CN106496317B

CN106496317B - Rana chensinensis secretory peptide, gene thereof and application thereof in pharmacy

Info

Publication number: CN106496317B
Application number: CN201610982013.2A
Authority: CN
Inventors: 徐学清; 曾白霜; 柴金为
Original assignee: Southern Medical University
Current assignee: Southern Medical University
Priority date: 2016-11-08
Filing date: 2016-11-08
Publication date: 2019-12-20
Anticipated expiration: 2036-11-08
Also published as: CN106496317A

Abstract

The invention relates to a rana chensinensis secretory peptide, a gene thereof and application thereof in pharmacy, wherein the rana chensinensis secretory peptide is a cyclic polypeptide consisting of 49 amino acids, the amino acid sequence of the cyclic polypeptide is shown as SEQ ID NO.1, and the forty-third cysteine and the forty-ninth cysteine form an intra-molecular disulfide bond. The gene sequence of the rana chensinensis secretory peptide consists of SEQ ID NO.4, wherein the mature rana chensinensis secretory peptide with the coding function is the 115-th 261-bit nucleotide. The mature functional polypeptide amino acid sequence of the rana chensinensis secretory peptide is deduced from the gene of the rana chensinensis secretory peptide, and the synthesized rana chensinensis secretory peptide has strong antibacterial, anti-influenza virus and antioxidant functions. The rana chensinensis secretory peptide has the characteristics of simple structure and convenient artificial synthesis, and can be applied to preparation of therapeutic drugs, beauty skin care drugs and food additives caused by pathogenic microorganism infectious diseases and free radical oxidation.

Description

Rana chensinensis secretory peptide, gene thereof and application thereof in pharmacy

The technical field is as follows:

the invention relates to the field of biomedicine, in particular to a protein obtained from animal tissues and application thereof in biological pharmacy.

Background art:

the discovery of penicillin enables people to deal with related diseases caused by infection of various pathogenic microorganisms, and various antibiotics derived from penicillin make a great contribution to protecting human health. However, many bacteria develop resistance to these "traditional antibiotics" due to their long-term use and abuse. The emergence of multiply-resistant superbacteria has made the development of new antimicrobial drugs particularly urgent. The antibiotic peptide is one kind of active polypeptide with molecular weight less than 1 ten thousand and 10-50 amino acids and capable of killing or inhibiting the growth of microbe. Recent studies have shown that: the antibacterial peptide not only has broad-spectrum antimicrobial activity, but also has incomparable superiority compared with traditional antibiotics: for example, in addition to killing microorganisms directly and inducing resistance in strains poorly, antimicrobial peptides can also modulate host immune function, inhibit inflammatory responses, and indirectly play a role in the treatment of infectious diseases (Nat Rev Microbiol,2012,10(4): 243-. In addition, in severe bacterial infection, the antibacterial peptide can also neutralize endotoxin, relieve sepsis, and rapidly stop or limit infection spread while rapidly killing pathogenic microorganisms (antibacterial Agents Chemothers, 2014,58(9): 5363-5371). Therefore, antibacterial peptides hold promise as a new generation of antimicrobial drugs.

Currently, there is increasing emphasis on the development of polypeptide antimicrobial drugs (Future Med Chem,2013,5 (3); 315-. According to the domestic and foreign literature, at least 20 active polypeptide drug candidates isolated from different organisms have been reported to enter the clinical trial (Future Med Chem,2013,5(3): 315-. For example, Neuprex, an orphan drug developed by Xoma for the treatment of meningococcemia, and Omiganan topical cream developed by Cutanea life science for the treatment of rosacea both entered three-phase clinical studies (Curt Protein Pept Sci,2012,13(7): 611-619); in addition, the drug PMX-30063 developed by Ellceutix for the treatment of MRSA-induced skin infections has entered the development of preclinical studies (Expert Rev Anti infection Ther,2014,12(12): 1477-.

Many amphibians are widely used as traditional Chinese medicines and national medicines in China. Such as Bufo gargarizans, Bombina maxima, Rana nigromaculata (Pelophytax nigromala), and Rana nigromaculata (Euphlyctis limnocharis). The skin and internal organs of the amphibians have wide pharmacological activity and clinical efficacy. Pharmacological activities have been reported to be: antimicrobial, antitumor, analgesic, local anesthetic, immunomodulating, cardiovascular effects, etc. (Dongwuxue Yanjiu,2015,36(4): 183-; 222; Chem Rev.2015,115(4): 1760-; 1846). The search for specific pharmacological activity monomer compounds of amphibious skin is a hot spot of new drug invention abroad. The active polypeptide Magainin, as obtained from xenopus laevis (xenopus laevis) skin secretions, has broad-spectrum antimicrobial action and simultaneously antitumor activity, has been approved in the united states as a broad-spectrum antibacterial drug, and its genetically engineered product has been used as an antibacterial drug by microbiologic lbiotech corporation for the treatment of foot ulcers in diabetic patients (Curr Protein Pept Sci,2012,13(8): 723-738.).

China has a long history of application of amphibian drugs, but researches on active ingredients and pharmacological properties of the amphibian drugs mainly focus on organic small molecules such as alkaloid and the like, and few researches on skin active peptide substances are carried out. The rana chensinensis (Hylaranaguentheri) is mainly distributed in provinces, Taiwan, Hainan island and hong Kong in the middle and south of China and is one of the characteristic resource animals in China.

The inventor searches and compares the full-sequence amino acid structure of the rana chensinensis secretory peptide by a protein database, and does not find any identical polypeptide. The inventor searches and compares the gene coding the peptide secreted by the rana chensinensis with a gene database, and does not find any same gene.

The invention content is as follows:

the invention aims to provide a novel rana chensinensis secretory peptide with broad-spectrum antimicrobial (including gram negative and positive bacteria, fungi and viruses) and a gene thereof based on the technical background, and application thereof in preparing medicaments for treating pathogenic microorganism infectious diseases and beautifying skin care medicaments.

In order to solve the technical problems, the invention adopts the technical scheme that:

the rana chensinensis secretory peptide is a cyclic peptide consisting of 49 amino acids, has the molecular weight of 5005.97 daltons, the isoelectric point of 9.481, and the amino acid sequence is as follows: gly Leu Phe Ser Lys Lys Gly Gly LysGly Gly Lys Ser Trp Ile Lys Gly Val Phe Lys Gly Ile Lys Gly Ile Gly Lys GluVal Gly Gly Asp Val Ile Arg Thr Gly Ile Glu Ile Ala Ala Cys Lys Ile Lys GlyGlu Cys (GLFSKKGGKGGKSWIKGVFKGIKGIGKEVGGDVIRTGIEIAACKIKGEC) (SEQ ID NO: 1), and the forty-third cysteine and the forty-ninth cysteine of the polypeptide.

The encoding gene of the rana chensinensis secretory peptide consists of 359 nucleotides, and the sequence from the 5 'end to the 3' end is (SEQ ID NO.4):

the 115-th 261 th nucleotide in the sequence codes a mature rana japonica secretory peptide (SEQ ID NO.1) with functions.

The rana chensinensis secretory peptide can be applied to preparation of medicaments for treating pathogenic microorganism infectious diseases and skin care medicaments.

The invention has the beneficial effects that:

the amino acid structure of the encoded gene of the rana chensinensis secretory peptide is deduced, and the synthesized rana chensinensis secretory peptide has obvious functions of inhibiting the growth of bacteria, fungi and viruses and resisting oxidation. The rana chensinensis secretory peptide has the beneficial characteristics of simple structure, convenient artificial synthesis and wide antibacterial spectrum.

Description of the drawings:

FIG. 1 shows the HPLC purification identification result of the peptide secreted from Rana temporaria chensinensis David;

FIG. 2 shows the mass spectrometric identification results of the secretory peptide of Rana temporaria chensinensis of the present invention;

FIG. 3 is a relation curve of the amount-effect of peptide secreted from Rana dybowskii for eliminating DPPH free radical;

FIG. 4 is a relation curve of the quantity-effect of the peptide secreted from Rana dybowskii in the invention for eliminating ABTS free radicals;

FIG. 5 shows the effect of the peptide secreted from Rana temporaria chensinensis on the inhibition of influenza virus-mediated intercellular fusion. The concentration of rana chensinensis secretory peptide in FIG. A, B and C were 10. mu.M, 1. mu.M and 0. mu.M, respectively, and in FIG. D, no virus no sample control.

The specific implementation mode is as follows:

the invention is described in further detail below with reference to the following figures and detailed description:

the rana chensinensis secretory peptide disclosed by the invention is a cyclic peptide consisting of 49 amino acids, has the molecular weight of 5005.97 daltons, the isoelectric point of 9.481, and the amino acid sequence is as follows: gly Leu Phe Ser Lys Lys Gly Gly LysGly Gly Lys Ser Trp Ile Lys Gly Val Phe Lys Gly Ile Lys Gly Ile Gly Lys GluVal Gly Gly Asp Val Ile Arg Thr Gly Ile Glu Ile Ala Ala Cys Lys Ile Lys GlyGlu Cys (SEQ ID NO: 1), and the forty-third cysteine and the forty-ninth cysteine of the polypeptides.

The gene sequence of the rana chensinensis secretory peptide is coded by the 115 th and 261 th nucleotides of SEQ ID NO. 4. The preparation process of the secretion peptide and the gene of the rana chensinensis comprises the following steps:

example 1 swamp frog secretory peptide gene cloning:

I. extracting total RNA of the skin of the rana chensinensis: cleaning living Rana temporaria chensinensis David with water, placing into liquid nitrogen, quickly freezing for 4 hr, collecting skin tissue, weighing, collecting 300mg skin tissue, adding 10m1 total RNA extraction buffer (Trizol solution, product of GIBCOBRL company, USA), and homogenizing in 20m1 glass homogenizer for 30 min. Adding equal volume of phenol/chloroform solution, mixing vigorously, standing at room temperature for 10min, centrifuging at 4 deg.C and 12000rpm for 10min, and removing precipitate. Adding isopropanol with the same volume into the supernatant, standing at room temperature for 10min, centrifuging at 12000rpm for 10min at 4 deg.C, washing the precipitate with 75% ethanol once, and air drying to obtain the final product.

II. Purification of Rana temporaria skin mRNA: the mRNA of skin of Rana temporaria chensinensis David is separated and purified by PROMEGAmRNA Isolation Systems kit. The method comprises the following specific steps: dissolving Rana temporaria chensinensis David skin total RNA 500 μ g in DEPC water 500 μ l, placing in 65 deg.C water bath for 10min, adding Oligo (dT) 3 μ l and 20 XSSC 13 μ l, mixing, standing at room temperature, and coolingHowever, it is called solution A. Mixing the magnetic beads, adsorbing with magnetic frame for 30S, discarding supernatant, adding 0.5 XSSC 0.3m1, adsorbing with magnetic frame for 30S, and adding 0.1ml 0.5 XSSC to suspend, and named as solution B. Adding the solution A into the solution B, standing at room temperature for 10min until the solution A is adsorbed by a magnetic rack for 30sec, discarding the supernatant, washing with 0.1 XSSC for 4 times, finally discarding the supernatant, adding 0.L of DEPC water for suspension, adsorbing on the magnetic rack for 30sec, transferring the supernatant to a new test tube, adding 0.15m1DEPC water for resuspension until the magnetic rack is adsorbed by the magnetic rack for 30S, and transferring the supernatant to the test tube, wherein the supernatant is purified skin mRNA of Rana temporaria chensinensis. 1/10 volumes of 3M sodium acetate, pH5.2, and an equal volume of isopropanol were added, the mixture was left at-70 ℃ for 30 minutes, centrifuged at 12000rpm for 10 minutes at 4 ℃, the supernatant was discarded, and the precipitate was dissolved in 10. mu.l of DEPC water to obtain Rana temporaria skin mRNA.

III, constructing a skin cDNA library of the rana japonica: a Kit was constructed using the plasmid cDNA Library of the CreatorTM SMART TM cDNA Library of CLONTECH.

First strand cDNA Synthesis (reverse transcription of mRNA): mu.l of Rana temporaria skin mRNA, 1. mu.l of SMART IV oligonucleotide, 1. mu.l of CDS III/3' PCR primer, and 2. mu.l of deionized water were added to a 0.5ml sterile centrifuge tube to make the total volume 5. mu.l. Mix the reagents in the centrifuge tubes and centrifuge at 12000rpm for 15sec, and incubate at 72 ℃ for 2 min. Centrifuge tubes were incubated on ice for 2 min. The following reagents 2.0. mu.l of 5 Xprimary strand buffer, 1.0. mu.l of 20mM dithiothreitol, 1.0. mu.l of 10mM dNTP mix, and 1.0. mu.l of PowerScript reverse transcriptase were added to the centrifuge tube. Mix the reagents in the centrifuge tubes and centrifuge at 12000rpm for 15sec, incubate at 42 ℃ for 1 h. The first strand synthesis was stopped by placing the centrifuge tube on ice. Mu.l of the first strand of the synthesized cDNA was taken from the centrifuge tube and used.

B. Amplifying the second strand by using a long-terminal polymerase chain reaction (LD-PCR) method: the PCR instrument was preheated to 95 ℃. Mu.l of first strand cDNA (reverse transcription of mRNA), 80. mu.l of deionized water, 10. mu.l of 10 × Advantage 2PCR buffer, 2. mu.l of 50 × dNTP mix, 2. mu.l of 5 'PCR primer, 2. mu.l of CDS III/3' PCR primer, and 2. mu.l of E.coli polymerase centrifuge tube were reacted. Amplification was performed in a PCR instrument according to the following procedure: 20sec at 95 ℃, 5sec at 95 ℃, 6min at 68 ℃ and 22 cycles. After the circulation was completed, the double strand cDNA synthesized in the centrifuge tube was extracted.

PCR products from PROMEGAThe SV Gel and PCR Clean-Up System kit is extracted and recovered, and the steps are as follows: adding cDNA double chains obtained by PCR into equal-volume membrane binding buffer, reversing and uniformly mixing, transferring the mixed solution into a centrifugal purification column, and standing at room temperature for 5 minutes to ensure that the DNA is fully bound with a silica gel membrane. The collection tube was centrifuged at 12000rpm for 30sec to discard the waste liquid. Add 700. mu.l of eluent (containing ethanol) to the centrifugation and purification column, centrifuge at 12000rpm for 30sec, and discard the waste liquid from the collection tube. And repeating the steps. Centrifuge at 12000rpm for 5min. The centrifugal purification column was placed in a new centrifuge tube. 30. mu.l of ultrapure water was added thereto, and the mixture was allowed to stand at room temperature for 5min. Centrifuging at 12000rpm for 30sec, and obtaining the purified cDNA double strand in the bottom of the tube.

D. Enzyme cutting, connection and transformation of connection products: mu.l of Takara pMD18-T vector and 4. mu.l of Rana dybowskii cDNA double-strand solution were added to a microcentrifuge tube, and the total amount was 5. mu.l. Add 5. mu.l of ligase buffer mix. Reacting at 16 ℃ for 2 h. The total amount (10. mu.l) was added to 100. mu.l of DH 5. alpha. competent cells and kept on ice for 30 min. After heating at 42 ℃ for 90Sec, the mixture was left on ice for 1 minute. The mixture was added with 890. mu.l of LB medium incubated at 37 ℃ and cultured with slow shaking at 37 ℃ for 60 min. 200 μ l of the suspension was spread on LB medium containing X-Gal, IPTG and Amp and cultured at 37 ℃ for 16 hours to form a single colony. Colonies were washed with 5m1LB liquid medium per LB plate and frozen with 30% glycerol. The constructed cDNA contained approximately 1X10⁶Individual clones.

IV, cloning and screening the peptide gene secreted by the rana chensinensis: the amplification primer is 24 nucleotides in length and has a sequence of 5 'ATGTTCACCTTGAAGAAACC CCTG 3' (SEQ ID NO.2), and another amplification primer in PCR is SMART (CLONTECH Co., Ltd.)^TM3 ' PCR Primer in cDNA Library Construction Kit, the sequence is 5 ' ATTCTAGAGGCCGAGGCGGCCGACATG 3 ' (SEQ ID NO. 3). The PCR reaction was performed under the following conditions: 30sec at 94 ℃, 45sec at 50 ℃ and 2.5min at 72 ℃ for 35 cycles.

The constructed bacterial cDNA library was first titrated, then diluted to the appropriate bacterial concentration with LB medium containing 100. mu.g/ml ampicillin (approximately 5000 bacteria/ml and 30 bacteria/ml for the first round of selection and the second round of selection, respectively), plated in an 8X 8 matrix (64 wells in total, 100. mu.1 per well) on 96-well plates, and incubated overnight at 37 ℃. And respectively combining the bacterial culture solutions according to rows and columns, carrying out PCR identification on 16 samples, and carrying out second round screening on the bacteria samples with the crossed positive holes.

V, determining the gene sequence of the peptide secreted by the rana chensinensis and obtaining the result: plasmid DNA extraction nucleotide sequences were determined by dideoxy using an apparatus, US Applied Biosystems 373A full-automatic nucleotide sequencer, Sequencing primers were BcaBESTTM Sequencing Primer RV-M and BcaBESTTM Sequencing Primer M13-47, BcaBESTTM Sequencing Primer RV-M sequences: 5 'GAGCGGATAACAATTTCACACAGG 3' (SEQ ID NO.5), BcaBESTTM Sequencing Primer M13-47: 5 'CGCCAGGGTTTTCCCAGTCACGAC 3' (SEQ ID NO. 6). The sequence from 5 'end to 3' end of the gene sequencing result is (SEQ ID NO.4):

the sequence table of the peptide gene nucleotide secreted by the rana chensinensis is as follows: the sequence length is 359 bases; sequence types: a nucleic acid; number of chains: single-stranded; topology: straight-chain; the sequence types are as follows: cDNA; the source is as follows: skin of Rana temporaria chensinensis David.

Deducing that the mature active secretion peptide coded by the function is the 115 th-261 th nucleotide according to the gene of the secretion peptide of the rana chensinensis, and the amino acid sequence is as follows: GLFSKKGGKGGKSWIKGVFKGIKGIGKEVGGDVIRTGIEIAACKIKGEC (see sequence SEQID NO.1)

Example 2, preparation of a rana chensinensis secretory peptide:

i, a preparation method of the rana chensinensis secretory peptide comprises the following steps: the amino acid sequence of the mature active secretory peptide with the function is deduced according to the gene of the secretory peptide of the rana chensinensis, and then the polypeptide is synthesized by an automatic polypeptide synthesizer. The formation of disulfide bonds was carried out by air oxidation, specifically by dissolving the polypeptide in 0.1mg/ml in 0.1% acetic acid solution in a flask, titrating to pH 7.8 with ammonium hydroxide, and stirring overnight at room temperature. Desalting by HPLC reverse phase C18 column chromatography, and purifying. In the purification ALiquid 0.05% TFA + 2% CH₃CN, B solution is 0.05% TFA + 90% CH₃CN, the concentration of the polypeptide in the solution B is 32-47% in 15 minutes, and the detection wavelength is 220 nm.

II, measuring the molecular weight by adopting a Fast atom bombardment mass spectrometry (FAB-MS), taking glycerol, m-nitrobenzyl alcohol, dimethyl sulfoxide (1:1: l, V: V: V, volume ratio) as a substrate, taking Cs + as a bombardment particle, and taking the current as 1 muA and the emission voltage as 25 Kv.

III, identifying the purity of the purified rana chensinensis secretory peptide by using a High Performance Liquid Chromatography (HPLC) method, measuring isoelectric points by isoelectric focusing electrophoresis, and measuring an amino acid sequence structure by using an automatic amino acid sequencer.

The rana chensinensis secretory peptide is a cyclic polypeptide encoded by a rana chensinensis secretory peptide gene, 5005.97 daltons, an isoelectric point 9.481, and a polypeptide complete sequence primary structure is as follows: GLFSKKGGKGGKSWIKGVFKGIKGIGKEVGGDVIRTGIEIAACKIKGEC whose forty-third cysteine and forty-ninth cysteine form an intramolecular disulfide bond.

Example 3 Activity test of peptide secreted from Rana temporaria

I, determination of the ability to inhibit bacterial growth

The antibacterial activity is detected by adopting a cup-dish method, and the culture medium is a common agar culture medium. Respectively injecting a heated and melted culture medium of 20m1 into a flat dish to serve as a bottom layer, uniformly spreading the culture medium in the dish bottom, solidifying, heating and melting another proper amount of the culture medium, respectively adding 5m1 bacterial suspension into each dish, and uniformly shaking to uniformly spread the culture medium on the bottom layer to serve as a bacterial layer. After cooling, 6 sterilized stainless steel cups were placed in a dish at equal distances. Adding 0.1-0.3mg/ml compound solution to be detected into the first steel cup, adding sample solution into the other steel cups by a two-fold dilution method, culturing at 37 ℃, and observing the size of the inhibition zone. The Minimum Inhibitory Concentration (MIC) is a zone of inhibition l0mm or more. The bacterial strain is from the first subsidiary hospital of Kunming medical college, the test is repeated for four times, and the average value is taken, and the result is shown in table 1, and the synthesized rana chensinensis secreted peptide can obviously inhibit the bacterial growth.

TABLE 1 Rana temporaria secretory peptide inhibits bacterial growth activity

II, determination of ability to inhibit fungal growth

The antifungal activity was measured by a cup and dish method using a modified Sabouraud (Sabouland) medium. Respectively injecting 20ml of heating and melting culture medium into a flat dish to serve as a bottom layer, uniformly spreading the culture medium on the bottom of the dish, heating and melting another proper amount of culture medium after solidification, respectively adding 5ml of bacterial suspension into each dish, and uniformly shaking to uniformly spread the culture medium on the bottom layer to serve as a bacterial layer. After cooling, 5 sterilized stainless steel cups were placed in the dish at a medium distance. Adding 0.1ml of the compound solution to be detected with the concentration of 0.3mg/ml into the first steel cup, adding the sample solution into the other steel cups by a two-fold dilution method, culturing at 37 ℃, and measuring the size of the inhibition zone after 24-48 h. The Minimum Inhibitory Concentration (MIC) is a zone of 10mm or more. The bacterial strain is from the institute of microbiology of Yunnan university, three experiments are performed in parallel, geometric mean values are taken, and the results are shown in table 2, and the synthesized peptide secreted by the rana chensinensis can obviously inhibit the growth of fungi.

TABLE 2 Rana temporaria secretory peptide inhibits fungal growth activity

III, determination of antioxidant Capacity

1) Determination of DPPH radical scavenging Capacity

Antioxidant polypeptides were studied using DPPH (1, 1-diphenylyl-2-picryl-hydrzyl) free radical scavenging assay. Preparing a DPPH ethanol solution with the concentration of 1 multiplied by 10 < -5 > mol/L, and storing the solution in a dark place. 2ml of 0.1mM solution of DPPH in absolute ethanol are added to a clean tube containing 2ml of the different enzymatic samples and mixed well. After standing at room temperature for 30min, absorbance is measured at 517nm, and the smaller the absorbance value is, the stronger the radical scavenging ability is.

Clearance (%) ═ 1- (a)_i-A_j)/A₀】*100％

In the formula, A₀2ml,0.1mM DPPH in absolute ethanol +2ml of sample reagent, blank, A_i2ml,0.1mM DPPH in absolute ethanol +2ml of sample, A_j2ml of absolute ethanol +2ml of sample.

2) Determination of ABTS free radical scavenging Activity

Dissolving ABTS with deionized water to make ABTS concentration reach 7mmol/L, adding potassium persulfate to make potassium persulfate concentration be 2.45 nmol/L. The solution was then left overnight at room temperature for 12-16 h in the dark. The resultant ABTS radical solution was diluted with phosphate buffer (PBS, 0.2mol/L, pH 7.4) to give an absorbance of 0.70 at 734 nm. 0.1ml of the enzymatic hydrolysate was mixed with 2.9ml of ABTS free radical solution, shaken for 30 seconds, reacted in the dark for 10 minutes, and then the absorbance of the reaction solution was measured at 734 nm. Distilled water is used as a blank to replace hydrolysate.

The clarity (%) ═ a_i-A_j)/A₀*100％

In the formula, A₀The absorbance of a mixture of 2.9ml of ABTS reagent and 0.1ml of distilled water, A_jThe absorbance was 2.9ml ABTS +0.1ml enzymolysis solution mixture.

As shown in fig. 3 and 4, the peptide secreted from rana chensinensis can significantly scavenge DPPH and ABTS free radicals. Free radical oxidation plays an important role in neurodegenerative diseases caused by senile dementia, Parkinson's disease, diabetes, rheumatoid arthritis and amyotrophic lateral sclerosis. The peptide secreted by the rana chensinensis can well eliminate free radicals, so that the rana chensinensis peptide can be applied to treatment of related diseases caused by free radical oxidation. In addition, in order to prevent damage to the skin caused by free radicals, it is essential to add a free radical scavenger to a cosmetic skin care product. Therefore, the rana rugulosa protease inhibiting peptide can also be applied to beauty skin care products.

IV, determination of inhibitory Capacity of influenza Virus proliferation

1) Determination of entry inhibition Capacity for five different H5N1 pseudoviruses

Preparation and drug treatment of H5N1 pseudovirus: the cells were cultured in DMEM medium containing 10% calf serum, 1% glutamine, 2% penicillin/streptomycin. 293T cells in logarithmic growth phase at 3X10⁵The cells were seeded at a density of 2 ml/well in 6-well cell culture plates at 37 ℃ with 5% CO₂The culture was carried out overnight. When the cell density reaches about 80%, the procedures of the PEI transfection reagent instruction are followed. Mu.l PEI transfection reagent and 200. mu.l DMEM medium without serum and double antibody were added to a sterile vial and mixed well and left to stand at room temperature for 5min. Mu.g of pNL4-3.luc. R-E-, 1. mu.g of HA and 1. mu.g of NA plasmid were added to the PEI-DMEM mixture, mixed well and left to stand at room temperature for 30min to form a transfection complex. The transfection complex was added to the cells and the six well plate was gently rotated to distribute it evenly. 5% CO₂Culturing at 37 deg.C for 10h, replacing culture solution with DMEM culture solution containing 10% calf serum, culturing for 48h, centrifuging at 2000rpm for 5min, collecting cell culture, diluting the supernatant containing pseudovirus in 96-well plate to 1ng/p24 concentration per well, and incubating with 2 times of Rana temporaria secretory peptide and positive control drug CL385319 at 37 deg.C for 30 min.

Detection of inhibition of pseudovirus entry: 1X10⁴One/well of MDCK cells was seeded in a 96-well cell culture plate and cultured for 24 h. The incubated pseudovirus mixtures are added into 96-well plates containing MDCK cells respectively and cultured for 48h at 37 ℃. Sucking culture supernatant, washing cells twice with PBS, adding 50 mul of lysate into each well, shaking for 20min, sucking 40 mul of lysate into a white board after the cells are lysed, adding luciferase chromogenic substrate (Promega, Madison, Wis., US), detecting chemiluminescence value on a multifunctional enzyme labeling instrument (Genios Pro, Tecan, US), and judging the activity of the drug in inhibiting virus entry. Compound inhibition (%) - (1- (E-N)/(P-N)]X 100, where E represents the chemiluminescence value of the experimental group, P represents the chemiluminescence value of a positive, i.e., virus-only, drug-free, control group, and N represents the chemiluminescence value of the negative control group. Median Inhibitory Concentration (IC) of Compounds₅₀) The antiviral activity index of the compound is calculated by Calccusyn software. As shown in Table 3, the peptide secreted by Rana dybowskii has good inhibitory activity on various H5N1 pseudoviruses。

TABLE 3 inhibitory Activity of Rana temporaria secretory peptide against H5N1 avian influenza pseudovirus infection

2) Determination of A/Thailand/Kan353/2004-HA Virus-mediated cell fusion inhibition capability

LinXA cells at 4X 10⁵Perwell was inoculated into 12-well plates. After 16h, the A/Thailand/Kan353/2004-HA plasmid 0.8ug DNA/well was transfected with Lipofectamine LTX (Life Technologies) as per the instructions. After 24h the transfection medium was replaced with DMEM containing 10% FBS. After 24h, the cells were washed with serum-free DMEM and trypsinized, washed with 10% FBS-DMEM to remove pancreatin, and incubated with 0.5ml of Rana temporaria chensinensis secretory peptide diluted with 0.2% FBS-DMEM and DMSO37 deg.C for 15min. After washing twice with the wash-off, the cells were incubated for 15min at 37 ℃ in 0.5ml of DMEM solution pH5.0 containing the corresponding concentration or water, the cells were washed with 10% FBS-DMEM and cultured for 3h at 37 ℃ in 1ml of complete medium. After aspiration of the medium, the medium was treated with 4% formaldehyde and the recording was observed under a x 100 microscope. As shown in FIG. 5, the synthesized peptide secreted by Rana chensinensis can obviously inhibit A/Thailand/Kan353/2004-HA mediated cell fusion.

As shown in table 3 and fig. 5, the rana chensinensis secretory peptide has the effect of inhibiting proliferation of influenza virus in cells by inhibiting cell fusion, and thus, it can be used as a drug for treating viral influenza.

SEQUENCE LISTING

<110> 1

Southern medical university

<120> secretion peptide of rana chensinensis, gene thereof and application thereof in pharmacy

<160> 6

<170> PatentIn version 3.3

<210> 1

<211> 49

<212> PRT

<213> Hylarana guentheri

<400> 1

Gly Leu Phe Ser Lys Lys Gly Gly Lys Gly Gly Lys Ser Trp Ile Lys

1 5 10 15

Gly Val Phe Lys Gly Ile Lys Gly Ile Gly Lys Glu Val Gly Gly Asp

20 25 30

Val Ile Arg Thr Gly Ile Glu Ile Ala Ala Cys Lys Ile Lys Gly Glu

35 40 45

Cys

<210> 2

<211> 24

<212> DNA

<213> Artificial sequence

<400> 2

atgttcacct tgaagaaacc cctg 24

<210> 3

<211> 27

<212> DNA

<213> Artificial sequence

<400> 3

attctagagg ccgaggcggc cgacatg 27

<210> 4

<211> 359

<212> DNA

<213> Artificial sequence

<400> 4

atgttcacct tgaagaaacc cctgttactg attgtccttc ttgggatcat ctccatatct 60

ctctgtgagc aagagagaca tgctgatgaa gaggaggaaa gcgaaataaa aagaggtctt 120

ttctctaaaa aaggcgggaa aggcggcaaa agttggatta agggtgtctt caaagggatc 180

aagggcatag gcaaggaagt tggtggggat gtgatcagaa ctgggataga aattgcagca 240

tgtaaaatta aaggtgaatg ttaaaacctg aattggaatc atctgatgtt caatatcatt 300

tagctaaatg ctaatgtcta ataaacgaaa agcaatgtca aaaaaaaaaa aaaaaaaaa 359

<210> 5

<211> 24

<212> DNA

<213> Artificial sequence

<400> 5

gagcggataa caatttcaca cagg 24

<210> 6

<211> 24

<212> DNA

<213> Artificial sequence

<400> 6

cgccagggtt ttcccagtca cgac 24

Claims

1. The rana chensinensis secretory peptide is a polypeptide consisting of 49 amino acids, the amino acid sequence of the rana chensinensis secretory peptide is shown as SEQ ID NO.1, and the forty-third cysteine and the forty-ninth cysteine form an intramolecular disulfide bond.

2. A nucleotide encoding the rana chensinensis secretory peptide of claim 1.

3. The use of the rana chensinensis secretory peptide of claim 1 for the preparation of an antibacterial, antifungal or antiviral medicament,

the bacteria are selected from one or more of escherichia coli, staphylococcus aureus and bacillus subtilis;

the fungus is selected from one or more of candida albicans and aspergillus flavus;

the virus is selected from influenza virus H5N 1.

4. The use of the rana chensinensis secretory peptide of claim 1 for the preparation of a medicament and a food additive having antioxidant effects.

5. Use of the rana chensinensis secretory peptide of claim 1 in the preparation of a free radical scavenging medicament or a cosmetic product.