CN106496317A - Guenther's frog secretion peptide and its gene and the application in pharmacy - Google Patents

Guenther's frog secretion peptide and its gene and the application in pharmacy Download PDF

Info

Publication number
CN106496317A
CN106496317A CN201610982013.2A CN201610982013A CN106496317A CN 106496317 A CN106496317 A CN 106496317A CN 201610982013 A CN201610982013 A CN 201610982013A CN 106496317 A CN106496317 A CN 106496317A
Authority
CN
China
Prior art keywords
frog
guenther
peptide
secretion peptide
secretion
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201610982013.2A
Other languages
Chinese (zh)
Other versions
CN106496317B (en
Inventor
徐学清
曾白霜
柴金为
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Southern Medical University
Original Assignee
Southern Medical University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Southern Medical University filed Critical Southern Medical University
Priority to CN201610982013.2A priority Critical patent/CN106496317B/en
Publication of CN106496317A publication Critical patent/CN106496317A/en
Application granted granted Critical
Publication of CN106496317B publication Critical patent/CN106496317B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/463—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from amphibians
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2002/00—Food compositions, function of food ingredients or processes for food or foodstuffs
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Toxicology (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The present invention relates to a kind of Guenther's frog secretion peptide and its gene and the application in pharmacy, a kind of ring type polypeptide that the Guenther's frog secretion peptide is made up of 43 amino acid, as shown in SEQ ID NO.1, its 37th cysteine and the 43rd cysteine coordinate intramolecular disulfide bond its amino acid sequence.The gene order of the Guenther's frog secretion peptide is made up of SEQ ID NO.4, and wherein coding functional maturation Guenther's frog secretion peptide is the 133rd 261 nucleotides.The present invention derives its ripe functional polypeptide amino acid sequence by the gene that Guenther's frog secretes peptide, and the Guenther's frog secretion peptide of synthesis has very strong antibacterial, resisiting influenza virus and anti-oxidation function.Guenther's frog secretion peptide has simple structure, artificial synthesized the characteristics of facilitate, and apply caused by cause pathogeny imcrobe infection disease and free-radical oxidation as preparing in medicine, beauty and skin care medicine and food additives.

Description

Guenther's frog secretion peptide and its gene and the application in pharmacy
Technical field：
The present invention relates to biomedical sector, and in particular to a kind of albumen obtained from animal tissue and in bio-pharmaceuticals In purposes.
Background technology：
The discovery of penicillin allows one to tackle the relevant disease caused by all kinds of cause pathogeny imcrobe infections, thus spreads out All kinds of antibiotic for bearing are even more to protecting human health to be made that tremendous contribution.But as people are to these " traditional antibiosis The Long-Time Service and abuse of element ", causes many bacteriums to generate drug resistance to them.The appearance of the superbacteria of multidrug resistant makes Exploitation novel antimicrobial medicine becomes especially urgent.Antibacterial peptide is that molecule amount is less than 10,000, by 10-50 amino acid group Into, have and kill or the active peptides that suppress growth of microorganism.Recent studies have shown that：Antibacterial peptide not only has the anti-micro- of wide spectrum Biologically active, while the superiority for having " conventional antibiotic " incomparable：Such as, except can directly killing microorganism and being difficult Inducible strain is produced outside drug resistance, and antibacterial peptide can also adjust the immunologic function of host, suppress inflammatory reaction, indirectly in infection Play a role in property disease treatment (Nat Rev Microbiol, 2012,10 (4):243-254).Additionally, in serious bacterial sense During dye, antibacterial peptide can also neutralize endotoxin, mitigate pyemia, stop rapidly or limit while quick killing pathogenic microorganism System infection diffusion (Antimicrob Agents Chemother, 2014,58 (9):5363-5371).Therefore, antibacterial peptide has uncommon Prestige becomes antimicrobial agents of new generation.
At present, the development of polypeptide antimicrobial agents is received increasingly extensive attention (Future Med Chem, 2013,5 (3)；315-337).According to domestic and foreign literature, so far, at least 20 kinds work obtained from different bio-separations Property polypeptide drug candidate enter clinical experimental stage (Future Med Chem, 2013,5 (3):315-337).Such as, Xoma is public The Orphan drug Neuprex and Cutanea life science companies for treating meningococcemia of department's research and development research and develop For treat the Omiganan medicinal external emulsifiable pastes of rosacea enter the clinical research of three phases (Curt Protein Pept Sci, 2012,13(7):611-619)；In addition, the research and development of Ellceutix companies for treating the skin infection medicine that MRSA causes PMX-30063 come into exploitation preclinical study (Expert Rev Anti Infect Ther, 2014,12 (12):1477- 1486).
A lot of amphibian animals are widely used as Chinese tradition Chinese medicine and national medicine.Such as Chinese toad (Bufo Gargarizans), Bombina maxima (Bombina maxima), Rana nigromaculata (Pelophylax nigromaculata) and rana limnocharis (Euphlyctis limnocharis) etc..The skin and internal organ of these amphibian animals has extensive pharmacologically active and clinic Curative effect.Report that pharmacologically active has：Antimicrobial, antitumor, analgesia, local anaesthesia, immunological regulation, to Cardiovascular System Deng (Dongwuxue Yanjiu, 2015,36 (4):183-222；Chem Rev.2015,115(4):1760-1846).In state Outward, the searching of the specific pharmacology active monomer compound of amphibian animal skin has been the focus of new drug discovery.Such as from Xenopus laevis (Xenopus Laevis the active peptides Magainin tool broad spectrum antimicrobial effects that) skin secretion is obtained, while there is antitumor activity, It has been approved as extensive pedigree antibiotic in the U.S., its gene engineering product is as antibacterials by microbiological Biotech companies be used for treat diabetes patient's foot ulcers (Curr Protein Pept Sci, 2012,13 (8):723- 738.).
There is long history in China to the application of amphibian animal medicine, but main to its active component and pharmacological Quality Research The organic molecules such as alkaloid are concentrated on, few to its skin activity peptides material research.Guenther's frog (Hylarana Guentheri middle and south each province of China, Taiwan, Hainan Island and Hong Kong) is distributed mainly on, is one of China characteristic resources animal.
The complete sequence amino acid structure of the Guenther's frog secretion peptide of the present invention is entered line search through Protein Data Bank by inventor Relatively, any phase homopolypeptide is found no.The Guenther's frog secretion DNA encoding peptide of the present invention is entered by inventor through gene database Line search is compared, and finds no any homologous genes.
Content of the invention：
The purpose of the present invention is based on above-mentioned technical background, there is provided plant new with broad spectrum antimicrobial (including gram Positive and negative bacterium, fungi and virus) Guenther's frog secretion peptide and its gene and it as preparing cause pathogeny imcrobe infection disease Medicine and beauty and skin care medicine application.
In order to solve above-mentioned technical problem, the technical solution used in the present invention is：
A kind of Guenther's frog secretes peptide, the cyclic peptide that described Guenther's frog secretion peptide is made up of, molecular weight 43 amino acid 5005.97 dalton, isoelectric point 9.481, its amino acid sequence is：Gly Leu Phe Ser Lys Lys Gly Gly Lys Gly Gly Lys Ser Trp Ile Lys Gly Val Phe Lys Gly Ile Lys Gly Ile Gly Lys Glu Val Gly Gly Asp Val Ile Arg Thr Gly Ile Glu Ile Ala Ala Cys Lys Ile Lys Gly Glu Cys (GLFSKKGGKGGKSWIKGVFKGIKGIGKEV GGDVIRTGIEIAACKIKGEC) (SEQ ID NO.1), above-mentioned Its 37th cysteine of polypeptide and the 43rd cysteine coordinate intramolecular disulfide bond.
The encoding gene of the Guenther's frog secretion peptide is made up of 359 nucleotides, and it is its sequence to hold to 3 ' terminal sequences from 5 ' For (SEQ ID NO.4)：
133-261 positions nucleotide coding tool functional maturation Guenther's frog secretion peptide (SEQ ID NO.1) in sequence.
The Guenther's frog secretion peptide can be in the medicine and beauty and skin care medicine for preparing cause pathogeny imcrobe infection disease Application.
The beneficial effects of the present invention is:
Its amino acid structure is derived by Guenther's frog secretion DNA encoding peptide, the Guenther's frog secretion peptide of synthesis has significant suppression Bacterium processed, fungi, viral growth and antioxidation.The Guenther's frog secretion peptide has simple structure, artificial synthesized convenience, antibacterial The wide beneficial features of pedigree.
Description of the drawings：
Fig. 1 is that Guenther's frog of the present invention secretes peptide HPLC Purification results；
Fig. 2 is that Guenther's frog of the present invention secretes peptide Mass Spectrometric Identification result；
Fig. 3 is that Guenther's frog of the present invention secretion peptide removes DPPH free radicals " amount-effect " relation curve；
Fig. 4 is that Guenther's frog of the present invention secretion peptide removes ABTS free radicals " amount-effect " relation curve；
Fig. 5 is the intercellular fusion effect that Guenther's frog secretion peptide of the present invention suppresses influenza virus mediation.Natural pond in figure A, B and C Water frog secretion peptide concentration is respectively 10 μM, 1uM and 0 μM, and figure D is virus-free n.s control.
Specific embodiment：
With reference to the accompanying drawings and detailed description the present invention is described in further details：
The Guenther's frog secretion peptide of the present invention, the cyclic peptide that described Guenther's frog secretion peptide is made up of 43 amino acid, molecular weight 5005.97 dalton, isoelectric point 9.481, its amino acid sequence is：Gly Leu Phe Ser Lys Lys Gly Gly Lys Gly Gly Lys Ser Trp Ile Lys Gly Val Phe Lys Gly Ile Lys Gly Ile Gly Lys Glu Val Gly Gly Asp Val Ile Arg Thr Gly Ile Glu Ile Ala Ala Cys Lys Ile Lys Gly Glu Cys (SEQ ID NO.1), its 37th cysteine of aforementioned polypeptides and the 43rd cysteine coordinate molecule Interior disulfide bond.
The 133-261 positions nucleotide coding of the gene order SEQ ID NO.4 of the Guenther's frog secretion peptide.The present invention's The preparation process of Guenther's frog secretion peptide and its gene comprises the steps：
Embodiment 1, Guenther's frog secretion peptide gene clone：
I, Guenther's frog skin Total RNAs extraction：Live body Guenther's frog is cleaned up with water, is put into quick-frozen 4h in liquid nitrogen, is taken skin Tissue, weighs, and takes 300mg skin histologies, adds 10m1 Total RNAs extraction buffer solutions (Trizol solution, GIBCOBRL companies of the U.S. Product), 30min is homogenized in 20m1 glass homogenizers.Equal-volume phenol/chloroformic solution is added, is acutely mixed, room temperature is placed 10min, 4 DEG C, 12000rpm is centrifuged 10min, and reject is precipitated.To in supernatant, add isopyknic isopropanol, room temperature to place 10min, 4 DEG C, 12000rpm is centrifuged 10min, and precipitation is washed once with 75% ethanol, dried, and the sediment of ttom of pipe is Guenther's frog Skin total serum IgE.
II, the purifying of Guenther's frog skin mRNA：Guenther's frog skin mRNA is isolated and purified using PROMEGA companies of the U.S.MRNA Isolation Systems kits.Specific as follows：Take 500 μ g of Guenther's frog skin total serum IgE to be dissolved in In 500 μ l DEPC water, 65 DEG C of water-bath 10min, plus 3 μ l Oligo (dT) probes of people and 13 μ l 20 × SSC solution are put into, are mixed Even, place room temperature cooling, referred to as A liquid.Magnetic bead is flicked mixing, is adsorbed 30S to magnetic frame, is abandoned supernatant, plus 0.5 × SSC 0.3m1, adsorbs 30S to magnetic frame, finally plus 0.5 × SSC of 0.1ml suspend, referred to as B liquid.A liquid is added in B liquid, room temperature Place 10 minutes, adsorb 30sec to magnetic frame, abandon supernatant, washed with 0.1 × SSC 4 times, finally abandon supernatant, plus 0.L ml DEPC aqueous suspensions, to magnetic frame adsorb 30sec, supernatant are moved to new test tube, 0.15m1DEPC water is added and is suspended again, Adsorb 30S to magnetic frame, supernatant is moved to above-mentioned test tube, be then the Guenther's frog skin mRNA of purifying in supernatant.Add 1/10 volume 3M sodium acetates, pH5.2, equal-volume isopropanol are placed 30 minutes in -70 DEG C, and 4 DEG C, 12000rpm is centrifuged 10min, abandons supernatant, sinks Shallow lake is dissolved in 10 μ l DEPC water and obtains Guenther's frog skin mRNA.
III, Guenther's frog skin cDNA library build：Using CLONTECH companies CreatorTM SMART TM cDNA Library Construction Kit Construction of Plasmid cDNA Library kits.
The first chains of A.cDNA synthesize (mRNA reverse transcriptions)：1 μ l Guenther's frog skins are added in the aseptic centrifuge tubes of 0.5ml MRNA, 1 μ l SMART IV oligonucleotides, 1 μ l CDS III/3 ' PCR primers, plus 2 μ l deionized waters make cumulative volume reach 5 μ l.Mix the reagent in centrifuge tube and 15sec, 72 DEG C of insulation 2min are centrifuged with 12000rpm.Centrifuge tube is incubated on ice 2min.2.0 μ l of following reagent, 5 × the first chains buffering, 1.0 μ l 20mM dithiothreitol (DTT)s, 1.0 μ l are added in centrifuge tube 10mM dNTP mixtures, 1.0 μ l PowerScript reverse transcriptase.Mixing centrifuge tube in reagent and with 12000rpm be centrifuged 15sec, is incubated 1h at 42 DEG C.Centrifuge tube is placed in the synthesis for stopping the first chain on ice.The cDNA synthesized by 2 μ l is taken from centrifuge tube First chain is standby.
B. the second chain is expanded using long end polymeric PCR (LD-PCR) method：95 DEG C of preheating PCR instruments.By 2 μ l The first chains of cDNA (mRNA reverse transcriptions), 80 μ l deionized waters, 10 μ 10 × Advantage of l 2PCR bufferings, 2 μ 50 × dNTP of l Mixture, 2 μ l, 5 ' PCR primers, 2 μ l CDS III/3 ' PCR primers and 2 μ l Escherichia coli polymerases centrifuge tubes are carried out instead Should.Expand by following procedure in PCR instrument：95 DEG C of 20sec, 95 DEG C of 5sec, 68 DEG C of 6min, 22 circulations.After circulation terminates, will The cDNA double-strands synthesized in centrifuge tube are stripped.
C.PCR products PROMEGA companiesSV Gel and PCR Clean-Up System kits Recovery is stripped, step is as follows：The cDNA double-strands obtained by PCR are added the reverse mixing of isopyknic film combination buffering, Then mixed liquor is proceeded to centrifugal purification post, is stored at room temperature 5 minutes, DNA is fully combined with pellosil.It is centrifuged with 12000rpm 30sec, outwells the waste liquid in collecting pipe.The eluent (containing ethanol) of 700 μ l is added in centrifugal purification post, with 12000rpm from Heart 30sec, outwells the waste liquid in collecting pipe.Repeat step above-mentioned steps.12000rpm is centrifuged 5min.Centrifugal purification post is placed in In new centrifuge tube.30 μ l ultra-pure waters are added, 5min is stood at room temperature.30sec is centrifuged with 12000rpm, ttom of pipe solution is The cDNA double-strands of purified mistake.
D. the conversion of digestion, connection and connection product：In microcentrifugal tube, add 1 μ l Takara pMD18-T to carry Body, 4 μ l Guenther's frog cDNA double-strand solution, full dose are 5 μ l.Add the ligase buffer mixture of 5 μ l.16 DEG C of reaction 2h.Full dose During (10 μ l) is added to 100 μ l DH5 α competent cells, 30min in ice, is placed.After 42 DEG C of heating 90Sec, then place in ice 1 minute.Add 37 DEG C of 890 μ l of LB culture mediums being incubated, 37 DEG C of slowly vibrating culture 60min.Take 200 μ l to coat containing X- On the LB culture mediums of Gal, IPTG, Amp, 37 DEG C of culture 16h, form single bacterium colony.Each LB plate is washed with 5m1LB fluid nutrient mediums Bacterium colony is washed, plus 30% glycerine is frozen.The cDNA of structure is greatly containing about 1 × 106Individual independent clone.
IVth, Guenther's frog secretion peptide gene colony screening：Amplimer length is 24 nucleotides, and its sequence is 5 ' ATGTTCACCTTGAAGAAACC CCTG 3 ' (SEQ ID NO.2), another amplimers of PCR are CLONTECH companies SMARTTM 3 ' PCR Primer primers in cDNA Library Construction Kit, its sequence are 5 ' ATTCTAGAGGCCGAGGCGGCCGACATG 3’(SEQ ID NO.3).PCR reactions are carried out under the following conditions：94℃ 30sec, 50 DEG C of 45sec and 72 DEG C of 2.5min, 35 circulations.
Titrate the bacterium cDNA library of structure first, be then diluted to the LB culture mediums containing 100 μ g/ml ampicillins Appropriate bacterial concentration (about 5000 bacteria/milliliters and 30 bacteria/milliliters are respectively used to first run screening the second wheel screening), On 96 well culture plates by 8 × 8 matrix bed boards (totally 64 hole, per 100 μ of hole 1), 37 DEG C of incubated overnights.Merge respectively carefully by row, column Bacteria culture fluid, has 16 samples to enter performing PCR identification, intersects positive hole bacteria samples and enters the second wheel screening.
Vth, Guenther's frog secretion peptide gene sequence is determined and result：Extract DNA dideoxy and determine nucleotides sequence Row, are the full-automatic nucleotide sequencing instrument of U.S. Applied Biosystems 373A using instrument, and sequencing primer is BcaBESTTM Sequencing Primer RV-M and BcaBESTTM Sequencing Primer M13-47, BcaBESTTM Sequencing Primer RV-M sequences：5`GAGCGGATAACAATTTCACACAGG 3’(SEQ ID NO.5), BcaBESTTM Sequencing Primer M13-47：5’CGCCAGGGTTTTCCCAGTCACGAC 3’(SEQ ID NO.6).It is (SEQ ID NO.4) that gene sequencing result is held to 3 ' terminal sequences from 5 ':
Guenther's frog secretes the sequence table of peptide gene nucleotides：Sequence length is 359 bases；Sequence type：Nucleic acid；Chain Number：Single-stranded；Topology：Straight-chain；Sequence species：cDNA；Source：Guenther's frog skin.
The gene for secreting peptide according to Guenther's frog infers that coding is 133-261 positions nucleosides by the secretion peptide ripe living of function Acid, amino acid sequence is：GLFSKKGGKGGKSWIKGVFKGIKGIGKEV GGDVIRTGIEIAACKIKGEC are (see sequence SEQ ID NO.1)
Embodiment 2, Guenther's frog secrete the preparation of peptide：
Ith, Guenther's frog secretes the preparation method of peptide：The gene for secreting peptide according to Guenther's frog infers that coding is living by the maturation of function With automatic Peptide synthesizer synthesis polypeptide after secretion peptide amino acid sequence.Disulfide bond is formed by air oxidation process, specially In flask by polypeptide dissolving according to 0.1mg/ml in 0.1% acetum after titrate into pH 7.8 with ammonium hydroxide, then It is stirred overnight at room temperature.By the anti-phase C18 column chromatographies desalinations of HPLC, purifying.During purifying, A liquid is 0.05%TFA+2%CH3CN, B Liquid is 0.05%TFA+90%CH3CN, polypeptide occur in 15 minutes B liquid concentration in 32-47%, and Detection wavelength is 220nm.
IIth, molecular weight determination adopts fast atom bombardment mass spectroscopy method (Fast atom bombardment mass Spectrometry, FAB-MS), with glycerine:M-nitrobenzyl alcohol:Dimethyl sulfoxide (1:1:L, V:V:V, volume ratio) be substrate, Cs+ Used as projectile, electric current is 1 μ A, and emitting voltage is 25Kv.
IIIth, Guenther's frog secretion peptide high performance liquid chromatography (HPLC) method of purifying identifies its purity, isoelectric focusing electrophoresis Isoelectric point is determined, and amino acid sequence structure is determined with automatic Protein Sequencer.
Guenther's frog secretion peptide is a kind of ring type polypeptide of Chinese amphibian animal Guenther's frog secretion peptide gene coding, 5005.97 dalton, isoelectric point 9.481, polypeptide complete sequence primary structure is： GLFSKKGGKGGKSWIKGVFKGIKGIGKEVGGDVIRTGIEIAACKIKGEC, its 37th cysteine and the 4th 13 cysteines form intramolecular disulfide bond.
Embodiment 3, Guenther's frog secrete the activity experiment of peptide
Ith, bacteria growing inhibiting ability is determined
Antibacterial activity detection adopts cylinder plate method, and culture medium is plain agar culture medium.It is injected separately into the culture of heating and melting Base 20m1 is in plate as bottom so as to uniform stand cloth in ware bottom, after solidification, after separately taking the appropriate heating and melting of culture medium, 5m1 bacteria suspensions are added in every ware respectively, is shaken up so as to uniform stand cloth on bottom, as bacterium layer.After cooling, in plate Equidistant uniformly it is put into the stainless steel cup 6 that has sterilized.First steel bowl adds the testing compound of 0.1-0.3mg/ml concentration Solution 0.l ml, remaining steel bowl add sample liquid, 37 DEG C of cultures to observe inhibition zone size using doubling dilution.Inhibition zone More than l0mm as minimal inhibitory concentration (minimal inhibitory concentration, MIC).Bacterium bacterial strain is originated In No.1 Hospital Attached to Kunming Medical College, this test is repeated four times, and averages, as a result as shown in table 1, the Guenther's frog point of synthesis Secreting peptide can significant bacteria growing inhibiting.
1. Guenther's frog of table secretion peptide bacteria growing inhibiting activity
IIth, fungi energy for growth is suppressed to determine
Antifungal activity detection adopts cylinder plate method, culture medium to be improvement Sabouraud (Sabousand) culture medium.It is injected separately into The culture medium 20ml that heating is dissolved is in plate as bottom so as to uniformly spreads out cloth at ware bottom, separately takes culture medium appropriate after solidification Heating is dissolved, and adds 5ml bacteria suspensions respectively, shake up in every ware so as to uniform stand cloth on bottom, used as bacterium layer.After cooling, The stainless steel cup 5 that has sterilized is put in plate moderate distance.First steel bowl adds the testing compound of 0.3mg/ml concentration Solution 0.1ml, remaining steel bowl add sample liquid, 37 DEG C of cultures to measure inhibition zone size after 24h-48h using doubling dilution. More than inhibition zone 10mm is used as minimal inhibitory concentration (minimal inhibitory concentration, MIC).Bacterium bacterial strain Derive from institute of microbiology of Yunnan University, this experiment do three parallel, take geometrical mean, as a result as shown in table 2, synthesis Guenther's frog secretion peptide can significantly suppress fungi to grow.
2. Guenther's frog of table secretion peptide suppresses fungi growth activity
IIIth, determination oxidative
1) measure of DPPH radical scavenging activities
Anti-oxidant using the determination method research of DPPH (1,1-diphenyl-2-picryl-hydrazyl) free radical scavenging activity Polypeptide.Compound concentration is the DPPH ethanol solutions of 1 × 10-5mol/L, keeps in dark place.By 2ml, the DPPH absolute ethyl alcohols of 0.1mM Solution is added in the clean tube containing 2ml difference enzymolysis samples, is mixed.After 30min is placed under room temperature, survey at 517nm Determine absorbance, light absorption value is less, show that free radical understands that ability is stronger.
Clearance rate (%)=【1-(Ai-Aj)/A0】* 100%
In formula, A0For 2ml, the sample reagent of the DPPH ethanol solution+2ml of 0.1mM, blank, AiFor 2ml, The sample of the DPPH ethanol solution+2ml of 0.1mM, AjSample for the absolute ethyl alcohol+2ml of 2ml.
2) measure of ABTS free radical scavenging activities
ABTS is dissolved with deionized water, make ABTS concentration reach 7mmol/L, add potassium peroxydisulfate, make potassium peroxydisulfate Concentration is 2.45nmol/L.The solution is placed in dark place overnight 12～16h at room temperature afterwards.Will be molten for the ABTS free radicals for generating With phosphate buffer, (7.4) PBS, 0.2mol/L, pH dilute liquid so as to which the light absorption value under 734nm is 0.70.Take 0.1ml enzymes Solution liquid is mixed with the free base fluids of 2.9ml ABTS, is shaken up 30 seconds, and dark place is reacted 10 minutes, then determines reaction under 734nm The light absorption value of liquid.Hydrolyzate is replaced to make with distilled water blank.
Understand rate (%)=(Ai-Aj)/A0* 100%
In formula, A0For 2.9ml ABTS reagents and the light absorption value of 0.1ml distillation water mixed liquids, AjFor 2.9ml ABTS+ The light absorption value of the enzymolysis liquid mixed liquor of 0.1ml.
As shown in Figures 3 and 4, Guenther's frog secretion peptide can significantly remove DPPH and ABTS free radicals.Free-radical oxidation is in old age The neurological that dementia, Parkinson's disease, diabetes, rheumatoid arthritis and amyotrophic lateral sclerosis cause Play an important role in property disease.Mercuric chloride protease inhibitory peptides can be removed free radical well and can illustrate which can apply to free radical The treatment of relevant disease caused by oxidation.In addition, for the infringement for preventing free radical from causing skin, adding in cosmetics and skincare product Plus free radical scavenger is than indispensable.Therefore, Mercuric chloride protease inhibitory peptides can also be applied in cosmetics and skincare product.
IVth, the rejection ability of proliferation of influenza virus is determined
1) the entrance rejection ability of five kinds of difference H5N1 pseudovirus is determined
The preparation of H5N1 pseudovirus and drug-treated：Cell is with containing 10% calf serum, 1% glutamine, 2% green grass or young crops/chain The DMEM nutrient solution cultures of mycin.By the 293T cells in exponential phase with 3x105/ ml density is inoculated in 6 hole cell trainings Foster plate, per hole 2ml, 37 DEG C, 5%CO2Overnight incubation.When cell density reaches 80% or so, according to PEI transfection reagent explanations Book step operation.15 μ l PEI transfection reagents and 200 μ l are added in a sterile vial without serum and dual anti-DMEM trainings Foster base, mixes and is stored at room temperature 5min.3 μ g pNL4-3.luc.R-E-, 1 μ g HA, 1 μ g NA are added toward PEI-DMEM mixed liquors Plasmid, mixes and is stored at room temperature 30min, to form transfection composite.Transfection composite is added in cell, six holes are gently rotated Plate so as to be evenly distributed.5%CO2, 37 DEG C culture 10h, by nutrient solution be replaced with the DMEM nutrient solutions containing 10% calf serum after Continuous culture 48h, 2000rpm centrifugation 5min collects cell culture, and the supernatant containing pseudovirus is diluted to every hole in 96 orifice plates The Guenther's frog for being diluted to variable concentrations after 1ng/p24 concentration respectively with 2 times secretes peptide and positive control medicine CL385319 37 DEG C incubation 30min.
The inhibitory action detection that pseudovirus is entered：1X104Individual/hole mdck cell is trained with being inoculated in 96 porocyte culture plates Foster 24h.It is added separately in 96 orifice plates containing mdck cell continue culture at 37 DEG C by pseudovirus mixed liquor good for above-mentioned incubation 48h.Culture supernatant is siphoned away, cell twice is washed with PBS, add 50 μ l lysates per hole, shake 20min, draw after cell lysis 40 μ l lysates add luciferase chromogenic substrate (Promega, Madison, WI, US), in multi-function microplate reader to blank (Genios Pro, Tecan, US) upper detection values of chemiluminescence, judges the activity of Drug inhibition cell entry.Compound inhibiting rate (%)=[1- (E-N)/(P-N)] × 100, wherein E represent the values of chemiluminescence of experimental group, and P represents positive namely not dosing Thing only adds the values of chemiluminescence of virus, N to represent the values of chemiluminescence of negative control group.Half-inhibition concentration (the IC of compound50) As the index of compound antiviral activity, calculated by Calccusyn softwares.As shown in table 3, Guenther's frog secretion peptide pair Various different H5N1 pseudovirus have good inhibitory activity.
The inhibitory activity of the anti-H5N1 bird flus pseudovirus infection of 3. Guenther's frog of table secretion peptide
2) the virus-mediated cell fusion rejection abilities of A/Thailand/Kan353/2004-HA are determined
LinXA cells are with 4 × 105/ hole is inoculated into 12 orifice plates.After 16h, A/Thailand/Kan353/2004-HA plasmids 0.8ugDNA/ holes are transfected to specifications with Lipofectamine LTX (Life Technologies).Transfect after 24h Culture medium is replaced with the DMEM containing 10%FBS.Serum-free DMEM washed cells are used after 24h, and use trypsin digestion cell, 10% Pancreatin, cell Guenther's frog secretion peptide and DMSO37 respectively with 0.5ml 0.2%FBS DMEM dilutions are removed in FBS DMEM washings DEG C incubation 15min.Suck supernatant to wash twice 37 in DMEM solution of the rear cell in 0.5ml containing respective concentration or the pH5.0 of water DEG C incubation 15min. 10%FBS DMEM washed cells, cell in 1ml complete mediums 37 DEG C culture 3h.Suck culture medium Use 4% formaldehyde treated afterwards, record in × 100 basis of microscopic observation.As shown in figure 5, the Guenther's frog secretion peptide of synthesis substantially can press down The cell fusion of A/Thailand/Kan353/2004-HA mediations processed.
From shown in table 3 and Fig. 5, Guenther's frog is secreted peptide and there is suppression influenza virus in the cell by suppressing cell fusion Increment, therefore, which can serve as the medicine for treating virus flu.
SEQUENCE LISTING
<110> 1
Nanfang Medical Univ
<120>Guenther's frog secretion peptide and its gene and the application in pharmacy
<160> 6
<170> PatentIn version 3.3
<210> 1
<211> 49
<212> PRT
<213> Hylarana guentheri
<400> 1
Gly Leu Phe Ser Lys Lys Gly Gly Lys Gly Gly Lys Ser Trp Ile Lys
1 5 10 15
Gly Val Phe Lys Gly Ile Lys Gly Ile Gly Lys Glu Val Gly Gly Asp
20 25 30
Val Ile Arg Thr Gly Ile Glu Ile Ala Ala Cys Lys Ile Lys Gly Glu
35 40 45
Cys
<210> 2
<211> 24
<212> DNA
<213>Artificial sequence
<400> 2
atgttcacct tgaagaaacc cctg 24
<210> 3
<211> 27
<212> DNA
<213>Artificial sequence
<400> 3
attctagagg ccgaggcggc cgacatg 27
<210> 4
<211> 359
<212> DNA
<213>Artificial sequence
<400> 4
atgttcacct tgaagaaacc cctgttactg attgtccttc ttgggatcat ctccatatct 60
ctctgtgagc aagagagaca tgctgatgaa gaggaggaaa gcgaaataaa aagaggtctt 120
ttctctaaaa aaggcgggaa aggcggcaaa agttggatta agggtgtctt caaagggatc 180
aagggcatag gcaaggaagt tggtggggat gtgatcagaa ctgggataga aattgcagca 240
tgtaaaatta aaggtgaatg ttaaaacctg aattggaatc atctgatgtt caatatcatt 300
tagctaaatg ctaatgtcta ataaacgaaa agcaatgtca aaaaaaaaaa aaaaaaaaa 359
<210> 5
<211> 24
<212> DNA
<213>Artificial sequence
<400> 5
gagcggataa caatttcaca cagg 24
<210> 6
<211> 24
<212> DNA
<213>Artificial sequence
<400> 6
cgccagggtt ttcccagtca cgac 24

Claims (10)

1. a kind of Guenther's frog secretes peptide, it is characterised in that the Guenther's frog secretes the amino acid sequence such as SEQ ID NO.1 institutes of peptide Show.
2. a kind of Guenther's frog secretes peptide, it is characterised in that the polypeptide that the Guenther's frog secretion peptide is made up of 43 amino acid, its As shown in SEQ ID NO.1, its 37th cysteine and the 43rd cysteine form molecule to amino acid sequence Interior disulfide bond.
3. Guenther's frog secretes the nucleotide sequence of peptide gene, it is characterised in that：CDNA is made up of 359 nucleotides, and which is from 5 ' ends To 3 ' terminal sequences as shown in SEQ ID NO.4.
4. the Guenther's frog described in a kind of coding claim 1 or 2 secretes the nucleotides of peptide.
5. the Guenther's frog secretion peptide described in claim 1 or 2 is preparing the medicine or beauty and skin care of cause pathogeny imcrobe infection disease The application of medicine.
6. the Guenther's frog secretion peptide described in claim 1 or 2 is preparing antibacterium or the use in antimycotic or antiviral drug On the way,
Preferably, the one kind or many of the bacterium in Escherichia coli, staphylococcus aureus, hay bacillus, Pseudomonas aeruginosa Kind；
Preferably, one or more in Candida albicans, aspergillus flavus of the fungi；
Preferably, one or more in H1N1, H5N1 of the influenza virus.
7. the Guenther's frog described in claim 1 or 2 secretes peptide answering in the medicine and food additives for preparing anti-oxidation efficacy With.
8. the Guenther's frog secretion peptide described in claim 1 or 2 is preparing removing free radical medicine or the purposes in cosmetic products.
9. the Guenther's frog secretion peptide described in claim 1 or 2 is in prevention or treatment and gastritis or pancreatitic medicine is prepared Purposes, it is preferable that the gastritis or pancreatitis are the related pancreatitis of the related gastritis of inflammation or inflammation.
10. purposes of the Guenther's frog secretion peptide described in claim 1 or 2 in the medicine for preparing treatment nerve degenerative diseases, excellent Nerve degenerative diseases are selected for treatment Parkinson's.
CN201610982013.2A 2016-11-08 2016-11-08 Rana chensinensis secretory peptide, gene thereof and application thereof in pharmacy Active CN106496317B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201610982013.2A CN106496317B (en) 2016-11-08 2016-11-08 Rana chensinensis secretory peptide, gene thereof and application thereof in pharmacy

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201610982013.2A CN106496317B (en) 2016-11-08 2016-11-08 Rana chensinensis secretory peptide, gene thereof and application thereof in pharmacy

Publications (2)

Publication Number Publication Date
CN106496317A true CN106496317A (en) 2017-03-15
CN106496317B CN106496317B (en) 2019-12-20

Family

ID=58323455

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201610982013.2A Active CN106496317B (en) 2016-11-08 2016-11-08 Rana chensinensis secretory peptide, gene thereof and application thereof in pharmacy

Country Status (1)

Country Link
CN (1) CN106496317B (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112341522A (en) * 2020-10-13 2021-02-09 海南大学 Antibacterial peptide and application thereof

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103724416A (en) * 2014-01-17 2014-04-16 福州大学 hylarana guentheri antibacterial peptide as well as preparation and application thereof
CN105175525A (en) * 2014-04-25 2015-12-23 福州大学 Hylarana guentheri antibacterial peptide and application thereof

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103724416A (en) * 2014-01-17 2014-04-16 福州大学 hylarana guentheri antibacterial peptide as well as preparation and application thereof
CN105175525A (en) * 2014-04-25 2015-12-23 福州大学 Hylarana guentheri antibacterial peptide and application thereof

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
MICHAEL CONLON 等: "Antimicrobial peptides from diverse families isolated from the skin of the Asian frog, Rana grahami", 《PEPTIDES》 *
谢智 等: "沼水蛙皮肤中抗菌肽的分离纯化与活性测定", 《福州大学学报(自然科学版)》 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112341522A (en) * 2020-10-13 2021-02-09 海南大学 Antibacterial peptide and application thereof
CN112341522B (en) * 2020-10-13 2023-06-23 海南大学 Antibacterial peptide and application thereof

Also Published As

Publication number Publication date
CN106496317B (en) 2019-12-20

Similar Documents

Publication Publication Date Title
Tam et al. Membranolytic selectivity of cystine‐stabilized cyclic protegrins
Yang et al. Solution structure and activity of the synthetic four-disulfide bond Mediterranean mussel defensin (MGD-1)
Čeřovský et al. Lucifensin, a novel insect defensin of medicinal maggots: synthesis and structural study
Yu et al. Novel cathelicidins from pigeon highlights evolutionary convergence in avain cathelicidins and functions in modulation of innate immunity
Lundy et al. Antimicrobial activity of truncated α-defensin (human neutrophil peptide (HNP)-1) analogues without disulphide bridges
Vanhoye et al. Membrane association, electrostatic sequestration, and cytotoxicity of Gly-Leu-rich peptide orthologs with differing functions
Sitaram et al. Structure-function relationship studies on the frog skin antimicrobial peptide tigerinin 1: design of analogs with improved activity and their action on clinical bacterial isolates
Zhao et al. Two new cationic α-helical peptides identified from the venom gland of Liocheles australasiae possess antimicrobial activity against methicillin-resistant staphylococci
CN106496317A (en) Guenther&#39;s frog secretion peptide and its gene and the application in pharmacy
CN106399319B (en) It is a kind of pool land frog gene and its coding polypeptide and the polypeptide purposes
CN1803834A (en) Antibacterial peptide of brown-spotted torrential frog, its gene and application in drug preparation
Chen et al. Identification of three novel Phyllomedusa sauvagei dermaseptins (sVI–sVIII) by cloning from a skin secretion-derived cDNA library
CN109438559B (en) Polypeptide for resisting multiple drug-resistant acinetobacter baumannii
CN106432483B (en) Rana chensinensis skin serine protease inhibitory peptide, gene and pharmaceutical application thereof
CN106478811B (en) Giant knotweed frog protease inhibitory peptide, gene thereof and application thereof in pharmacy
CN100581584C (en) Serine protease inhibitor of Rana grahami, and its application
JP2001186887A (en) Antimicrobial peptide originating from pandinus imperator
CN107513100A (en) Mercuric chloride antibacterial peptide and its gene and application
CN115043925A (en) Modified antibacterial peptide oNCM and application thereof
CN106399320B (en) A kind of purposes of the gene of kaloula pulchra and its polypeptide of coding and the polypeptide
Zheng et al. Prediction and characterization of a novel hemoglobin-derived mutant peptide (mTgHbP7) from Tegillarca granosa
CN106432459A (en) Microhyla pulchra antibacterial peptide, and gene thereof and application thereof in pharmacy
CN108676071B (en) anti-Abeta protein aggregation heptapeptide, application thereof and gene for encoding synthetic polypeptide
Jackway et al. Disulfide-containing peptides from the glandular skin secretions of froglets of the genus Crinia: Structure, activity and evolutionary trends
CN1840544A (en) ESC42 protein, preparation method and use thereof

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant