CN1850857A - Rana grahami propyl sperm peptide, gene and variant and its pharmaceutical use - Google Patents
Rana grahami propyl sperm peptide, gene and variant and its pharmaceutical use Download PDFInfo
- Publication number
- CN1850857A CN1850857A CN 200610010931 CN200610010931A CN1850857A CN 1850857 A CN1850857 A CN 1850857A CN 200610010931 CN200610010931 CN 200610010931 CN 200610010931 A CN200610010931 A CN 200610010931A CN 1850857 A CN1850857 A CN 1850857A
- Authority
- CN
- China
- Prior art keywords
- propyl
- lys
- odorranagrahami
- pro
- sperm
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Peptides Or Proteins (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
The invention relates to non finger odor frog third refined peptide, gene and the variant and the application in medicine. It is an annular polypeptide, and the molecular weight is 2188.68 dalton, isoelectric point is 10.07, the full sequence is NH2- AALKGCWTKSIPPKPCFGKR-COOH, the sixth cysteine and the sixteenth cysteine form intramolecularly disulfide bond. The coding gene is formed by 304 nucleotides. And the coding mature sections are the 130th to the 189th nucleotides. It could be used to cure tumor, gastritis, and pancreatitis, and has simple sequence.
Description
Technical field:
The invention provides a kind of odorranagrahami (Rana grahami) propyl sperm peptide, gene and varient and the application in pharmacy thereof, belong to field of biomedicine technology.
Background technology:
(serine protease inhibitor, basic functions serpin) is to prevent proteolysis to serpin, regulates the hydrolysising balance of serine protease.By the adjusting to serine protease, serpin all has significant effects to the intravital many important physical biochemical functions of biology.Below 14 class biochemical functions all be subjected to the adjusting of serpin: blood coagulation, complement formation, fibrinolytic, protein folding, cell migration, cytodifferentiation, cell matrix are rebuild, hormone formation and transhipment, intracellular protein hydrolysis, blood pressure regulation, tumor suppression and virus or the pathogenic formation of parasite.Because so numerous physiological functions is subjected to its adjusting, serpin has become the focus of international research.Its research and development are then being contained huge clinical treatment medication preparation and are being worth.
Tumour is a class principal disease of harm humans health, and the medicine scarcity.It is reported that malignant tumour only just increases 1,600,000 cases newly in China every year, and sicken age rejuvenation gradually.Employed medicine in chemotherapy all has bigger human toxicity as AC, tumour necrosis factor etc. at present, very big of side effect, thereby the exploitation of anti-tumor medicine is the focus of drug development.Tumour expansion and transfer are one of major reasons of present clinical treatment tumour inefficiency.Serpin maspin has the obvious suppression effect with external to tumour in vivo, and its mechanism of action is to suppress tumor cell invasion and vascularization.
According to domestic and foreign literature, serpin such as aprotinin also are used for anti-fibrinolytic in thoracic surgery except that being widely used in treatment of diseases such as gastritis, pancreatitis clinically, suppress contact activation, anti-inflammatory etc.Serine protease analogue such as Kallikrein, tryptase in rheumatic arthritis and many inflammation (as rhinitis, conjunctivitis, asthma, gastro-enteritis, cardiovascular systems inflammation) play an important role in taking place.Clinical trial proves that its inhibitor is effective medicine.On the other hand, also do not treat the medicine of herpesvirus infection at present clinically effectively, it is effective treatment means that discovered in recent years suppresses the simplexvirus serine protease.Above-mentioned these new serpin medicines have been in II, III phase clinical stage and commercialization.
In the traditional Chinese medicine and national medicine of China, many amphibian animals are used as medicinal material and are used widely, as Chinese toad (Bufo gargarizans), Bombina maxima (Bombina maxima), Rana nigromaculata (pelophylaxnigromaculata), Rana guentheri (Hylaranaguentheri) and rana limnocharis (Euphlyctislimnocharis) etc.The skin of these amphibian animals and internal organ have pharmacologically active and clinical efficacy widely, reported that pharmacologically active has: broad-spectrum antibacterial action, antitumor, toponarcosis, analgesia, immunomodulatory, to effect of cardiovascular systems etc., on the other hand, the complicacy of traditional Chinese medicine pharmaceutical cpd and the limitation of concocting method thereof also are the major reasons that causes active constituents of medicine better not play a role, thereby the specific reactive monomer compound of searching is one of important content of the modernization of Chinese medicine from these conventional medicaments.Abroad, the searching of the specific pharmacology reactive monomer of batrachians skin compound has become the focus of new drug invention.The foreign scholar isolates a lower molecular weight in the bell toad eastwardly and has the active polypeptide BSTI of serpin, and domestic scholars has been separated to from Bombina maxima and has the inhibiting polypeptide BMTI of serine protease.The bufokinin and the ranakinin of vasodilator and hypotensive effect from toad and wood frog skin, have been obtained having.Bright smart peptide and the smart peptide of junket from the North America leopard frog and the A Bai frog, have been separated to immunomodulatory and antitumor action.The nearly more than ten years screen more than 170 kinds of batrachians skin active peptides and analogue, prove that 40 various active peptides have drug development prospect preferably.
There is long history in China to the application of batrachians medicine, but the research of its activeconstituents and pharmacological properties is mainly concentrated on organic molecules such as alkaloid, and is also less to the research of its skin activity albumen peptide matters.Odorranagrahami mainly is distributed in the Yunnan of China, and provinces such as Sichuan and Guangxi are one of characteristic resources animals of China.And at present also rarely have report about the research of Rana grahami skin active substance.
The contriver searches comparison with odorranagrahami propyl sperm peptide of the present invention and varient complete sequence amino acid structure thereof through Protein Data Bank, finds no any phase homopolypeptide.The contriver searches comparison with odorranagrahami propyl sperm peptide encoding gene of the present invention through gene database, finds no any homologous genes.
Summary of the invention:
The objective of the invention is based on above-mentioned prior art basis, provide one group to have intensive serpin activity, have the smelly frog propyl sperm peptide of odorranagrahami graduated dial, its gene and the application of various varient in pharmacy that stronger growth of tumour cell suppresses active and immunoregulatory activity simultaneously.
In order to realize purpose of the present invention, the invention provides following technical scheme:
The odorranagrahami propyl sperm peptide:
The odorranagrahami propyl sperm peptide is a kind of ring type polypeptide of Chinese amphibian animal odorranagrahami genes encoding, molecular weight 2188.68 dalton, iso-electric point 10.07 has the serpin activity. and non-enzymatic activity, odorranagrahami propyl sperm peptide total order is classified as: Ala
1-Ala
2-Leu
3-Lys
4-Gly
5-Cys
6-Trp
7-Thr
8-Lys
9-Ser
10-Ile
11-Pro
12-Pro
13-Lys
14-Pro
15-Cys
16-Phe
17-Gly
18-Lys
19-Arg
20, its halfcystine of the 6th and the 16th 's halfcystine forms intramolecular disulfide bond.
The clone of odorranagrahami propyl sperm peptide gene comprises:
The total RNA of Rana grahami skin extracts, the mRNA purifying, and mRNA reverse transcription and cDNA library construction, the design primer utilizes PCR method screening odorranagrahami protease inhibitor gene.Amplimer length is 23 Nucleotide, and its sequence is 5 ' ATGTTCACCATGAAGAAATCCCT 3 ', and another amplimer of PCR is the SMART of CLONTECH company
TM3 ' PCR Primer primer among the cDNA Library Construction Kit, its sequence is 5 ' ATTCTACAGGCCGAGGCGGCCGACATG 3 '.The positive monoclonal that obtains carries out gene nucleotide series and measures.Gene sequencing result shows that the gene of coding odorranagrahami propyl sperm peptide is made up of 304 Nucleotide, holds to 3 ' terminal sequence from 5 ' to be:
atgttcacct tgaagaaatc cctgttactc cttttctttc ttgggatcat ctccttatct 60
ttccgtgagc aagagagaga tgccgatgaa gatgatggag gggaagttac aggggaagaa 120
gtaaaaagag ctgcactcaa agggtgctgg accaagagta taccaccaaa gccttgtttt 180
ggaaaaagat aaaacttgaa atggaaatca tctgatgtgg aatatcattt agctaaatgc 240
taaatgtctg ataaaaaata aaatatattg cacgtacaaa aaaaaaaaaa aaaaaaaaaa 300
aaaa 304
Encoding mature odorranagrahami propyl sperm peptide sequence be 130-189 position Nucleotide, its aminoacid sequence is:
Ala Ala Leu Lys Gly Cys Trp Thr Lys Ser Ile Pro Pro Lys Pro Cys Phe Gly Lys Arg
1 5 10 15 20
Utilize the varient of protein science method design odorranagrahami propyl sperm peptide, its varient is as follows:
2, the 1 of propyl sperm peptides and the 2nd 's L-Ala lacks simultaneously
Leu Lys Gly Cys Trp Thr Lys Ser Ile Pro Pro Lys Pro Cys Phe Gly Lys Arg
The L-Ala that propyl sperm peptide is 3, the 1 and the 20th 's arginine lacks simultaneously
Ala Leu Lys Gly Cys Trp Thr Lys Ser Ile Pro Pro Lys Pro Cys Phe Gly Lys
The L-Ala of propyl sperm peptide 4, the 1,2 and the 20th 's arginine lacks simultaneously
Leu Lys Gly Cys Trp Thr Lys Ser Ile Pro Pro Lys Pro Cys Phe Gly Lys
The L-Ala of propyl sperm peptide 5, the 1,2, the 19th Methionin and the 20th arginine lack simultaneously
Leu Lys Gly Cys Trp Thr Lys Ser Ile Pro Pro Lys Pro Cys Phe Gly。
The preparation method of odorranagrahami propyl sperm peptide and varient thereof:
Infer the aminoacid sequence of odorranagrahami propyl sperm peptide according to the gene of coding odorranagrahami propyl sperm peptide, utilize the mutant of protein science method design odorranagrahami propyl sperm peptide, synthesize its complete sequence with automatic Peptide synthesizer.By the anti-phase C of HPLC
18Column chromatography desalination, purifying.Identify its purity with the HPLC method then, molecular weight determination adopts fast atom bombardment mass spectroscopy(FABMS) method (Fast atom bombardment mass spectrometry, FAB-MS), isoelectric focusing electrophoresis is measured iso-electric point, measures the aminoacid sequence structure with automatic Protein Sequencer.
Odorranagrahami propyl sperm peptide of the present invention, gene and varient are as the application of preparation treatment tumour, gastritis, pancreatitis medicine.
Beneficial effect of the present invention is:
By odorranagrahami propyl sperm peptide encoding gene its amino acid structure of deriving, utilize the mutant of protein science method design odorranagrahami propyl sperm peptide, synthetic odorranagrahami propyl sperm peptide and mutant thereof have significant immunomodulatory and suppress the effect of tumor growth.That this odorranagrahami propyl sperm peptide and mutant thereof have is simple in structure, synthetic convenient, suppress the tangible beneficial features of tumor effect.
Embodiment:
Further specify essentiality content of the present invention with embodiment below, but content of the present invention is not limited thereto.
The gene clone of odorranagrahami propyl sperm peptide:
I, the total RNA of Rana grahami skin extract:
A. live body odorranagrahami water cleans up, and puts into the liquid nitrogen quick-frozen 4 hours, gets skin histology, weigh, get the 300mg skin histology, add the total RNA of 10ml and extract damping fluid (Trizol solution, U.S. GIBCOBRL company product), homogenate is 30 minutes in the 20ml glass homogenizer.
B. add equal-volume phenol/chloroformic solution, violent mixing, room temperature was placed 10 minutes, and 4 ℃, centrifugal 10 minutes of 12000rpm, reject precipitation.
C. supernatant adds isopyknic Virahol, and room temperature was placed 10 minutes, and 4 ℃, centrifugal 10 minutes of 12000rpm, precipitation is washed once with 75% ethanol, dries, and pipe end throw out is the total RNA of Rana grahami skin.
The purifying of II, Rana grahami skin mRNA:
The PolyATtract of U.S. PROMEGA company is adopted in Rana grahami skin mRNA separation and purification
MRNAIsolation Systems test kit.
A. get the total RNA 500 μ g of Rana grahami skin and be dissolved in the 500 μ l DEPC water, put into 65 ℃ of water-baths 10 minutes, add Oligo (dT) probe and 13 μ l, the 20 * SSC solution of people 3 μ l, mixing is placed the room temperature cooling, is called A liquid.
B. the washing of magnetic bead (SA-PMP): magnetic bead is flicked mixing,, abandon supernatant, add 0.5 * SSC 0.3ml,, add 0.1ml 0.5 * SSC at last and suspend, be referred to as B liquid to magnetic force frame absorption 30 seconds to magnetic force frame absorption 30 seconds.
C. A liquid is added in the B liquid, room temperature was placed 10 minutes, to magnetic force frame absorption 30 seconds, abandon supernatant, with 0.1 * SSC washing 4 times, abandon supernatant at last, add 0.1ml DEPC aqueous suspension, to the magnetic force frame, adsorbed 30 seconds, supernatant is moved to new test tube, add 0.15ml DEPC water again and suspend again, to magnetic force frame absorption 30 seconds, moving supernatant to above-mentioned test tube, then is the Rana grahami skin mRNA of purifying in the supernatant.
D. add 1/10 volume 3M sodium acetate, pH5.2, the equal-volume Virahol, in-70 ℃ of placements 30 minutes, 4 ℃, centrifugal 10 minutes of 12000rpm abandoned supernatant, and resolution of precipitate is in 10 μ l DEPC water.
III, Rana grahami skin cDNA library construction: adopt the CLONTECH Creator of company
TMSMART
TMCDNALibrary Construction Kit Construction of Plasmid cDNA Library test kit.
A.cDNA first chain synthesizes (mRNA reverse transcription):
1. add 1 μ l Rana grahami skin mRNA, 1 μ l SMART IV oligonucleotide, 1 μ l CDS III/3 ' PCR primer at the aseptic centrifuge tube of 0.5ml, add 2 μ l deionized waters and make cumulative volume reach 5 μ l.
2. the reagent in the mixing centrifuge tube is also of short duration centrifugal, and 72 ℃ are incubated 2 minutes.
3. centrifuge tube was hatched on ice 2 minutes.
4. in centrifuge tube, add following reagent 2.0 μ 15 * the first chains buffering, 1.0 μ l 20mM dithiothreitol (DTT), 1.0 μ l 10mM dNTP mixtures, 1.0 μ l PowerScript ThermoScript II.
5. reagent and of short duration centrifugal in the mixing centrifuge tube is incubated 1 hour at 42 ℃.
6. centrifuge tube is placed and end the synthetic of first chain on ice.
7. it is standby to get the 2 synthetic cDNA of μ l institute, first chain from centrifuge tube.
B. adopt long terminal polymerase chain reaction (LD-PCR) method second chain that increases
1.95 ℃ preheating PCR instrument.
2. 2 μ l cDNA, first chains (mRNA reverse transcription), 80 μ l deionized waters, 10 μ l, 10 * Advantage2PCR buffering, 2 μ l, 50 * dNTP mixture, 2 μ l, 5 ' PCR primer, 2 μ l CDS III/3 ' PCR primers and 2 μ l Escherichia coli polymerase centrifuge tubes are reacted.
3. in the PCR instrument, increase by following program:
1. 95 ℃ of 20 second
2. 22 circulations:
95 ℃ of 5 second
68 ℃ 6 minutes
4. after the loop ends, synthetic cDNA two strands in the centrifuge tube is carried out extracting.
The C.PCR product Wizard of PROMEGA company
SV Gel and PCR Clean-Up System test kit carries out extracting and reclaims, and step is as follows:
1. will put upside down mixing by the isopyknic film binding buffer of the double-stranded adding of the cDNA that PCR obtains, will mix liquid then and change the centrifugal purification post over to, room temperature left standstill 5 minutes, and DNA is fully combined with pellosil.16, centrifugal 1 minute of 000g outwells the waste liquid in the collection tube.
2. the elutriant (containing ethanol) that adds 700 μ l in the centrifugal purification post, 16, centrifugal 1 minute of 000g outwells the waste liquid in the collection tube.
3. repeating step 2.
4.16, centrifugal 5 minutes of 000g.
5. the centrifugal purification post is placed new centrifuge tube.
6. add 30 μ l ultrapure waters, at room temperature left standstill 5 minutes.
7.16, centrifugal 1 minute of 000g, pipe end solution is the cDNA two strands of purified mistake.
D. the preparation of bacillus coli DH 5 alpha competent cell:
1. the single DH5 α of picking bacterium colony is inoculated in 3ml and does not contain in the LB substratum of penbritin, and 37 ℃ of overnight incubation are got above-mentioned bacterium liquid next day and are inoculated at 1: 100 in proportion in the 50ml LB nutrient solution, and 37 ℃ vibrated 2 hours.Work as OD
600Value reaches at 0.35 o'clock, the results bacterial cultures.
2. bacterium is transferred in aseptic, disposable, the ice-cold 50ml polypropylene tube, 10min puts in the side on ice, makes culture be cooled to 0 ℃.
In 4 ℃ with the centrifugal 10min of 4100r/min, to reclaim cell.
4. pour out nutrient solution, pipe is inverted 1min so that last trace nutrient solution flows to end.
5. the 0.1mol/L CaCl of every 50ml initial incubation liquid and 30ml precooling
2-MgCl
2Solution (80mmol/LMgCl
2, 20mmol/L CaCl
2) resuspended every part of cell precipitation.
In 4 ℃ with the centrifugal 10min of 4100r/min, to reclaim cell.
7. pour out nutrient solution, pipe is inverted 1min so that last trace nutrient solution flows to end.
8. every 50ml initial incubation thing ice-cold 0.1mol/L CaCl of 2ml
2Resuspended every part of cell precipitation, standby after the packing.
E. the enzyme conversion cutting, connect and connect product:
1. add 1 μ l Takara pMD18-T carrier, the double-stranded solution of 4 μ l odorranagrahami cDNA in Eppendorf tube, full dose is 5 μ l.
2. the ligase enzyme buffer mixture that adds 5 μ l (equivalent).
3.16 ℃ reaction 2 hours.
4. full dose (10 μ l) is added in the 100 μ l DH5 α competent cells, places 30 minutes in the ice.
5.42 after 90 seconds of ℃ heating, in ice, placed 1 minute again.
6. add 37 ℃ of LB substratum 890 μ l of bathing of temperature, 37 ℃ of slow shaking culture 60 minutes.
7. get 200 μ l and coat on the LB substratum that contains X-Gal, IPTG, Amp 37 ℃ and cultivated 16 hours, form single bacterium colony.
8. each LB plate washs bacterium colony with 5ml LB liquid nutrient medium, and it is frozen to add 30% glycerine.The cDNA that makes up approximately contains 1 * 10
6Individual independent clone.
IV, odorranagrahami propyl sperm peptide gene clone screening:
Amplimer length is 23 Nucleotide, and its sequence is 5 ' ATGTTCACCATGAAGAAATCCCT 3 ', and another amplimer of PCR is the SMART of CLONTECH company
TM3 ' PCRPrimer primer among the cDNA Library Construction Kit, its sequence is 5 ' ATTCTACAGGCCGAGGCGGCCGACATG 3 '.
The PCR reaction is carried out under the following conditions: 94 ℃ of 30 second, 60 ℃ of 30 second and 72 ℃ of 45 second, 35 circulations.
The bacterium cDNA library that makes up of titration at first, be diluted to suitable bacterial concentration (about 5000 bacteria/milliliters with the LB substratum that contains 100 μ g/ml penbritins then, be respectively applied for first run screening second with 30 bacteria/milliliters and take turns screening), on 96 well culture plates by 8 * 8 matrix bed boards (totally 64 holes, every hole 100 μ l), 37 ℃ of incubated overnight.Merge inoculum respectively by row, column, have 16 samples to carry out PCR and identify that the positive hole bacteria samples of intersecting enters second and takes turns screening.
V, odorranagrahami propyl sperm peptide gene sequencing and result:
Extract plasmid DNA and measure nucleotide sequence with dideoxy method, use instrument to be the full-automatic nucleotide sequencing instrument of U.S. AppliedBiosystems373A, sequencing primer is BcaBEST
TMSequencing PrimerRV-M and BcaBEST
TMSequencing Primer M13-47, BcaBEST
TMSequencing Primer RV-M sequence: 5`GAGCGGATAACAATTTCACACAGG 3 ', BcaBEST
TMSequencing Primer M13-47:5 ' CGCCAGGGTTTTCCCAGTCACGAC 3 '.Gene sequencing result from 5 ' end to 3 ' terminal sequence is:
atgttcacct tgaagaaatc cctgttactc cttttctttc ttgggatcat ctccttatct 60
ttccgtgagc aagagagaga tgccgatgaa gatgatggag gggaagttac aggggaagaa 120
gtaaaaagag ctgcactcaa agggtgctgg accaagagta taccaccaaa gccttgtttt 180
ggaaaaagat aaaacttgaa atggaaatca tctgatgtgg aatatcattt agctaaatgc 240
taaatgtctg ataaaaaata aaatatattg cacgtacaaa aaaaaaaaaa aaaaaaaaaa 300
aaaa 304
The sequence table of odorranagrahami propyl sperm peptide gene nucleotide is: sequence length is 304 bases, sequence type: nucleic acid, chain number: strand, topology: straight chain shape, sequence kind: cDNA, source: Rana grahami skin.
Encoding mature odorranagrahami propyl sperm peptide aminoacid sequence be 130-189 position Nucleotide, its aminoacid sequence is:
Ala Ala Leu Lys Gly Cys Trp Thr Lys Ser Ile Pro Pro Lys Pro Cys Phe Gly Lys Arg
1 5 10 15 20
Odorranagrahami propyl sperm peptide gene prepares the application of odorranagrahami propyl sperm peptide as genetically engineered.
Odorranagrahami propyl sperm peptide varient prepares the application of the smelly frog propyl sperm peptide of graduated dial varient as protein engineering.
Preparation odorranagrahami propyl sperm peptide and varient thereof:
The preparation method of I, odorranagrahami propyl sperm peptide: the aminoacid sequence of inferring the odorranagrahami propyl sperm peptide according to the gene of coding odorranagrahami propyl sperm peptide, utilize the mutant of protein science method design odorranagrahami propyl sperm peptide, with synthetic its complete sequence of automatic Peptide synthesizer.By the anti-phase C of HPLC
18Column chromatography desalination, purifying.
II, molecular weight determination adopt the fast atom bombardment mass spectroscopy(FABMS) method, and (Fast atom bombardment mass spectrometry, FAB-MS), with glycerine: m-nitrobenzyl alcohol: methyl-sulphoxide (1: 1: 1, V: V: V, volume ratio) is a substrate, Cs
+As projectile, electric current is 1 μ A, and emission voltage is 25Kv.
The odorranagrahami propyl sperm peptide and the varient thereof of III, purifying are identified its purity with the high-efficient liquid phase chromatogram HPLC method, molecular weight determination adopts the fast atom bombardment mass spectroscopy(FABMS) method, isoelectric focusing electrophoresis is measured iso-electric point, measures the aminoacid sequence structure with automatic Protein Sequencer.
The odorranagrahami propyl sperm peptide is a kind of ring type polypeptide of Chinese amphibian animal odorranagrahami genes encoding, molecular weight 2188.68 dalton, iso-electric point 10.07 has the serpin activity. and non-enzymatic activity, odorranagrahami propyl sperm peptide total order is classified as: Ala
1-Ala
2-Leu
3-Lys
4-Gly
5-Cys
6-Trp
7-Thr
8-Lys
9-Ser
10-Ile
11-Pro
12-Pro
13-Lys
14-Pro
15-Cys
16-Phe
17-Gly
18-Lys
19-Arg
20, its halfcystine of the 6th and the 16th 's halfcystine forms intramolecular disulfide bond.
Odorranagrahami propyl sperm peptide varient is one group of active ring type polypeptide of serpin with improvement by the method design of protein science. non-enzymatic activity, and their complete sequence is as follows:
Propyl sperm peptide 2,
Leu-Lys-Gly-Cys-Trp-Thr-Lys-Ser-Ile-Pro-Pro-Lys-Pro-Cys-Phe-Gly-Lys-Arg
Propyl sperm peptide 3,
Ala-Leu-Lys-Gly-Cys-Trp-Thr-Lys-Ser-Ile-Pro-Pro-Lys-Pro-Cys-Phe-Gly-Lys
Propyl sperm peptide 4,
Leu-Lys-Gly-Cys-Trp-Thr-Lys-Ser-Ile-Pro-Pro-Lys-Pro-Cys-Phe-Gly-Lys
Propyl sperm peptide 5,
Leu-Lys-Gly-Cys-Trp-Thr-Lys-Ser-Ile-Pro-Pro-Lys-Pro-Cys-Phe-Gly
The pharmacological evaluation of Odorranagrahami antimicrobialpeptideand:
1. odorranagrahami propyl sperm peptide and varient thereof suppress the effect of serine protease:
The odorranagrahami propyl sperm peptides of different amounts and varient is dissolved in 0.05M Tris-HCl damping fluid and a certain amount of trypsin ultimate density is 40 μ g/ml) under room temperature, be incubated 2min in 0.05M Tris-HCl damping fluid, add chromophoric substrate S-2238 (final concentration is 40 μ g/ml) at last and start reaction, the spectrophotometer of using the production of PERKIN ELMER (U.S.) company changes 2min in locating to monitor absorption value, the 0.05M Tris-HCl damping fluid and the blank that add same volume suppress constant K i=[I]/(V0/VI+1) calculate.[I] is the volumetric molar concentration of odorranagrahami propyl sperm peptide and varient thereof, and V0 is that blank is the speed of response of trypsinase and chromophoric substrate, and V1 is for adding the speed of response of trypsinase and chromophoric substrate behind odorranagrahami propyl sperm peptide and the varient thereof.This test repeats six times, averages.
No graduated dial propyl sperm peptide and varient thereof all can suppress tryptic activity very effectively, suppress needed odorranagrahami propyl sperm peptide of half tryptic activity and varient concentration thereof and suppress constant K i to see Table 1 under above-mentioned test conditions.
Table 1 odorranagrahami propyl sperm peptide and varient thereof are to the restraining effect of serine protease:
Sample | Half-inhibition concentration (ng/vml) | Ki |
Propyl sperm peptide 1 propyl sperm peptide 2 propyl sperm peptides 3 propyl sperm peptides 4 propyl sperm peptides 5 | 1640 215 159 113 60.8 | 5×10 -7 7×10 -8 5.4×10 -8 4×10 -8 2.3×10 -10 |
2. odorranagrahami propyl sperm peptide and varient thereof suppress the effect of tumor growth:
On 96 porocyte culture plates, testing sample is carried out 5 times or 2 times of doubling dilutions with perfect medium, totally six extent of dilution, each extent of dilution is established 3 repeating holes, and every hole 100 μ l are provided with the normal cell contrast simultaneously.Every hole drips 3 * 10
5The HepG2 of individual/ml, C8166 and Molt-4 cell 100 μ l.Put 37 ℃, 5%CO
2Cultivate in the incubator.Measure the toxic action of testing compound pair cell after 48 hours with mtt assay.EC50 is the concentration when 50% host cell is produced cytotoxic effect.
Table 1 odorranagrahami propyl sperm peptide and varient thereof suppress the effect of growth of tumour cell:
Sample | EC50(μM) | ||
HepG2 | C8166 | Molt-4 | |
Propyl sperm peptide 1 propyl sperm peptide 2 propyl sperm peptides 3 propyl sperm peptides 4 propyl sperm peptides 5 | 2 1.8 1.4 0.5 0.3 | 1.5 1.7 0.9 0.4 0.4 | 1 1.5 1 0.2 0.3 |
By as seen from Table 1, Rana grahami propyl sperm peptide and variation physical efficiency thereof significantly suppress the growth of hepatoma cell line (HepG2) and two kinds of lymphocytic series (C8166 and Molt-4), this shows that Rana grahami propyl sperm peptide and variant thereof have very strong inhibition tumor cell growth and regulate the effect of exempting from service, and show the performance of improvement, also have simultaneously the advantages such as sequence is simple, synthetic convenience. Can be used as the application of preparation treatment tumour, gastritis, pancreatitis medicine.
Odorranagrahami propyl sperm peptide, gene and varient and the application .seq in pharmacy thereof
SEQUENCE LISTING
<110〉Kunming Institute of Zoology, Chinese Academy of Sciences
<120〉odorranagrahami propyl sperm peptide, gene and varient and the application in pharmacy thereof
<130>1
<160>2
<170>PatentIn version 3.3
<210>1
<211>304
<212>DNA
<213>Rana grahami
<400>1
atgttcacct tgaagaaatc cctgttactc cttttctttc ttgggatcat ctccttatct 60
ttccgtgagc aagagagaga tgccgatgaa gatgatggag gggaagttac aggggaagaa 120
gtaaaaagag ctgcactcaa agggtgctgg accaagagta taccaccaaa gccttgtttt 180
ggaaaaagat aaaacttgaa atggaaatca tctgatgtgg aatatcattt agctaaatgc 240
taaatgtctg ataaaaaata aaatatattg cacgtacaaa aaaaaaaaaa aaaaaaaaaa 300
aaaa 304
<210>2
<211>20
<212>PRT
<213>Rana grahami
<400>2
Ala Ala Leu Lys Gly Cys Trp Thr Lys Ser Ile Pro Pro Lys Pro Cys
1 5 10 15
Phe Gly Lys Arg
20
Claims (5)
1. the odorranagrahami propyl sperm peptide is characterized in that this odorranagrahami propyl sperm peptide is a kind of ring type polypeptide of Chinese amphibian animal odorranagrahami genes encoding, molecular weight 2188.68 dalton, and iso-electric point 10.07 has the serpin activity.Non-enzymatic activity, odorranagrahami propyl sperm peptide total order is classified as:
Ala
1-Ala
2-Leu
3-Lys
4-Gly
5-Cys
6-Trp
7-Thr
8-Lys
9-Ser
10-Ile
11-Pro
12-Pro
13-Lys
14-Pro
15-Cys
16-Phe
17-Gly
18-Lys
19-Arg
20, its halfcystine of the 6th and the 16th 's halfcystine forms intramolecular disulfide bond.
2. odorranagrahami propyl sperm peptide gene nucleotide series, it is characterized in that: cDNA is made up of 304 Nucleotide, and it from 5 ' end to 3 ' terminal sequence is:
atgttcacct tgaagaaatc cctgttactc cttttctttc ttgggatcat ctccttatct 60
ttccgtgagc aagagagaga tgccgatgaa gatgatggag gggaagttac aggggaagaa 120
gtaaaaagag ctgcactcaa agggtgctgg accaagagta taccaccaaa gccttgtttt 180
ggaaaaagat aaaacttgaa atggaaatca tctgatgtgg aatatcattt agctaaatgc 240
taaatgtctg ataaaaaata aaatatattg cacgtacaaa aaaaaaaaaa aaaaaaaaaa 300
aaaa 304。
3. the described odorranagrahami propyl sperm peptide of claim 2 gene nucleotide series is characterized in that, encoding mature odorranagrahami propyl sperm peptide sequence be 130-189 position Nucleotide, its aminoacid sequence is:
Ala Ala Leu Lys Gly Cys Trp Thr Lys Ser Ile Pro Pro Lys Pro Cys Phe Gly Lys Arg
1 5 10 15 20。
4. the varient of odorranagrahami propyl sperm peptide is characterized in that its varient is as follows:
2, the 1 of propyl sperm peptides and the 2nd 's L-Ala lacks simultaneously
Leu Lys Gly Cys Trp Thr Lys Ser Ile Pro Pro Lys Pro Cys Phe Gly Lys Arg
The L-Ala that propyl sperm peptide is 3, the 1 and the 20th 's arginine lacks simultaneously
Ala Leu Lys Gly Cys Trp Thr Lys Ser Ile Pro Pro Lys Pro Cys Phe Gly Lys
The L-Ala of propyl sperm peptide 4, the 1,2 and the 20th 's arginine lacks simultaneously
Leu Lys Gly Cys Trp Thr Lys Ser Ile Pro Pro Lys Pro Cys Phe Gly Lys
The L-Ala of propyl sperm peptide 5, the 1,2, the 19th Methionin and the 20th arginine lack simultaneously
Leu Lys Gly Cys Trp Thr Lys Ser Ile Pro Pro Lys Pro Cys Phe Gly。
5. the application of odorranagrahami propyl sperm peptide, gene and varient is characterized in that the application as preparation treatment tumour, gastritis, pancreatitis medicine of odorranagrahami propyl sperm peptide, gene and varient.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CNB2006100109315A CN100389125C (en) | 2006-05-30 | 2006-05-30 | Rana grahami propyl sperm peptide, gene and variant and its pharmaceutical use |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CNB2006100109315A CN100389125C (en) | 2006-05-30 | 2006-05-30 | Rana grahami propyl sperm peptide, gene and variant and its pharmaceutical use |
Publications (2)
Publication Number | Publication Date |
---|---|
CN1850857A true CN1850857A (en) | 2006-10-25 |
CN100389125C CN100389125C (en) | 2008-05-21 |
Family
ID=37132359
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CNB2006100109315A Expired - Fee Related CN100389125C (en) | 2006-05-30 | 2006-05-30 | Rana grahami propyl sperm peptide, gene and variant and its pharmaceutical use |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN100389125C (en) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN100522992C (en) * | 2007-02-12 | 2009-08-05 | 中国科学院昆明动物研究所 | Novel ring-shape small-peptide BA and its use |
Family Cites Families (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN1333249A (en) * | 2000-07-07 | 2002-01-30 | 上海博德基因开发有限公司 | Novel polypeptide--huan nervous serinje protease inhibitor (PI12) 83.27 and polynucleotide for encoding said polypeptide |
EP1227152A1 (en) * | 2001-01-30 | 2002-07-31 | Société des Produits Nestlé S.A. | Bacterial strain and genome of bifidobacterium |
-
2006
- 2006-05-30 CN CNB2006100109315A patent/CN100389125C/en not_active Expired - Fee Related
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN100522992C (en) * | 2007-02-12 | 2009-08-05 | 中国科学院昆明动物研究所 | Novel ring-shape small-peptide BA and its use |
Also Published As
Publication number | Publication date |
---|---|
CN100389125C (en) | 2008-05-21 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN1264858C (en) | Angiogenesis-inhibitory tripeptides, compositions and their methods of use | |
CN1236370A (en) | Chemically modified polypeptides | |
CN1876676A (en) | Antineoplastic oligopeptide and its preparation method and application | |
CN100351270C (en) | Antibacterial peptide of brown-spotted torrential frog, its gene and application in drug preparation | |
CN1304415C (en) | Pyrane derivatives as both ACE- and NEP- inhibitors | |
CN1075148A (en) | New megalokaryocyte amplification gene | |
CN1883703A (en) | Serine protease inhibitor of Rana grahami, its gene and application | |
CN1850857A (en) | Rana grahami propyl sperm peptide, gene and variant and its pharmaceutical use | |
CN101037473A (en) | R. grahami rnmunoregulating polypeptide, gene and variant and its application in medicine production | |
TW202019947A (en) | Novel peptides and its derivatives capable of stimulating cytokine release | |
CN100351271C (en) | Active polypeptide of brown-spotted torrential frog, its gene and application in drug preparation | |
CN1034123C (en) | Calcium channel blocking polypeptides from filistata hibernalis | |
CN106432483A (en) | Hylarana guentheri skin serine endopeptidase peptide inhibitor, as well as gene and pharmaceutical application thereof | |
CN1170928C (en) | Liver cancer related gene and its application | |
CN1840544A (en) | ESC42 protein, preparation method and use thereof | |
CN1247616C (en) | New monomeric insulin and its medicinal composition and prepn process | |
CN1238377C (en) | Acidic antibacterial peptides and gene as well as its application in pharmacy | |
CN1506375A (en) | Azurin as bacterial protein with wide-spectrum antitumor function and its use and medicinal composition | |
CN1289527C (en) | Horny cell growth factor mutant with high bioactivity and its preparation process and use thereof | |
CN1260359C (en) | High soluble expressed tricholsanthin mutant and its preparing method | |
CN107501395B (en) | Rana nigromaculata antioxidant peptide, gene and application thereof | |
CN106496317A (en) | Guenther's frog secretion peptide and its gene and the application in pharmacy | |
CN100335499C (en) | C-terminal amino acid lactone modified extrasin alpha-1 and its uses | |
CN1301265C (en) | Synthesized polypeptide and application | |
CN1324046C (en) | Protein and sugar binding protein with anti-HIV activity |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C14 | Grant of patent or utility model | ||
GR01 | Patent grant | ||
C17 | Cessation of patent right | ||
CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20080521 |