagat gtcttataaa aaaataaaga tatctcaaac atcaaaaaaa 420
aaaaaaaaaa aaaaaaaaaa aa 442
<210>2
<211>24
<212>PRT
＜213〉amolops loloensis (Amolops loloensis)
<220>
<221>AMIDATION
<222>(24)
<400>2
Phe Leu Pro Met Leu Ala Gly Leu Ala Ala Ash Phe Leu Pro Lys Leu
1 5 10 15
Phe Cys Lys Ile Thr Lys Lys Cys-AMIDATION
20
Claims (4)
1. amolops loloensis antibacterial peptide, it is characterized in that: the amolops loloensis antibacterial peptide is a kind of single chain polypeptide of Chinese batrachians amolops loloensis antibacterial peptide gene coding, molecular weight 2666.4 dalton, iso-electric point 9.70, the polypeptide total order is classified as: Phe Leu Pro Met Leu Ala Gly Leu Ala Ala Asn Phe Leu Pro Lys Leu Phe CysLys Ile Thr Lys Lys Cys-AMIDATION.
2. amolops loloensis antibacterial peptide gene nucleotide sequence, it is characterized in that: cDNA is made up of 442 Nucleotide, and it from 5 ' end to 3 ' terminal sequence is:
taagcagtgg tatcaacgca gagtggccat tacggccggg ggagacctcc actgaagtct 60
tccagctctc tacattctca gcaccaactg aaccacccga gcccaaagat gttcaccttg 120
aagaaatcca tgttactcct tttcttcctt gggaccatca acttatctct ctgtgagcaa 180
gagagaaatg cagatgagga agaaagaaga gatgatgatg aaatggatgt tgaagtggaa 240
aaacgatttt taccaatgtt ggccggtctg gctgctaatt tcttgccaaa attattttgt 300
aaaataacca aaaaatgttg aaactctgga attggaaatc atctgatgtg gaatatcatt 360
tagctaaatg cacatcagat gtcttataaa aaaataaaga tatctcaaac atcaaaaaaa 420
aaaaaaaaaa aaaaaaaaaa aa 442
3. the described amolops loloensis antibacterial peptide gene of claim 2 nucleotide sequence is characterized in that, the ripe antibacterial peptide of coding amolops loloensis is a 247-318 position Nucleotide, and its aminoacid sequence is:
Phe Leu Pro Met Leu Ala Gly Leu Ala Ala Asn Phe Leu Pro Lys Leu Phe
1 5 10 15
Cys Lys Ile Thr Lys Lys Cys-AMIDATION。
20
4. the described amolops loloensis antibacterial peptide of claim 1 is as the application of preparation cause pathogeny imcrobe infection treatment of diseases medicine and anti-tumor medicine.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2006100106270A CN100351270C (en) | 2006-01-12 | 2006-01-12 | Antibacterial peptide of brown-spotted torrential frog, its gene and application in drug preparation |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2006100106270A CN100351270C (en) | 2006-01-12 | 2006-01-12 | Antibacterial peptide of brown-spotted torrential frog, its gene and application in drug preparation |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1803834A true CN1803834A (en) | 2006-07-19 |
| CN100351270C CN100351270C (en) | 2007-11-28 |
Family
ID=36866004
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNB2006100106270A Expired - Fee Related CN100351270C (en) | 2006-01-12 | 2006-01-12 | Antibacterial peptide of brown-spotted torrential frog, its gene and application in drug preparation |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN100351270C (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102786583A (en) * | 2012-08-13 | 2012-11-21 | 中国科学院烟台海岸带研究所 | Rana kunyuensis kunyuenin kunyuenin-3 as well as preparation method and application of rana kunyuensis kunyuenin kunyuenin-3 |
| CN102796177A (en) * | 2012-08-13 | 2012-11-28 | 中国科学院烟台海岸带研究所 | Transformed antibacterial peptide, preparation method and application |
| CN104558121A (en) * | 2014-12-31 | 2015-04-29 | 常熟理工学院 | Tiger frog antibacterial peptide, and coding gene and application thereof |
| CN111690041A (en) * | 2020-06-23 | 2020-09-22 | 上海大学 | Polypeptide with anti-tumor activity, preparation method and application thereof |
| CN114671936A (en) * | 2022-03-08 | 2022-06-28 | 昆明医科大学 | Peptide Zs-CATH for defending against rana platyphylla, and gene and application thereof |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102250216B (en) * | 2011-06-27 | 2013-03-06 | 昆明理工大学 | Rana nigromaculata antimicrobial peptide as well as gene and application thereof |
-
2006
- 2006-01-12 CN CNB2006100106270A patent/CN100351270C/en not_active Expired - Fee Related
Cited By (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102786583A (en) * | 2012-08-13 | 2012-11-21 | 中国科学院烟台海岸带研究所 | Rana kunyuensis kunyuenin kunyuenin-3 as well as preparation method and application of rana kunyuensis kunyuenin kunyuenin-3 |
| CN102796177A (en) * | 2012-08-13 | 2012-11-28 | 中国科学院烟台海岸带研究所 | Transformed antibacterial peptide, preparation method and application |
| CN102786583B (en) * | 2012-08-13 | 2014-03-19 | 中国科学院烟台海岸带研究所 | Rana kunyuensis modified antibacterial peptides as well as preparation method and application of rana kunyuensis kunyuenin kunyuenin-3 |
| CN104558121A (en) * | 2014-12-31 | 2015-04-29 | 常熟理工学院 | Tiger frog antibacterial peptide, and coding gene and application thereof |
| CN104558121B (en) * | 2014-12-31 | 2018-11-16 | 常熟理工学院 | A kind of Mercuric chloride antibacterial peptide and its encoding gene and application |
| CN111690041A (en) * | 2020-06-23 | 2020-09-22 | 上海大学 | Polypeptide with anti-tumor activity, preparation method and application thereof |
| CN111690041B (en) * | 2020-06-23 | 2022-06-07 | 上海大学 | Polypeptide with anti-tumor activity and preparation method thereof |
| CN114671936A (en) * | 2022-03-08 | 2022-06-28 | 昆明医科大学 | Peptide Zs-CATH for defending against rana platyphylla, and gene and application thereof |
| CN114671936B (en) * | 2022-03-08 | 2023-09-01 | 昆明医科大学 | Bungeana grahami defensive peptide Zs-CATH and gene and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN100351270C (en) | 2007-11-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN100351270C (en) | Antibacterial peptide of brown-spotted torrential frog, its gene and application in drug preparation | |
| CN100351271C (en) | Active polypeptide of brown-spotted torrential frog, its gene and application in drug preparation | |
| CN101063103A (en) | Hainan sporic scorpion antibiotic and preparation method and application | |
| CN1177055C (en) | Antibacterial peptide gene of fly and its cloning process | |
| CN100345865C (en) | Antibiotic dipeptide and its chemical modifier, its preparation method and uses | |
| EP1532280A2 (en) | Endosymbiotic gammaproteobacterium identified in ecteinascidia turbinata | |
| CN1294258C (en) | Method for separating antibiotic peptide and separated antibiotic peptide | |
| CN100344758C (en) | Antibacterial peptide gene of Chinese prawn containing single whey acidic protein structure domain and its coded antibacterial peptide and application | |
| CN1760203A (en) | Antibacterial tripeptides and modified chemicals, and application | |
| CN1883703A (en) | Serine protease inhibitor of Rana grahami, its gene and application | |
| CN1238377C (en) | Acidic antibacterial peptides and gene as well as its application in pharmacy | |
| CN1262559C (en) | Housefly phylaxin gene, and its cloning method and recombinant application | |
| CN101037473A (en) | R. grahami rnmunoregulating polypeptide, gene and variant and its application in medicine production | |
| CN101012275A (en) | Rana grahami skin peptide, gene thereof and application in pharmacy | |
| CN106432459B (en) | Antibacterial peptide of hypsizigus marmoreus, gene thereof and application thereof in pharmacy | |
| CN1170845C (en) | Giant-web bombinator antineoplastic protein and its prepn and gene | |
| CN1840544A (en) | ESC42 protein, preparation method and use thereof | |
| CN1171998C (en) | Antibacterial peptide gene of Chinese prawn and its colon technique | |
| CN1034123C (en) | Calcium channel blocking polypeptides from filistata hibernalis | |
| CN101012273A (en) | Rana grahami secretory peptide, gene thereof and application in pharmacy | |
| CN1850857A (en) | Rana grahami propyl sperm peptide, gene and variant and its pharmaceutical use | |
| CN1244584A (en) | Chemotarix factor with immunocyte chemotaxis and hemopoinesis stimulating activity | |
| CN1170847C (en) | Giant-web bombinator antimicrobial peptide and its prepn and gene | |
| CN101012274A (en) | Rana grahami peptide, gene thereof and application in pharmacy | |
| CN1632120A (en) | Hepcidin antibiotic peptide gene of weever cultured in sea water |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C19 | Lapse of patent right due to non-payment of the annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |