CN1912138A - Oligonucleotide adapter of identification of protein squence applied in protein tissue research - Google Patents
Oligonucleotide adapter of identification of protein squence applied in protein tissue research Download PDFInfo
- Publication number
- CN1912138A CN1912138A CN 200610025342 CN200610025342A CN1912138A CN 1912138 A CN1912138 A CN 1912138A CN 200610025342 CN200610025342 CN 200610025342 CN 200610025342 A CN200610025342 A CN 200610025342A CN 1912138 A CN1912138 A CN 1912138A
- Authority
- CN
- China
- Prior art keywords
- oligonucleotide
- protein
- adaptive son
- sequence
- adaptive
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to chip ligand and correlation technique used to identify protein sequence. It sifts and composes oligonucleotide proper gamete which can identify special tripeptide KAI, GEL, DGI, LAS as the protein chip ligand. The method used to identify protein sequence for the oligonucleotide proper gamete includes the following steps: using Structure-switch oligonucleotide proper gamete technique to approve that the oligonucleotide proper gamete can interact with the tripeptide sequence protein; biotin marking for the complex; fixing it on streptavidin labeled bead carrier; sampling, eluting, detecting for the protein; the composing of the four sequences can combine the protein contains the given four sequences. Thus the protein can be caught.
Description
Technical field
The present invention relates to the investigative technique of proteomics, the adaptive son of oligonucleotide (Nucleic Acid Aptamer) that is specifically related to the identification of protein sequence is used for protein purification and protein chip part and correlation technique.
Background technology
The protein chip technology of broad research and exploitation is based on antigen and the interactional principle of antibody mostly at present, therefore utilizes the research of antibody making protein chip the most deep.At first, then the associated protein in the sample is detected orderly being fixed on filter membrane or other carrier of antibody.In order to achieve this end, antibody is fixed on the suitable carriers by suitable method, to keep its native conformation and biological activity simultaneously.Recently, other material except that antibody also is studied the part that is developed as protein chip, and for example to micromolecular compound, technology such as adaptive son of oligonucleotide and polypeptide microarray have all been made good try and exploration.Because the adaptive son of oligonucleotide has the specificity of the conjugated protein close with antibody, and the adaptive son of oligonucleotide can be fixed in carrier easily and keep stability of structure, therefore its research and development had remarkable progress.Yet it is very difficult seeking the adaptive son of its specific oligonucleotide at each protein, needs a large amount of input and heavy work, can not adapt to the needs of current proteomics research fast development.Therefore, research is very urgent for protein science for research and development novel protein chip part and correlation technique.
Summary of the invention
The problem that the present invention is directed to above-mentioned existence filter out can the specific binding polypeptide sequence the adaptive son of oligonucleotide, these adaptive sons can carry out proteinic identification and catch at sequence of amino acid, thereby be applied to protein purification, protein chip and other proteomics research, to solve the adaptive son of a kind of oligonucleotide only at a kind of proteinic problem.
The technical scheme that realizes the object of the invention is as follows: target is in the adaptive son of the oligonucleotide of small peptide or other molecule, corresponding sequence in can identification of protein, the various combination of the adaptive son of a plurality of oligonucleotides can be used for discerning, enrichment and catch the protein that contains corresponding aminoacid sequence.
The method of protein that identification contains corresponding sequence is: I, the adaptive son of synthetic oligonucleotide is carried out proper extension and the synthetic short chain Nucleotide that contains fluorescein base group and corresponding quenching group respectively, II, in reaction system, add above-mentioned various Nucleotide, damping fluid and protein III, detect.
The method of catching associated protein is: I, the adaptive son of synthetic oligonucleotide is carried out biotin labeling, II, the adaptive son of biotin labeled oligonucleotide is fixed on the magnetic bead carrier of marked by streptavidin, III, carry out sample on the protein example, IV, wash-out can not be in conjunction with the protein of the adaptive son of oligonucleotide, V, at last bonded protein detected.
Target is in tripeptides KAI, GEL, and the nucleotides sequence of the adaptive son of oligonucleotide of DGI and LAS is classified as:
The adaptive son of GEL-oligonucleotide:
gcgaagcggg?ctgaagtgca?cacagctgga?ggagtattgt?tgggtgctc
The adaptive son of KAI-oligonucleotide:
gcgcagcggg?tggagtgtta?agatgaattg?cggtgtgggc?cggcctctat?tggc
The adaptive son of LAS-oligonucleotide:
acgaagtggg?tgtatagcga?ataatcatta?agaaagggcg?ctgtgttgtg
The adaptive son of DGI-oligonucleotide:
agcctaaaat?attgcttagta?agggtggtct?ggctccgaga?ggggt
The corresponding tripeptide sequence of the adaptive son of oligonucleotide in can recognition protein, and can from the thick lysate of recombination bacillus coli, catch CathepsinD (CatD) albumen that contains corresponding tripeptide sequence with purifying.
Be described in further detail the present invention below in conjunction with accompanying drawing.
Description of drawings
The adaptive son of the different number oligonucleotides of Fig. 1 is caught the recombinant C atD albumen result that part is purified
The adaptive son of the different number oligonucleotides of Fig. 2 is caught the recombinant C atD albumen result who does not purify
The proteic detected result of the adaptive son identification recombinant C at D of Fig. 3 oligonucleotide
Among the figure:
◆: adaptive son of KAI-oligonucleotide and CatD;
■: adaptive son of KAI-oligonucleotide and BSA;
▲: adaptive son of GEL-oligonucleotide and CatD;
: adaptive son of GEL-oligonucleotide and BSA
The proteic detected result of the adaptive son identification Dahp of Fig. 4 oligonucleotide
Among the figure: () 0g/L, (▲), 0.4g/L (■) 2.0g/L,
The oligonucleotide aptamer of the different tripeptides of the target that screens and synthesize, these oligomerization nucleosides The acid aptamer can special identification contains the protein of corresponding tripeptide sequence, and a plurality of oligomerization The albumen that those contain these tripeptide sequences can be adsorbed and catch to the combination of nucleotide aptamer Matter. These oligonucleotide aptamers can carry out multiple combination, for example four oligonucleotides Aptamer can more effective identification contains the albumen of this sequence simultaneously. This method has realized egg The identification of white matter sequence information just can be learnt by the combination of oligonucleotide aptamer and to be caught The relevant information of the albumen that obtains.
The concrete steps of oligonucleotide aptamer screening are as follows:
1, synthetic tripeptides KAI, GEL, DGI and LAS.
Tripeptides Ac-LAS-amide, Ac-DGI-amide, Ac-GEL-amide and Ac-KAI-amide is by New England Peptide, and Inc. is synthetic.
2, tripeptides is coupled to HiTrap NHS-activated column.
HiTrap NHS-activated column is available from Amersham Pharmacia Biotech.
Tripeptides is dissolved in the standard coupling buffer, and three peptide concentrations after the dissolving are 0.5mM. Beat Open HiTrap NHS-activated column pillar lid, drip the hydrochloric acid 6 of ice-cold 1mM Ml, its flow velocity are 1ml/min, note avoiding bubble. Inject immediately 1ml 0.5mM tripeptides Solution is to pillar, and the envelope post was also placed 30 minutes in 25 ℃. Wash post then deactivation do not have combination The unnecessary active group of tripeptides and wash-out non-specific adsorption, 4 ℃ save backup.
3, the corresponding oligonucleotide aptamer of screening.
Wash 3 times with Apt buffer A 2ml, the DNA that 1ml is dissolved in buffer A at random Storehouse upper prop, room temperature are placed and were washed pillar with the 11ml buffer A again in 30 minutes, use 0.8 afterwards again Ml is dissolved in the 0.5mM tripeptides wash-out three times of buffer A, obtains 6 pipe eluents, every pipe About 400ul, every pipe adds 1ml ethanol, is dissolved in 6ul water after the DNA precipitation. Carry out with 3ul Pcr amplification, pcr amplification uses primer APT1-5:5 '-gcagtctcgt cgacaccc-3 ', Primer APT1-3:5 '-ctgcgtcgga tccagcac-3 '. Mix 6 pipe products also pure Change is dissolved in 50ul water, and 3ul carries out strand PCR, carries out altogether 6 pipes, and precipitation with alcohol is used after mixing Do the screening of next round. Screening is 12 times like this, and last PCR product cloning to the T carrier also Order-checking. Obtain following sequence:
GEL-oligonucleotide aptamer:
gcgaagcggg ctgaagtgca cacagctgga ggagtattgt tgggtgctc
KAI-oligonucleotide aptamer:
gcgcagcggg tggagtgtta agatgaattg cggtgtgggc cggcctctat tggc
LAS-oligonucleotide aptamer:
acgaagtggg tgtatagcga ataatcatta agaaagggcg ctgtgttgtg
DGI-oligonucleotide aptamer:
agcctaaaat?attgcttagta?agggtggtct?ggctccgaga?ggggt
Utilize combining of the adaptive son of the adaptive sub-technical evaluation of Structure-switch signaling oligonucleotide and the corresponding tripeptides of protein:
The main method of the adaptive sub-technology of Structure-switch signaling oligonucleotide is after the adaptive son of oligonucleotide is carried out end prolongation (MAP), make it can follow FDNA (short-chain nucleic acids of mark fluorescent group) and QDNA (short-chain nucleic acids of mark quenching group) annealed combination simultaneously, FDNA in the ternary complex and QDNA interact and cause fluorescent quenching at this moment, do not have signal to produce.When the target protein of the adaptive son of oligonucleotide occurs, target protein and adaptive sub combination of oligonucleotide, thus cause QDNA to dissociate, make FDNA send fluorescence.Utilize such principle to detect protein.
(1) according to the synthetic adaptive son of structure-switch signaling oligonucleotide of the adaptive subsequence of oligonucleotide.
The adaptive son of MAP-DGI-oligonucleotide:
5’-cctgccacgc?tccgccctgc?tcactggcgc?agcgggtgga?gtgttaagatgaattgcggt?gtgggccggc?ctctattggc-3’
The adaptive son of MAP-GEL-oligonucleotide:
5’-cctgccacgc?tccgccctgc?tcactggcga?agcgggctga?agtgcacacagctggaggag?tattgttggg?tgctc-3’
FDNA：5’-FAM-gcagggcgga?gcgtggcagg-3’
QDNA：5’-cccgctgcgc?cagtg-DABCYL-3’
(2) in test tube, add FDNA: MAP: QDNA=160: after 320: 480 (nM), add the BSA of different concns respectively, CatD or Dahp albumen, the 10xapt buffer A of 2.5uL, last water is supplied volume to 25uL, carries out fluoroscopic examination then.
Method according to proteinic aminoacid sequence capture protein:
1, biotin labeling capture protein molecule:
The adaptive son of oligonucleotide is adopted biotin labeling, be attached on the magnetic bead that contains Streptavidin (streptavidin), come the capture protein molecule with such magnetic bead.
(1) the adaptive son of the oligonucleotide that screening is obtained is synthetic and carry out biotin labeling.
con-biotin：5’-Biotin-atcacttata?tccat-3’
GEL-biotin：5’-Biotin-aatcacttat?gcgaagcggg?ctgaagtgcacacagctgga?ggagtattgt?tgggtgctc-3’
KAI-biotin：5’-Biotin-atcttgcgca?gcgggtggag?tgttaagatgaattgcggtg?tgggccggcc?tctattggc-3’
LAS-biotin：5’-Biotin-atcacttata?cgaagtgggt?gtatagcgaataatcattaa?gaaagggcgc?tgtgttgtg-3’
DGI-biotin：5’-Biotin-atcacttatc?catagcctaa?aatattgcttagtaagggtg?gtctggctcc?gagaggggt-3’
(2) the adaptive son of the oligonucleotide behind the mark is fixed in carrier.At first wash the 240uL magnetic bead 3 times with 400uL apt buffer A, then with in the magnetic bead of the adaptive son adding of the biotin labeled oligonucleotide of the various 100mM of 1uL Streptavidin (streptavidin) mark (contrast) with biotin labeled short sequence, supplying to the end with the apt buffer A, volume is 240uL, room temperature was placed 30 minutes, subsequently with 400uL apt buffer A wash 3 times each 15 minutes.
(3) add protein sample solution to be measured (with the preparation of apt buffer A), supply to the end with the apt buffer A that volume is 240uL, room temperature placement 30 minutes, with the apt buffer A wash 3 times each 15 minutes.
(4) use 0.02M NaOH eluted protein at last.
(5), the SDS-PAGE analyzing proteins is also with software LabWorks 4.0 software (UVP). protein content is added up.
Buffer A: 0.5M ethanolamine, 0.5M NaCl, pH 8.3Buffer B:0.1M acetate, 0.5M NaCl, pH 4; The coupling buffer of standard (Standardcoupling buffer): 0.2M MaHCO
3, 0.5M NaCl, pH 8; 10X Apt buffer A: 200mM Tris-HCl, pH 7.3; 1400mM NaCl; 50mM KCl; 50mMMgCl; 10mM CaCl
20.2%Triton X-100.
The PCR response procedures
94/5min，94/30sec，60/30sec，72/30sec，22cycles，then
72/7min，4/for?ever；
The adaptive son of oligonucleotide has the character that is similar to antibody, so small molecules or a proteinic part can become the target spot of the adaptive son identification of oligonucleotide fully.Target of the present invention is in tripeptides KAI, GEL, the adaptive son of the oligonucleotide of DGI and LAS with discern this tripeptide sequence and with protein in corresponding sequence interact, contain the protein of this tripeptide sequence with identification and absorption.Combination at random by the adaptive son of several oligonucleotides can be with the protein purification enrichment, and in addition, this method has popularity, is applicable to the protein of all species.Can determine adsorbed proteic sequence information by the information of the adaptive son of oligonucleotide.
The PIR-NREF database is added up discovery, contain tripeptides GEL simultaneously, DGI, KAI, the LAS sequence has only 2 albumen in E.coli, then have 17 in mouse, has 35 in the people.The various combination that relies between the adaptive son of multiple oligonucleotide can be discerned more albumen, for proteomics research provides effective way.
Embodiment
The adaptive son of different number oligonucleotides is caught CatD albumen
1 usefulness 400uL apt buffer A is washed the 240uL magnetic bead 3 times
2 then the adaptive son of the biotin labeled oligonucleotide of the various 100mM of 1uL add in the magnetic bead of streptavidin mark, supply to the end with the apt buffer A that volume is 240uL, room temperature placement 30 minutes.Be divided into six groups, be respectively: 4: biotin labeled DGI, KAI, GEL and each 20mM of the adaptive son of LAS oligonucleotide; 3: biotin labeled LAS, KAI, the adaptive son of GEL oligonucleotide and each 20mM of biotin labeled control sequence; 2: biotin labeled KAI and GEL oligonucleotide each 20mM of adaptive son and the biotin labeled control sequence of 40mM; 1:20mM adaptive son of biotin labeled LAS oligonucleotide and the biotin labeled control sequence of 60mM; 1 ': 20mM adaptive son of biotin labeled DGI oligonucleotide and the biotin labeled control sequence of 60mM; The biotin labeled control sequence of 0:80mM.
3 subsequently with 400uL apt buffer A wash 3 times each 15 minutes
4 add protein sample solution (CatD of purifying and BSA), supply to the end with the apt buffer A that volume is 240uL, room temperature placement 30 minutes
5 usefulness apt buffer A wash 3 times each 15 minutes
6 usefulness 0.02M NaOH eluted proteins
7 SDS-PAGE analytic samples
8 adopt UVP bioimaging systems and labworks 4.0 (UVP) software analysis electrophoretic band
9 results are as shown in Figure 1: four adaptive sons of oligonucleotide are the strongest to the proteic adsorptive power of CatD when existing simultaneously
The adaptive son of different number oligonucleotides is caught CatD albumen
1 usefulness 400uL apt buffer A is washed the 240uL magnetic bead 3 times
2 then the adaptive son of the biotin labeled oligonucleotide of the various 100mM of 1uL add in the magnetic bead of streptavidin mark, supply to the end with the apt buffer A that volume is 240uL, room temperature placement 30 minutes.Be divided into six groups, be respectively: 4: biotin labeled DGI, KAI, GEL and each 20mM of the adaptive son of LAS oligonucleotide; 3: biotin labeled LAS, KAI, the adaptive son of GEL oligonucleotide and each 20mM of biotin labeled control sequence; 2: biotin labeled KAI and GEL oligonucleotide each 20mM of adaptive son and the biotin labeled control sequence of 40mM; 1:20mM adaptive son of biotin labeled LAS oligonucleotide and the biotin labeled control sequence of 60mM; 1 ': the biotin labeled control sequence of the adaptive sub-60mM of the biotin labeled DGI oligonucleotide of 20mM; The biotin labeled control sequence of 0:80mM.
3 subsequently with 400uL apt buffer A wash 3 times each 15 minutes
4 add protein sample solution (the intestinal bacteria lysate of recombinant expressed Cat D), supply to the end with the apt buffer A that volume is 240uL, room temperature placement 30 minutes
5 usefulness apt buffer A wash 3 times each 15 minutes
6 usefulness 0.02M NaOH eluted proteins
7 SDS-PAGE analytic samples
8 adopt UVP bioimaging systems and labworks 4.0 (UVP) software analysis electrophoretic band
9 results are as shown in Figure 2: the strongest to the proteic adsorptive power of CatD when three or four adaptive sons of oligonucleotide exist simultaneously.
The proteic detection of Cat D
1 from mouse brain cDNA clone Cat D gene, is connected to PET24a (+) carrier, and BL21 (DE3) is as expression of recombinant proteins host bacterium.
catD-sense：5’-cctgaattca?tgaagactcc?cggcgt-3’
catD-antisense：5’-atcaagcttg?agtacgacag?cattggc-3’
The hyperacoustic method purifying of 2 usefulness CatD albumen, its step is as follows: behind the ultrasonic disruption cell 4 ℃, 15000rpm abandoned supernatant after centrifugal in 15 minutes, and the gentle ultrasonic 30-40 of EDTA solution that adds the long-pending 10mM pH 8.0 of precipitation volume pentaploid again is after second, 4 ℃, 5000rpm abandoned supernatant in 15 minutes, repeated this again and handled twice, the EDTA that in every gram precipitation, adds the 2mMpH 8.0 of 10mL precooling, gentle ultrasonic to solution be oyster white; Gentle ultrasonic one minute of the 40mM NaOH solution that adds isopyknic precooling to supernatant limpid till.The 0.5MTris pH 8.0 that adds 1/4 volume includes the PMSF of 1mM and the Leupeptin of every milliliter of 10uL; Put ice bath five minutes, 4 ℃, 15000rpm, centrifugal one hour.
3 the adaptive sons of oligonucleotide with the end prolongation, the short-chain nucleic acids (QDNA) of short nucleic acid chains (FDNA) the quenching group mark of mark fluorescent group is pressed following concentration ratio FDNA: MAP: QDNA=160: 320: 480 (nM) adds in the quantitative fluorescent PCR pipe, the albumen (0 that adds different concns, 1.4,2.7,4.1g/L) Cat D, BSA (0,2.0,4.2,6.3g/L), damping fluid is Apt Buffer, at 37 ℃ with OPTICON2 continuousfluorescence detector (MJ Research) record data.Contain KAI and GEL tripeptide sequence among the adaptive sub-.Cat D of the adaptive son of KAI-oligonucleotide/GEL-oligonucleotide that present embodiment adopts.
4 results increase with Cat D protein concentration as shown in Figure 3, and fluorescence intensity increases, and can see that in BSA experiment in contrast increasing fluorescent signal with protein concentration does not almost change.(◆: the adaptive sub-and CatD of KAI-oligonucleotide; ■: the adaptive sub-and BSA of KAI-oligonucleotide; ▲: the adaptive sub-and CatD of GEL-oligonucleotide; : the adaptive sub-and BSA of GEL-oligonucleotide)
The proteic detection of Dahp
1 from bacillus coli gene group dna clone Dahp gene, is connected to PET24a (+) carrier, and BL21 (DE3) is as expression of recombinant proteins host bacterium.
Dahp-sence：5’-gaattcatga?attatcagaa?cgacgattta?cg-3’
Dahp-antisence：5’-aagcttcccg?cgacgcgctt?ttact-3’
2 adopt Ni-NTA purifying Dahp albumen.
3 the adaptive sons of oligonucleotide with the end prolongation, the short-chain nucleic acids (QDNA) of short nucleic acid chains (FDNA) the quenching group mark of mark fluorescent group is pressed following concentration ratio FDNA: MAP: QDNA=160: 320: 480 (nM) adds in the quantitative fluorescent PCR pipe, the albumen (0 that adds different concns, 0.5,1.0,2.0,4.0,8.0, and 16.0mg/L) Dahp albumen, BSA [the 0g/L () that adds different concns simultaneously, (0.4g/L ▲), 2.0g/L (■)], check the special interaction between Dahp and the adaptive son of KAI-oligonucleotide, damping fluid is Apt Buffer, at 37 ℃ with OPTICON2 continuousfluorescence detector (MJ Research) record data.Contain the KAI tripeptide sequence among the adaptive sub-.Dahp of the KAI-oligonucleotide that adopts in the present embodiment.
4 results increase with the Dahp protein concentration as shown in Figure 4, and fluorescence intensity increases, and can see that in the experiment that adds BSA increasing fluorescent signal with protein concentration also increases.
Sequence table
＜110〉East China Normal University
＜120〉the adaptive son of the oligonucleotide of identification of protein sequence is in Application in Proteomics
<160>4
<210>1
<211>49
<212>DNA
＜213〉artificial sequence
<220>
<400>1
GEL-aptamer：
gcgaagcggg?ctgaagtgca?cacagctgga?ggagtattgt?tgggtgctc 49
<210>2
<211>54
<212>DNA
＜213〉artificial sequence
<220>
<400>2
KAI-aptamer：
gcgcagcggg?tggagtgtta?agatgaattg?cggtgtgggc?cggcctctat?tggc 54
<210>3
<211>50
<212>DNA
＜213〉artificial sequence
<220>
<400>3
LAS-aptamer：
acgaagtggg?tgtatagcga?ataatcatta?agaaagggcg?ctgtgttgtg 50
<210>4
<211>45
<212>DNA
＜213〉artificial sequence
<220>
<400>4
DGI-aptamer：
agcctaaaat?attgcttagta?agggtggtct?ggctccgaga?ggggt 45
Claims (3)
1, the adaptive son of the oligonucleotide of identification of protein sequence is in Application in Proteomics, it is characterized in that: use target in the adaptive son of the oligonucleotide of small peptide or other molecule, corresponding sequence in can identification of protein, the various combination of the adaptive son of a plurality of oligonucleotides or other molecule can be used for discerning, enrichment and catch the protein that contains corresponding aminoacid sequence.
2, the adaptive son of the oligonucleotide of identification of protein sequence as claimed in claim 1 is characterized in that in Application in Proteomics: the method for catching associated protein is: on protein example I before sample, wash-out and the protein detection, the adaptive son of synthetic oligonucleotide is carried out biotin labeling; II, the adaptive son of biotin labeled oligonucleotide is fixed on the magnetic bead carrier of marked by streptavidin;
The method of protein that identification contains corresponding aminoacid sequence is:
I, the adaptive son of synthetic oligonucleotide is carried out proper extension and the synthetic short chain Nucleotide that contains fluorescein base group and corresponding quenching group respectively,
II, in reaction system, add above-mentioned various Nucleotide, damping fluid and protein,
III, detect.
3, according to the adaptive son of oligonucleotide of claim 1 and 2 described identification of protein sequences in Application in Proteomics, it is characterized in that: target tripeptides KAI, GEL, DGI and LAS can discern the nucleotides sequence of the adaptive son of oligonucleotide that contains corresponding tripeptide sequence and classify as: the adaptive son of GEL-oligonucleotide:
gcgaagcggg?ctgaagtgca?cacagctgga?ggagtattgt?tgggtgctc
The adaptive son of KAI-oligonucleotide:
gcgcagcggg?tggagtgtta?agatgaattg?cggtgtgggc?cggcctctat?tggc
The adaptive son of LAS-oligonucleotide:
acgaagtggg?tgtatagcga?ataatcatta?agaaagggcg?ctgtgttgtg
The adaptive son of DGI-oligonucleotide:
agcctaaaat?attgcttagta?agggtggtct?ggctccgaga?ggggt。
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200610025342 CN1912138A (en) | 2006-03-31 | 2006-03-31 | Oligonucleotide adapter of identification of protein squence applied in protein tissue research |
| PCT/US2007/008274 WO2007117444A2 (en) | 2006-03-31 | 2007-03-30 | Protein detection by aptamers |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200610025342 CN1912138A (en) | 2006-03-31 | 2006-03-31 | Oligonucleotide adapter of identification of protein squence applied in protein tissue research |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN1912138A true CN1912138A (en) | 2007-02-14 |
Family
ID=37721193
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 200610025342 Pending CN1912138A (en) | 2006-03-31 | 2006-03-31 | Oligonucleotide adapter of identification of protein squence applied in protein tissue research |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1912138A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102405288A (en) * | 2009-02-19 | 2012-04-04 | Lfb生物技术公司 | Means for purifying a coagulation protein, and methods for implementing same |
-
2006
- 2006-03-31 CN CN 200610025342 patent/CN1912138A/en active Pending
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102405288A (en) * | 2009-02-19 | 2012-04-04 | Lfb生物技术公司 | Means for purifying a coagulation protein, and methods for implementing same |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| RU2360923C2 (en) | Novel ligand of cytokine receptor zcytor17 | |
| CN1742201A (en) | Methods of biosensing using fluorescent polymers and quencher-tether-ligand bioconjugates | |
| AU2011256290A1 (en) | Rapid isolation of monoclonal antibodies from animals | |
| CN1514243A (en) | Method of preceeding qualitative and lor quantitative analysis against target substance its device and marker and detecting reagent box | |
| CN1284168A (en) | Solid-phase tips and uses relating thereto | |
| CN1313622C (en) | High-flux cell biological chip testing technology and reagent case | |
| JP6824903B2 (en) | Methods and compositions for peptide cyclization and protease treatment | |
| CN1912138A (en) | Oligonucleotide adapter of identification of protein squence applied in protein tissue research | |
| CN1880447A (en) | Process for preparing high-flux monoclonal antibody | |
| CN101029340A (en) | Method for screening high-reproduction goat and its special primer | |
| CN1240685C (en) | Production method and use for dichloro quinolinic acid artificial hapten, artificial antigen and specific antibody | |
| Kunys et al. | Specificity Profiling of Protein‐Binding Domains Using One‐Bead‐One‐Compound Peptide Libraries | |
| CN1294418C (en) | Method and reagent box for inspecting mycelian protein antibody of white candida | |
| CN1696698A (en) | Affinity chromatography-enzyme immunoassay method for PAT protein, and dedicated kit | |
| CN1164947C (en) | Process for preparing cross-linking antibody by solid-phase immunoadsorption method | |
| JP2007139787A (en) | Method for identification and relative determination of protein based on selective isolation of rrnk peptide for simplifying complicated proteinic mixture | |
| CN1811451A (en) | Method for detecting nephrotic syndrome hemorrhagic fever antibody | |
| CN1687416A (en) | Gene sequence of lipid transfer protein of vinca rosea | |
| CN1866020A (en) | Kit for simultaneously detecting nonyl phenol, atrazine and estradiol and preparation method thereof | |
| CN101037473A (en) | R. grahami rnmunoregulating polypeptide, gene and variant and its application in medicine production | |
| JP2009184981A (en) | Anti-d-amino acid monoclonal antibody and method for immunologically analyzing d-amino acid using anti-d-amino acid monoclonal antibody | |
| CN1354258A (en) | Chromatographic biological chip technology capable of making quick detection | |
| CN114437176B (en) | Novel light labeling reagent and application thereof in cell surface proteome and N-glycosylation enrichment analysis | |
| CN108822189A (en) | A kind of targeting combines specific polypeptide and its application of lymphocytic cancer cell system | |
| CN1238500C (en) | Immunology epitope of hog cholera virus feature and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Open date: 20070214 |