CN101037473A - R. grahami rnmunoregulating polypeptide, gene and variant and its application in medicine production - Google Patents
R. grahami rnmunoregulating polypeptide, gene and variant and its application in medicine production Download PDFInfo
- Publication number
- CN101037473A CN101037473A CN 200710065669 CN200710065669A CN101037473A CN 101037473 A CN101037473 A CN 101037473A CN 200710065669 CN200710065669 CN 200710065669 CN 200710065669 A CN200710065669 A CN 200710065669A CN 101037473 A CN101037473 A CN 101037473A
- Authority
- CN
- China
- Prior art keywords
- odorranagrahami
- immunomodulatory peptides
- immunomodulatory
- immunomodulation
- grahami
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Peptides Or Proteins (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
The invention relates to an Odorrana grahami immunomodulation peptide, gene and variant and the application in the pharmacy belonging to the biomedicine field. The Odorrana grahami immunomodulation peptide is a circular peptide with a molecular weight of 1791.12 D and a isoelectric point of 9.84. The whole sequence of the Odorrana grahami immunomodulation peptide is Thr Ser Arg Cys Tyr Ile Gly Tyr Arg Arg Lys Val Val Cys Ser (TSRCYIGYRRKVVCS), wherein the fourth cysteine and 14th cysteine form intramolecular disulfide bond. The code gene is composed of 307 nucleotides, wherein the code mature parts are from 141th to 186th nucleotide. The produced variant is produced by substituting the fourth amino acid in the original sequence of the Odorrana grahami immunomodulation peptide. The artificial synthetic Odorrana grahami immunomodulation peptide and variant thereof has a strong immunomodulation activity and tumor resistance activity and can be used for immunomodulation, tumor treatment and chemotherapeutics. The invention has the advantages such as simple sequence and convenient synthesis.
Description
Technical field:
The invention provides a kind of odorranagrahami (Rana grahami) immunomodulatory peptides, its gene and varient and the application in pharmacy thereof, belong to field of biomedicine technology.
Background technology:
In the traditional Chinese medicine and national medicine of China, many amphibian animals are used as medicinal material and are used widely, as Chinese toad (Bufo gargarizans), Bombina maxima (Bombina maxima), Rana nigromaculata (pelophylaxnigromaculata), Rana guentheri (Hylaranaguentheri) and rana limnocharis (Euphlyctislimnocharis) etc.The skin of these amphibian animals and internal organ have pharmacologically active and clinical efficacy widely, reported that pharmacologically active has: broad-spectrum antibacterial action, antitumor, toponarcosis, analgesia, immunomodulatory, to effect of cardiovascular systems etc., on the other hand, the complicacy of traditional Chinese medicine pharmaceutical cpd and the limitation of concocting method thereof also are the major reasons that causes active constituents of medicine better not play a role, thereby the specific reactive monomer compound of searching is one of important content of the modernization of Chinese medicine from these conventional medicaments.Abroad, the searching of the specific pharmacology reactive monomer of batrachians skin compound has become the focus of new drug invention.The foreign scholar isolates a lower molecular weight in the bell toad eastwardly and has the active polypeptide BSTI of serpin, and domestic scholars has been separated to from Bombina maxima and has the inhibiting polypeptide BMTI of serine protease.The bufokinin and the ranakinin of vasodilator and hypotensive effect from toad and wood frog skin, have been obtained having.Bright smart peptide and the smart peptide of junket from the North America leopard frog and the A Bai frog, have been separated to immunomodulatory and antitumor action.The nearly more than ten years screen more than 170 kinds of batrachians skin active peptides and analogue, prove that 40 various active peptides have drug development prospect preferably.
There is long history in China to the application of batrachians medicine, but the research of its activeconstituents and pharmacological properties is mainly concentrated on organic molecules such as alkaloid, and is also less to the research of its skin activity albumen peptide matters.Odorranagrahami mainly is distributed in the Yunnan of China, and provinces such as Sichuan and Guangxi are one of characteristic resources animals of China.
The contriver searches comparison with odorranagrahami immunoloregulation polypeptide of the present invention and varient complete sequence amino acid structure thereof through Protein Data Bank, finds no any phase homopolypeptide.The contriver searches comparison with odorranagrahami immunomodulatory dna encoding peptide of the present invention through gene database, finds no any homologous genes.
Summary of the invention:
The objective of the invention is based on above-mentioned prior art basis, provide one group to have the intensive immunoregulatory activity, have stronger growth of tumour cell simultaneously and suppress the smelly frog immunoloregulation polypeptide of active odorranagrahami graduated dial, its gene and varient and the application in pharmacy thereof.
In order to realize purpose of the present invention, the invention provides following technical scheme:
The odorranagrahami immunoloregulation polypeptide:
A kind of ring type polypeptide that it is characterized in that Chinese amphibian animal odorranagrahami genes encoding, molecular weight 1791.12 dalton, iso-electric point 9.84, have intensive immunoregulatory activity and anti-tumor activity, the total order of odorranagrahami immunomodulatory peptides is classified as: Thr Ser Arg Cys Tyr Ile Gly Tyr Arg Arg Lys Val Val Cys Ser (TSRCYIGYRRKVVCS), its halfcystine of the 4th and the 14th 's halfcystine forms intramolecular disulfide bond.
The clone of odorranagrahami immunomodulatory peptides gene comprises:
The total RNA of Rana grahami skin extracts, the mRNA purifying, and mRNA reverse transcription and cDNA library construction, the design primer utilizes PCR method screening odorranagrahami protease inhibitor gene.Amplimer length is 23 Nucleotide, and its sequence is 5 ' ATGTTCACCATGAAGAAATCCCT 3 ', and another amplimer of PCR is the SMART of CLONTECH company
TM' PCR Primer primer, its sequence are 5 ' ATTCTACAGGCCGAGGCGGCCGACATG 3 ' among the cDNA Library Construction Kit 3.The positive monoclonal that obtains carries out gene nucleotide series and measures.Gene sequencing result shows that the gene of coding odorranagrahami immunomodulatory peptides is made up of 307 Nucleotide, holds to 3 ' terminal sequence from 5 ' to be:
atgttcacct tgaagaaatc cctgttactc cttttctttc ttgggaccat ctccttatct 60
ctctgtgagc aagaaagaga tgccgatgaa gaaagcaatg aagaaaatgg agtagaagct 120
aaagttaaag agctaaaaag gacctctaga tgctatatag gatatcggcg caaagtagtt 180
tgttcataag atcaatcttg aattggaggt catctgatgt gaaatatcat ttagctaaat 240
gctcaacaga tgtctaataa aaaataaaaa tgtcacagaa aaaaaaaaaa aaaaaaaaaa 300
aaaaaaa 307
Encoding mature odorranagrahami immunomodulatory peptide sequence be 141-186 position Nucleotide, its aminoacid sequence is:
Thr Ser Arg Cys Tyr Ile Gly Tyr Arg Arg Lys Val Val Cys Ser
5 10 15
Utilize the varient of protein science method design odorranagrahami immunomodulatory peptides, its varient is as follows:
The glycine mutation that immunomodulatory peptides is 2, the 7 is a L-glutamic acid
Thr Ser Arg Cys Tyr Ile Glu Tyr Arg Arg Lys Val Val Cys Ser
5 10 15
The preparation method of odorranagrahami immunomodulatory peptides and varient thereof:
Infer the aminoacid sequence of odorranagrahami immunomodulatory peptides according to the gene of coding odorranagrahami immunomodulatory peptides, utilize the mutant of protein science method design odorranagrahami immunomodulatory peptides, synthesize its complete sequence with automatic Peptide synthesizer.By the anti-phase C of HPLC
18Post desalination, purifying.Identify its purity with the HPLC method then, molecular weight determination adopts fast atom bombardment mass spectroscopy(FABMS) method (Fast atom bombardment mass spectrometry, FAB-MS), isoelectric focusing electrophoresis is measured iso-electric point, measures the aminoacid sequence structure with automatic Protein Sequencer.
Odorranagrahami immunomodulatory peptides of the present invention, gene and varient are as the application of preparation immunomodulatory, oncotherapy, chemotherapeutics.
Beneficial effect of the present invention is:
By odorranagrahami immunomodulatory dna encoding peptide its amino acid structure of deriving, utilize the mutant of protein science method design odorranagrahami immunomodulatory peptides, synthetic odorranagrahami immunomodulatory peptides and mutant thereof have significant immunomodulatory and suppress the effect of tumor growth.That this group odorranagrahami immunomodulatory peptides and mutant thereof have is simple in structure, synthetic convenient, suppress the tangible beneficial features of tumor effect.
Embodiment:
Further specify essentiality content of the present invention with embodiment below, but content of the present invention is not limited thereto.
The gene clone of odorranagrahami immunomodulatory peptides:
I, the total RNA of Rana grahami skin extract:
A. live body odorranagrahami water cleans up, and puts into the liquid nitrogen quick-frozen 4 hours, gets skin histology, weigh, get the 300mg skin histology, add the total RNA of 10ml and extract damping fluid (Trizol solution, U.S. GIBCOBRL company product), homogenate is 30 minutes in the 20ml glass homogenizer.
B. add equal-volume phenol/chloroformic solution, violent mixing, room temperature was placed 10 minutes, and 4 ℃, centrifugal 10 minutes of 12000rpm, reject precipitation.
C. supernatant adds isopyknic Virahol, and room temperature was placed 10 minutes, and 4 ℃, centrifugal 10 minutes of 12000rpm, precipitation is washed once with 75% ethanol, dries, and pipe end throw out is the total RNA of Rana grahami skin.
The purifying of II, Rana grahami skin mRNA:
The PolyATtract of U.S. PROMEGA company is adopted in Rana grahami skin mRNA separation and purification
MRNAIsolation Systems test kit.
A. get the total RNA 500 μ g of Rana grahami skin and be dissolved in the 500 μ l DEPC water, put into 65 ℃ of water-baths 10 minutes, add Oligo (dT) probe and 13 μ l, the 20 * SSC solution of people 3 μ l, mixing is placed the room temperature cooling, is called A liquid.
B. the washing of magnetic bead (SA-PMP): magnetic bead is flicked mixing,, abandon supernatant, add 0.5 * SSC 0.3ml,, add 0.1ml 0.5 * SSC at last and suspend, be referred to as B liquid to magnetic force frame absorption 30 seconds to magnetic force frame absorption 30 seconds.
C. A liquid is added in the B liquid, room temperature was placed 10 minutes, to magnetic force frame absorption 30 seconds, abandon supernatant, with 0.1 * SSC washing 4 times, abandon supernatant at last, add 0.1ml DEPC aqueous suspension, to the magnetic force frame, adsorbed 30 seconds, supernatant is moved to new test tube, add 0.15ml DEPC water again and suspend again, to magnetic force frame absorption 30 seconds, moving supernatant to above-mentioned test tube, then is the Rana grahami skin mRNA of purifying in the supernatant.
D. add 1/10 volume 3M sodium acetate, pH5.2, the equal-volume Virahol, in-70 ℃ of placements 30 minutes, 4 ℃, centrifugal 10 minutes of 12000rpm abandoned supernatant, and resolution of precipitate is in 10 μ l DEPC water.
III, Rana grahami skin cDNA library construction: adopt the CLONTECH Creator of company
TMSMART
TMCDNALibrary Construction Kit Construction of Plasmid cDNA Library test kit.
A.cDNA first chain synthesizes (mRNA reverse transcription):
1. add 1 μ l Rana grahami skin mRNA, 1 μ l SMART IV oligonucleotide, 1 μ l CDS III/3 ' PCR primer at the aseptic centrifuge tube of 0.5ml, add 2 μ l deionized waters and make cumulative volume reach 5 μ l.
2. the reagent in the mixing centrifuge tube and centrifugal 1 minute with 12000rpm, 72 ℃ of insulations 2 minutes.
3. centrifuge tube was hatched on ice 2 minutes.
4. in centrifuge tube, add following reagent 2.0 μ l 5 * the first chains buffering, 1.0 μ l 20mM dithiothreitol (DTT),
4. in centrifuge tube, add following reagent 2.0 μ l 5 * the first chains buffering, 1.0 μ l 20mM dithiothreitol (DTT), 1.0 μ l 10mM dNTP mixtures, 1.0 μ l PowerScript ThermoScript II.
5. reagent and with 12000rpm centrifugal 1 minute in the mixing centrifuge tube were 42 ℃ of insulations 1 hour.
6. centrifuge tube is placed and end the synthetic of first chain on ice.
7. it is standby to get the 2 synthetic cDNA of μ l institute, first chain from centrifuge tube.
B. adopt long terminal polymerase chain reaction (LD-PCR) method second chain that increases
1.95 ℃ preheating PCR instrument.
2. 2 μ l cDNA, first chains (mRNA reverse transcription), 80 μ l deionized waters, 10 μ l, 10 * Advantage2 PCR buffering, 2 μ l, 50 * dNTP mixture, 2 μ l, 5 ' PCR primer, 2 μ l CDS III/3 ' PCR primers and 2 μ l Escherichia coli polymerase centrifuge tubes are reacted.
3. in the PCR instrument, increase by following program:
1. 95 ℃ of 20 second
2. 22 circulations:
95 ℃ of 5 second
68 ℃ 6 minutes
4. after the loop ends, synthetic cDNA two strands in the centrifuge tube is carried out extracting.
The C.PCR product Wizard of PROMEGA company
SV Gel and PCR Clean-Up System test kit carries out extracting and reclaims, and step is as follows:
1. will put upside down mixing by the isopyknic film binding buffer of the double-stranded adding of the cDNA that PCR obtains, will mix liquid then and change the centrifugal purification post over to, room temperature left standstill 5 minutes, and DNA is fully combined with pellosil.16, centrifugal 1 minute of 000g outwells the waste liquid in the collection tube.
2. the elutriant (containing ethanol) that adds 700 μ l in the centrifugal purification post, 16, centrifugal 1 minute of 000g outwells the waste liquid in the collection tube.
3. repeating step 2.
4.16,000g centrifugal 5 minutes with 12000rpm.
5. the centrifugal purification post is placed new centrifuge tube.
6. add 30 μ l ultrapure waters, at room temperature left standstill 5 minutes.
7.16, centrifugal 1 minute of 000g, pipe end solution is the cDNA two strands of purified mistake.
D. the preparation of bacillus coli DH 5 alpha competent cell:
1. the single DH5 α of picking bacterium colony is inoculated in 3ml and does not contain in the LB substratum of penbritin, and 37 ℃ of overnight incubation are got above-mentioned bacterium liquid next day and are inoculated at 1: 100 in proportion in the 50ml LB nutrient solution, and 37 ℃ vibrated 2 hours.Work as OD
600Value reaches at 0.35 o'clock, the results bacterial cultures.
2. bacterium is transferred in aseptic, disposable, the ice-cold 50ml polypropylene tube, 10min puts in the side on ice, makes culture be cooled to 0 ℃.
In 4 ℃ with the centrifugal 10min of 4100r/min, to reclaim cell.
4. pour out nutrient solution, pipe is inverted 1min so that last trace nutrient solution flows to end.
5. the 0.1mol/L CaCl of every 50ml initial incubation liquid and 30ml precooling
2-MgCl
2Solution (80mmol/LMgCl
2, 20mmol/L CaCl
2) resuspended every part of cell precipitation.
In 4 ℃ with the centrifugal 10min of 4100r/min, to reclaim cell.
7. pour out nutrient solution, pipe is inverted 1min so that last trace nutrient solution flows to end.
8. every 50ml initial incubation thing ice-cold 0.1mol/L CaCl of 2ml
2Resuspended every part of cell precipitation, standby after the packing.
E. the enzyme conversion cutting, connect and connect product:
1. add 1 μ l Takara pMD18-T carrier, the double-stranded solution of 4 μ l odorranagrahami cDNA in Eppendorf tube, full dose is 5 μ l.
2. the ligase enzyme buffer mixture that adds 5 μ l (equivalent).
3.16 ℃ reaction 2 hours.
4. full dose (10 μ l) is added in the 100 μ l DH5 α competent cells, places 30 minutes in the ice.
5.42 after 90 seconds of ℃ heating, in ice, placed 1 minute again.
6. add 37 ℃ of LB substratum 890 μ l of bathing of temperature, 37 ℃ of slow shaking culture 60 minutes.
7. get 200 μ l and coat on the LB substratum that contains X-Gal, IPTG, Amp 37 ℃ and cultivated 16 hours, form single bacterium colony.
8. each LB plate washs bacterium colony with 5ml LB liquid nutrient medium, and it is frozen to add 30% glycerine.The cDNA that makes up approximately contains 1 * 10
6Individual independent clone.
IV, odorranagrahami immunomodulatory peptides gene clone screening:
Amplimer length is 23 Nucleotide, and its sequence is 5 ' ATGTTCACCATGAAGAAATCCCT 3 ', and another amplimer of PCR is the SMART of CLONTECH company
TM3 ' PCRPrimer primer among the cDNA Library Construction Kit, its sequence is 5 ' ATTCTACAGGCCGAGGCGGCCGACATG 3 '.
The PCR reaction is carried out under the following conditions: 94 ℃ of 30 second, 60 ℃ of 30 second and 72 ℃ of 45 second, 35 circulations.
The bacterium cDNA library that makes up of titration at first, be diluted to suitable bacterial concentration (about 5000 bacteria/milliliters with the LB substratum that contains 100 μ g/ml penbritins then, be respectively applied for first run screening second with 30 bacteria/milliliters and take turns screening), on 96 well culture plates by 8 * 8 matrix bed boards (totally 64 holes, every hole 100 μ l), 37 ℃ of incubated overnight.Merge inoculum respectively by row, column, have 16 samples to carry out PCR and identify that the positive hole bacteria samples of intersecting enters second and takes turns screening.
V, odorranagrahami immunomodulatory peptides gene sequencing and result:
Extract plasmid DNA and measure nucleotide sequence with dideoxy method, use instrument to be the full-automatic nucleotide sequencing instrument of U.S. AppliedBiosystems373A, sequencing primer is BcaBEST
TMSequencing PrimerRV-M and BcaBEST
TMSequencing Primer M13-47, BcaBEST
TMSequencing Primer RV-M sequence: 5`GAGCGGATAACAATTTCACACAGG 3 ', BcaBEST
TMSequencing Primer M13-47:5 ' CGCCAGGGTTTTCCCAGTCACGAC 3 '.Gene sequencing result from 5 ' end to 3 ' terminal sequence is:
atgttcacct tgaagaaatc cctgttactc cttttctttc ttgggaccat ctccttatct 60
ctctgtgagc aagaaagaga tgccgatgaa gaaagcaatg aagaaaatgg agtagaagct 120
aaagttaaag agctaaaaag gacctctaga tgctatatag gatatcggcg caaagtagtt 180
tgttcataag atcaatcttg aattggaggt catctgatgt gaaatatcat ttagctaaat 240
gctcaacaga tgtctaataa aaaataaaaa tgtcacagaa aaaaaaaaaa aaaaaaaaaa 300
aaaaaaa 307
The sequence table of odorranagrahami immunomodulatory peptides gene nucleotide is: sequence length is 307 bases, sequence type: nucleic acid, chain number: strand, topology: straight chain shape, sequence kind: cDNA, source: the smelly moth skin of no graduated dial.
Encoding mature odorranagrahami immunomodulatory peptides aminoacid sequence be 141-186 position Nucleotide, its aminoacid sequence is:
Thr Ser Arg Cys Tyr Ile Glu Tyr Arg Arg Lys Val Val Cys Ser
5 10 15
Odorranagrahami immunomodulatory peptides gene prepares the application of odorranagrahami immunomodulatory peptides as genetically engineered.
Odorranagrahami immunomodulatory peptides varient prepares the application of the smelly frog immunomodulatory peptides of graduated dial varient as protein engineering.
Preparation odorranagrahami immunomodulatory peptides and varient thereof:
The preparation method of I, odorranagrahami immunomodulatory peptides: the aminoacid sequence of inferring the odorranagrahami immunomodulatory peptides according to the gene of coding odorranagrahami immunomodulatory peptides, utilize the mutant of protein science method design odorranagrahami immunomodulatory peptides, with synthetic its complete sequence of automatic Peptide synthesizer.By the anti-phase C of HPLC
18Column chromatography desalination, purifying.
II, molecular weight determination adopt fast atom bombardment mass spectroscopy(FABMS) method (Fast atom bombardment mass spectrometry, FAB-MS), with glycerine: m-nitrobenzyl alcohol: methyl-sulphoxide (1: 1: 1, V: V: V, volume ratio) is substrate, Cs+ is as projectile, and electric current is 1 μ A, and emission voltage is 25Kv.
The odorranagrahami immunomodulatory peptides and the varient thereof of III, purifying are identified its purity with the high-efficient liquid phase chromatogram HPLC method, molecular weight determination adopts the fast atom bombardment mass spectroscopy(FABMS) method, isoelectric focusing electrophoresis is measured iso-electric point, measures the aminoacid sequence structure with automatic Protein Sequencer.
The odorranagrahami immunomodulatory peptides is a kind of ring type polypeptide of Chinese amphibian animal odorranagrahami genes encoding, molecular weight 1791.12 dalton, iso-electric point 9.84, have intensive immunoregulatory activity and anti-tumor activity, the total order of odorranagrahami immunomodulatory peptides is classified as: Thr Ser Arg Cys Tyr Ile Gly Tyr Arg Arg Lys Val Val CysSer (TSRCYIGYRRKVVCS), its halfcystine of the 4th and the 14th 's halfcystine forms intramolecular disulfide bond.
Odorranagrahami immunomodulatory peptides varient is that method design a kind of by protein science has the immunoregulatory activity of improvement and the ring type polypeptide of anti-tumor activity, and their complete sequence is as follows:
Smelly frog immunomodulatory peptides 2,
Thr Ser Arg Cys Tyr Ile Glu Tyr Arg Arg Lys Val Val Cys Ser
5 10 15
The pharmacological evaluation of odorranagrahami immunomodulatory peptides:
1. the immunoregulation effect of odorranagrahami immunomodulatory peptides and varient thereof:
Mastocyte plays important effect in the innate immunity process of animal, can discharge histamine and the former regulatory factor of some other inflammation in the time of mast cell degranulation, the release of these materials attracts inflammatory cell to inflamed sites, the diffusion of final inflammation part inflammation.So discharging histamine, mastocyte can be used as the active a kind of means that detect.
The disconnected neck of healthy Wistar rat is put to death intraperitoneal injection 10ml tyrode's solution (Tyrode solution), abdominal massaging 10 minutes, open the tyrode's solution that the abdominal cavity sucking-off contains mastocyte, centrifugal 5 minutes of 1000rpm repeats to wash once with tyrode's solution, uses the tyrode's solution suspension mastocyte of 1-2ml again.Get 10 μ l samples and 90 μ l cell suspensions were hatched 10 minutes at 37 ℃, hatched 10 minutes for 37 ℃, add the cold tyrode's solution of 1.9ml then, the centrifugal 5min of 3000rpm, the sucking-off supernatant, precipitation suspends with the 2ml tyrode's solution, and boils 10min on boiling water.Supernatant or precipitation add 0.6g NaCl, 2.5mL propyl carbinol and 0.2ml 2.5mol/L NaOH respectively, mixing immediately, vibration back low-speed centrifugal 5min; Get the 2mL organic phase and be added to the test tube that adds 0.6mL0.1mol/L HCl and 2.5mL normal heptane, vibration back low-speed centrifugal 5min abandons organic phase; Get 0.5mL HCl with 1 times of distilled water dilution after, add 0.25mL 0.4mol/L NaOH and 0.05mL 1mg/L OPT methanol solution, behind accurate response 10min under 20 ℃ of conditions, add 0.25mL 0.5mol/L HCl termination reaction.After blank Guan Weixian adds 0.25mol/L HCl, add o-phthalaldehyde(OPA) again.
The automatic spectrophotofluorometer that utilizes PE company is in excitation wave 360nm, and wavelength of fluorescence 450nm measures fluorescence intensity reading (T) under the condition of slit 10nm.
The histamine release rate is calculated as follows:
Histamine release rate=[(the histamine release amount of sample-spontaneous histamine release amount)/histamine total content] * 100%
This tests triplicate.
The results are shown in Table 1.
The histamine release effect of table 1 odorranagrahami immunomodulatory peptides and varient thereof:
| Concentration (ug/ml) | Histamine release rate (%) | |
| Smelly frog immunomodulatory peptides | Smelly frog immunomodulatory peptides 2 | |
| 5 10 50 | 10 23 48 | 18 40 86 |
2. odorranagrahami immunomodulatory peptides and varient thereof suppress the effect of tumor growth:
On 96 porocyte culture plates, testing sample is carried out 5 times or 2 times of doubling dilutions with 1640 substratum, totally six extent of dilution, each extent of dilution is established 3 repeating holes, and every hole 100 μ l are provided with the normal cell contrast simultaneously.Every hole drips 3 * 10
5The Hela of individual/ml, HepG2 cell 100 μ l.Put 37 ℃, 5%CO
2Cultivate in the incubator.Measure the toxic action of testing compound pair cell after 48 hours with mtt assay.EC50 is the concentration when tumour cell is produced 50% restraining effect.
Table 2 odorranagrahami immunomodulatory peptides and varient thereof suppress the effect of growth of tumour cell:
| Sample | EC50(μM) | |
| Hela | HepG2 | |
| The smelly frog immunomodulatory peptides 2 of smelly frog immunomodulatory peptides | 12 2 | 20 1.5 |
By table 1 as seen, odorranagrahami immunomodulatory peptides and variation physical efficiency thereof significantly suppress the growth of cervical cancer cell (Hela) and tumor cell of liver system (HepG2), this shows that odorranagrahami immunomodulatory peptides and varient thereof have very strong inhibition growth of tumour cell effect, and show improved performance, also have advantages such as sequence is simple, synthetic convenience simultaneously.Can be used as preparation and control the application of immunomodulatory, oncotherapy and chemotherapeutics.
Odorranagrahami immunomodulatory peptides, its gene and varient and the application _ ST25 in pharmacy thereof
SEQUENCE LISTING
＜110〉Kunming Institute of Zoology, Chinese Academy of Sciences
＜120〉odorranagrahami immunomodulatory peptides, its gene and varient and the application in pharmacy thereof
<130>1
<160>3
<170>PatentIn version 3.4
<210>1
<211>307
<212>DNA
<213>Rana grahami
<400>1
atgttcacct tgaagaaatc cctgttactc cttttctttc ttgggaccat ctccttatct 60
ctctgtgagc aagaaagaga tgccgatgaa gaaagcaatg aagaaaatgg agtagaagct 120
aaagttaaag agctaaaaag gacctctaga tgctatatag gatatcggcg caaagtagtt 180
tgttcataag atcaatcttg aattggaggt catctgatgt gaaatatcat ttagctaaat 240
gctcaacaga tgtctaataa aaaataaaaa tgtcacagaa aaaaaaaaaa aaaaaaaaaa 300
aaaaaaa 307
<210>2
<211>15
<212>PRT
<213>Rana grahami
<400>2
Thr Ser Arg Cys Tyr Ile Gly Tyr Arg Arg Lys Val Val Cys Ser
1 5 10 15
<210>3
<211>15
<212>PRT
<213>Rana grahami
<400>3
Thr Ser Arg Cys Tyr Ile Glu Tyr Arg Arg Lys Val Val Cys Ser
1 5 10 15
Claims (6)
1. odorranagrahami immunomodulatory peptides, it is characterized in that this odorranagrahami immunomodulatory peptides is a kind of ring type polypeptide of Chinese amphibian animal odorranagrahami genes encoding, the odorranagrahami immunomodulatory peptides is a kind of ring type polypeptide, molecular weight 1791.12 dalton, iso-electric point 9.84, the total order of odorranagrahami immunomodulatory peptides is classified as: Thr Ser Arg Cys TyrIle Gly Tyr Arg Arg Lys Val Val Cys Ser (TSRCYIGYRRKVVCS), its halfcystine of the 4th and the 14th 's halfcystine forms intramolecular disulfide bond.
2. odorranagrahami immunomodulatory peptides gene nucleotide series, it is characterized in that: cDNA is made up of 307 Nucleotide, and it from 5 ' end to 3 ' terminal sequence is:
atgttcacct tgaagaaatc cctgttactc cttttctttc ttgggaccat ctccttatct 60
ctctgtgagc aagaaagaga tgccgatgaa gaaagcaatg aagaaaatgg agtagaagct 120
aaagttaaag agctaaaaag gacctctaga tgctatatag gatatcggcg caaagtagtt 180
tgttcataag atcaatcttg aattggaggt catctgatgt gaaatatcat ttagctaaat 240
gctcaacaga tgtctaataa aaaataaaaa tgtcacagaa aaaaaaaaaa aaaaaaaaaa 300
aaaaaaa 307
3. the described odorranagrahami immunomodulatory peptides of claim 2 gene nucleotide series is characterized in that, encoding mature odorranagrahami immunomodulatory peptide sequence be 141-186 position Nucleotide, its aminoacid sequence is:
Thr Ser Arg Cys Tyr Ile Glu Tyr Arg Arg Lys Val Val Cys Ser
5 10 15
4. the varient of the described odorranagrahami immunomodulatory peptides of claim 1 is characterized in that its varient is as follows:
Immunomodulatory peptides 2, the 7th glycine mutation is a L-glutamic acid in the odorranagrahami immunomodulatory peptides original series,
Thr Ser Arg Cys Tyr Ile Glu Tyr Arg Arg Lys Val Val Cys Ser
5 10 15。
5. the application of the described odorranagrahami immunomodulatory peptides of claim 1 is characterized in that the application of odorranagrahami immunomodulatory peptides as preparation immunomodulatory, oncotherapy and chemotherapeutics.
6. the application of the described odorranagrahami immunomodulatory peptides of claim 4 varient is characterized in that the application of odorranagrahami immunomodulatory peptides varient as preparation immunomodulatory, oncotherapy and chemotherapeutics.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200710065669 CN101037473A (en) | 2007-02-12 | 2007-02-12 | R. grahami rnmunoregulating polypeptide, gene and variant and its application in medicine production |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200710065669 CN101037473A (en) | 2007-02-12 | 2007-02-12 | R. grahami rnmunoregulating polypeptide, gene and variant and its application in medicine production |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN101037473A true CN101037473A (en) | 2007-09-19 |
Family
ID=38888671
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 200710065669 Pending CN101037473A (en) | 2007-02-12 | 2007-02-12 | R. grahami rnmunoregulating polypeptide, gene and variant and its application in medicine production |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101037473A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102657845A (en) * | 2012-05-31 | 2012-09-12 | 中国科学院昆明动物研究所 | Applications of odorrana grahami polypeptide AH90 and CW49 for promoting skin regeneration |
| CN111235156A (en) * | 2020-02-19 | 2020-06-05 | 温州医科大学 | Immune regulatory peptide derived from rana huashanensis and application of gene thereof in skin photodamage protection |
-
2007
- 2007-02-12 CN CN 200710065669 patent/CN101037473A/en active Pending
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102657845A (en) * | 2012-05-31 | 2012-09-12 | 中国科学院昆明动物研究所 | Applications of odorrana grahami polypeptide AH90 and CW49 for promoting skin regeneration |
| CN102657845B (en) * | 2012-05-31 | 2013-09-11 | 中国科学院昆明动物研究所 | Applications of odorrana grahami polypeptide AH90 and CW49 for promoting skin regeneration |
| CN111235156A (en) * | 2020-02-19 | 2020-06-05 | 温州医科大学 | Immune regulatory peptide derived from rana huashanensis and application of gene thereof in skin photodamage protection |
| CN111235156B (en) * | 2020-02-19 | 2022-08-09 | 温州医科大学 | Immune regulatory peptide derived from rana huashanensis and application of gene thereof in skin photodamage protection |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN100351270C (en) | Antibacterial peptide of brown-spotted torrential frog, its gene and application in drug preparation | |
| CN1974601A (en) | New-type Fc fusion protein and its production process | |
| CN101037473A (en) | R. grahami rnmunoregulating polypeptide, gene and variant and its application in medicine production | |
| CN1075148A (en) | New megalokaryocyte amplification gene | |
| CN101041818A (en) | Method for recombinant production of pancreatic glucagons sample peptide-2 | |
| CN1883703A (en) | Serine protease inhibitor of Rana grahami, its gene and application | |
| CN1850857A (en) | Rana grahami propyl sperm peptide, gene and variant and its pharmaceutical use | |
| CN1639190A (en) | Transmembrane NFAT inhibitory peptide | |
| CN100351271C (en) | Active polypeptide of brown-spotted torrential frog, its gene and application in drug preparation | |
| CN1170928C (en) | Liver cancer related gene and its application | |
| CN1034123C (en) | Calcium channel blocking polypeptides from filistata hibernalis | |
| CN1840544A (en) | ESC42 protein, preparation method and use thereof | |
| CN1490333A (en) | Insulinotropic peptide and its use | |
| CN1247616C (en) | New monomeric insulin and its medicinal composition and prepn process | |
| CN1297999A (en) | Human glutaminyl s-RNA synthatase 58 as one new kind of polypeptide and polynucleotides encoding this polypeptide | |
| CN107501395B (en) | Rana nigromaculata antioxidant peptide, gene and application thereof | |
| CN101033253A (en) | Recombination Japanese lamprey oral gland Grimin protein induction cell apoptosis and its antineoplastic action | |
| CN1238377C (en) | Acidic antibacterial peptides and gene as well as its application in pharmacy | |
| CN101062948A (en) | Monomer quick-effective insulin and preparation method and usage thereof | |
| CN1208461C (en) | New gene SNX21 of human SNX family | |
| CN101012273A (en) | Rana grahami secretory peptide, gene thereof and application in pharmacy | |
| CN1524958A (en) | Angiotensin II correlative gene, coding protein and application thereof | |
| CN1818062A (en) | Anti senescence related iron-protein gene of Amphioxus | |
| CN1511959A (en) | High efficiency system for screening T cell antigen expression peptide and preparing MHC-peptide polymer (MHC tetramer) | |
| CN1912138A (en) | Oligonucleotide adapter of identification of protein squence applied in protein tissue research |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |