CN1811451A - Method for detecting nephrotic syndrome hemorrhagic fever antibody - Google Patents
Method for detecting nephrotic syndrome hemorrhagic fever antibody Download PDFInfo
- Publication number
- CN1811451A CN1811451A CN 200610013151 CN200610013151A CN1811451A CN 1811451 A CN1811451 A CN 1811451A CN 200610013151 CN200610013151 CN 200610013151 CN 200610013151 A CN200610013151 A CN 200610013151A CN 1811451 A CN1811451 A CN 1811451A
- Authority
- CN
- China
- Prior art keywords
- antibody
- gene
- strain
- pbs
- recombinant protein
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Peptides Or Proteins (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
Abstract
The present invention provides a method for detecting hemorrhagic fever with renal syndrome (HFRS) antibody, belonging to the field of biological technology. It relates to a technique capable of utilizing immunomagnetic trapping technique and antigen protein of enzyme-labelled recombinant virus to detect antibody of HFRS due to Hantanvirus. Said method includes the following steps: purifying S gene recombinant protein of Hantanvirus representative strain Z10 and L99 expressed by pET prokaryotic expression system, labeling biotin or horseradish peroxidase, making magnetic microsphere be connected with sheep anti-human IgM (mu chain) or sheep anti-human IgG antibody and making it be sensitized to obtain immunomagnetic microsphere for detecting specific IgM/IgG antibody of seoul type or Hantan type of Hantanvirus and creating the quick and sensitive immunomagnetic microphere ELISA method for detecting HFRS specific IgM/IgG antibody in blood serum sample.
Description
Technical field:
The present invention relates to hemorrhagic fever with renal syndrome (HFRS) cause of disease---the preparation of Hantaan virus (HV) S gene recombinant protein and the preparation of mark and immune magnetic microsphere, utilize immune magnetic ball capture technique, set up novel, quick, sensitive immune magnetic microsphere-ELISA method, detect specific IgM/IgG antibody in the hemorrhagic fever with renal syndrome patients serum sample.Belong to biological technical field.
Technical background:
China is the country that is subjected to hemorrhagic fever with renal syndrome harm the most serious, and annual number of the infected accounts for more than 90% of World Report sum, and case fatality rate is high, for China's statutory report infectious disease case fatality rate one of infectious disease of five that ranks forefront, causes concern both domestic and external.The diagnosis of this disease and the research of preventing and controlling are undertaken by Chinese scholar mostly.This disease onset is anxious, and clinical manifestation is intricate, and kidney damage is outstanding, does not still have the medicine of special efficacy, and harm is serious, so early diagnosis and early treatment are to improve the key that patient's prognosis reduces case fatality rate.For this reason, the research of this sick laboratory auxiliary diagnosis just seems very important.
The detection that the early stage employing RT-PCR method of hemorrhagic fever with renal syndrome is carried out viral nucleic acid 3～5 days the patient in back that only limits to fall ill, patients serum's antibody is then along with the prolongation of the course of disease raises and the lasting long period gradually, occupy very consequence so detect the auxiliary clinical diagnosis of the method for the specific IgM/IgG antibody among the patients serum, and can be used for disease surveillance.Now adopt indirect immunofluorescence (IFA) or ELISA detection specificity IgM/IgG antibody clinically mostly.On methodology, IFA method high specificity, relative sensitivity is poor slightly, is commonly used to do confirmatory test; The ELISA method adopts zymetology cascade enlarge-effect, and sensitivity increases, but need be with prize law getting rid of the interference of other composition in the blood (as rheumatoid factor etc.) when detecting IgM antibody, otherwise occurs false positive easily.And the both needs certain instrument and equipment, be difficult to promote, and existing ELISA method uses the ELISA Plate volume of import more very much not to be easy to carry, and cost is higher, this has just influenced different medical unit undoubtedly and has used this method to carry out early diagnosis, so study a kind of sensitivity that improves test and also simple to operate, be easy to carry, fast, sensitive, special, the detection method that is beneficial to popularization, to be fit to diagnosis and the disease surveillance work that basic unit carries out HFRS, be the task of top priority.
Summary of the invention:
At the problems referred to above, the objective of the invention is to be easy to carry for the early diagnosis of hemorrhagic fever with renal syndrome and disease surveillance provide a kind of, easy, quick, sensitive, special detection method, relate to the preparation of the preparation of Hantaan virus S gene recombinant protein and mark, immune magnetic microsphere, the foundation of immune magnetic microsphere-ELISA method.
The present invention adopts technique for gene engineering with the popular type Hantaan virus of domestic advantage type strain: the S gene directed cloning of SEO type (soul type) L99 strain and HTN type (Chinese beach type) Z10 strain is gone into the pET32a carrier, change the E.coliBL21 competence over to, through the IPTG abduction delivering, with nickel ion affinity chromatograph (Ni-NTA) purifying, obtain highly purified proteantigen, mark horseradish peroxidase (HRP) or biotin, antigen serves as a mark; And the magnetic microsphere of unlike materials such as agarose, polyvinyl alcohol (PVA), cellulose activated, connect goat-anti people IgM (μ chain) or goat anti-human igg antibody, obtain being used for the immune magnetic microsphere of detection specificity IgM/IgG antibody.Replace the ELISA Plate of traditional E LISA to set up the ELISA detection method with above-mentioned immune magnetic microsphere, be used for kidney syndrome blooding diagnosis or disease surveillance as the solid phase adsorption carrier.
Detect the method for nephrotic syndrome hemorrhagic fever antibody, its concrete scheme is to adopt goat-anti people IgM (μ chain) or goat anti-human igg antibody to link to each other the preparation immune magnetic microsphere with magnetic microsphere as the solid phase adsorption carrier, set up the novel immune magnetic microsphere-ELISA method that detects hemorrhagic fever with renal syndrome patients serum IgM/IgG antibody, its key step is as follows:
1) preparation of the Hantaan virus S gene recombinant protein of biotin or HRP mark;
2) be used to catch the preparation of the immune magnetic microsphere of human serum antibody IgM/IgG;
3) detect hemorrhagic fever with renal syndrome patient antibody.
Need to prove:
The enzyme labeling recombinant protein of preparation is the recombinant protein of Hantaan virus S gene expression, and its preparation technology comprises following process:
1) Bing Du cultivation and RNA extract:
The Hantaan virus S gene source of choosing is in the popular type standard virus of China's advantage strain Z10 and L99, depositary institution is prevention of CDC (CDC) virosis and control institute, Z10, L99 Strain are inoculated the Vero-E6 cell routinely, and indirect immunofluorescence (IFA) is checked the cell infection degree.When 75%～100% cell has infected, collect cell.The RNeasy Mini Kit of Qiagen company is used in the extraction of cell total rna, and the step of by specification is extracted.
2) utilize the RT-PCR technology to obtain the S gene of coding destination protein:
To extract total RNA of infection cell as the synthetic cDNA of the template of reverse transcription, the primer sequence of the synthetic cDNA of reverse transcription is P14 (TAGTAGTAGACTCC), RNA Kit (AMV) kit that uses TaKaRa company is by the explanation operation, the reverse transcription product is directly used in pcr amplification, and the primer sequence P1 and the P2 of amplification Z10 strain S gene are respectively GGGGTACCGCAACTATGGAGGAACTAC and CGCTCTAGAAGTTTTAAAGGCTCTTGG; The primer sequence P3 and the P4 of pcr amplification L99 strain S gene are respectively CGCATCGATGGCAACTATGGAAGAAATC and TCGGGTACCAATTTCATAGGTTCCTGG, above-mentioned primer sequence is synthetic by Ying Jun Bioisystech Co., Ltd, and reaction conditions is: 94 ℃ of pre-sex change of 2min; 94 ℃ of 50sec, 50 ℃～62 ℃ 50～75sec, 72 ℃ of 90sec, totally 30～35 circulations; 72 ℃ are extended 5～10min, and above-mentioned pcr amplification product is through sequential analysis (providing the order-checking service by Ying Jun Bioisystech Co., Ltd), and its result is consistent with the Z10 strain sequence (AF184987) and the L99 strain sequence (AF288299) of GenBank login respectively;
3) based on the structure of the Hantaan virus S gene pET-32a expression system of e. coli strain bl21:
S gene PCR purified product and pET-32a carrier with restriction endonuclease EcoRI and XhoI difference double digestion L99 Strain, S gene PCR purified product and pET-32a carrier with SacI and XhoI difference double digestion Z10 Strain, reclaim the purpose fragment, after connecting, the T4 ligase changes the competent cell of E.coliBL21 bacterial strain over to, recombinant plasmid is identified through PCR and double digestion, is obtained to contain the E.coliBL21 prokaryotic expression system of pET32a-L99S and pET32a-Z1OS recombinant plasmid;
4) expression of Hantaan virus S gene recombinant protein and evaluation:
Recombinant bacterial strain is inoculated in 2～5mL contains in the LB nutrient solution of ampicillin 100 μ g/mL, 37 ℃ of shaken cultivation are to OD
600Reaching at 0.6～0.8 o'clock, is that the IPTG of 0.1～2mmol/L induced 4 hours with final concentration, and the thalline of collection is resuspended with 2 * gel sample-loading buffer, handles 1～10min for 100 ℃, makes cellular lysate, and lysate carries out SDS-PAGE and analyzes; And employing is wet entirely or half-dried transfer printing is transferred to albumen on the nitrocellulose filter, carrying out Western-blot identifies, wherein one resists and the two anti-horseradish peroxidase mark goat anti-human iggs that are respectively HFRS patient's pooled serum and 1: 100～500PBS dilution, wherein PBS concentration is 0.01mM, pH is 7.4 (following PBS all uses this concentration), SDS-PAGE result shows that the recombinant bacterial strain pET32a-L99S/E.coliBL21 of structure and pET32a-Z10S/E.coliBL21 all express a 67.1kDa destination protein, the result of Western-blot shows that for specific band appears in this recombinant protein and HV infected patient seroreaction it has good antigenicity;
5) extraction of Hantaan virus S gene recombinant protein and purifying:
With the zymocyte liquid after inducing through the centrifugal 10min of 5000r/min, collecting thalline gives a baby a bath on the third day after its birth time with the phosphate buffer (PBS) of pH7.4, bacterial sediment is resuspended with PBS, the ultrasonication thalline, 12000r/min, 4 ℃ centrifugal 1 hour, collect supernatant, use nickel ion affinity chromatographic column (Ni-NTA) purifying expressed proteins at last, collect eluent, through vacuum freeze drying, prepare the pure product of Hantaan virus S gene recombinant protein, be 95～98% through the purity of SDS-PAGE or HPLC chromatography determination recombinant protein;
6) mark of Hantaan virus S gene recombinant protein, it comprises biotin and two kinds of methods of HRP mark:
(A) implementation step of mark biotin is as follows: get the expressing protein 10～30mg behind the purifying, be dissolved in 0.05～0.2M/L NaHCO
3(pH8.5) among damping fluid 2～10mL, add activation biotin 3～5mg, stir, room temperature reaction 1～4 hour adds glycocoll 50～100mg, cessation reaction, biotin labeled recombinant protein is behind saturated ammonium sulphate 2 times, sediment is with 2～5mLPBS dissolving, and after the dialysis, vacuum freeze drying is preserved;
(B) utilize the implementation step of sodium periodate method mark HRP as follows: 1～5mg HRP to be dissolved in 1～10mL distilled water, to add freshly prepared 0.06M NaIO
4Solution 0.1～1mL, mixing is placed 30min for 4 ℃, add 0.16M ethylene glycol-NaCl solution 0.5～1mL, precooling absolute ethyl alcohol 1～10mL room temperature is placed 30min, and centrifugal, taking precipitate makes it to dissolve fully with distilled water, be hydroformylation HRP, add the solution 1mL of 5～20mg expressing protein, mixing is also adorned bag filter, slowly stirs dialysis 6～18 hours for 4 ℃ with 0.05M carbonate buffer solution pH9.5, make it combination, sucking-off adds NaBH then
4Or KBH
4Solution (5mg/mL) 0.05～0.2mL placed 2 hours for 4 ℃, added the equal-volume saturated ammonium sulfate, sediment makes it to dissolve fully with PBS, and dialysed overnight, and next day is centrifugal again, remove insolubles and promptly get the enzyme labeling thing, after adding to 1～5mL and measure with PBS, vacuum freeze drying is preserved.
The immune magnetic microsphere that preparation is used to catch human serum antibody IgM/IgG is that the magnetic microsphere that Chinese patent ZL03144274.9 activates is connected with goat-anti people IgM (μ chain)/goat anti-human igg's antibody, and sensitization is immune magnetic microsphere; The concrete practice is: under 2～8 ℃, get the good magnetic microsphere 1～5mL of activation, adding is through pH9.6,0.1M goat-anti people IgM (μ chain)/goat anti-human igg 5～10mL that carbonate buffer solution diluted, fully reaction is after PBS drip washing, add 10% rabbit anteserum (RSA), 5～10mL and after 1 hour, clean the immune magnetic microsphere that can obtain being used for the IgM/IgG detection with PBS in 37 ℃ of sealings.
Detect the method for hemorrhagic fever with renal syndrome patient antibody, concrete experimental procedure is: containing the patients serum 1mL to be measured that 15 μ L add 1: 50～100PBS dilution in by the centrifuge tube of the immune magnetic microsphere of goat-anti people IgM (μ chain)/goat anti-human igg's sensitization respectively, feminine gender and each 1mL of positive control, 37 ℃ of oscillating reactionss 1 hour, outside centrifugal tube wall, assemble fixedly microballoon with magnet, discard reactant liquor, clean repeatedly 3 times with PBS, carrying out the colour developing of enzyme indicated weight group antigen then judges, method is the biotin labeled expressing protein 1mL of HRP/ that adds 80～100 times of PBS dilutions in the experiment centrifuge tube, 37 ℃ of oscillating reactionss 1 hour, the chromogenic substrate 1mL that adds new preparation after the cleaning again, reaction 10min, the visual inspection change color, blank and negative control are colourless, it is blue that positive control shows, then the result sets up, and the detector tube colour developing is deeper than or equals the positive control color and shows that then experimental result is positive, and perhaps measures OD
450Value is calculated the positive that is judged to be of P/N 〉=2.1, P/N＜2.1 be judged to be feminine gender, wherein P/N=(test serum OD
450Value-blank OD
450Value)/(negative control OD
450Value-blank OD
450Value).
Traditional E LISA method and immune magnetic ball are caught the comparison of ELISA method sensitivity: the HFRS patients serum is pressed 1: 10 continuous doubling dilution to 1 with PBS: 10000, and each dilutability is made 3 parts of parallel samples.Utilize traditional E LISA method (see national clinical examination working specification, Nanjing: publishing house of Southeast China University, 1991, P345) and immune magnetic ball of the present invention catch the ELISA method, respectively the dilution serum of difference is detected, the results are shown in Table 1.
Table 1 traditional E LISA method and immune magnetic ball are caught ELISA method remolding sensitivity
| Extension rate | Parallel sample | Traditional E LISA method | Immunity magnetic ball is caught the ELISA method |
| 1∶10 1∶100 1∶1000 1∶10000 | 1 2 3 1 2 3 1 2 3 1 2 3 | + + + + + + - - - - - - | + + + + + + + + + + + + |
Annotate :+expression test findings is positive, and-expression test findings is negative.
Table 1 result shows that immune magnetic ball catches the ELISA method and compare with traditional ELISA method, and when serum dilution was lower than 1: 100, two kinds of methods can detect positive findings.When serum dilution reaches 1: 1000 and 1: 10000 the time, the ELISA method of catching immune magnetic ball of the present invention detects positive, and traditional E LISA rule is negative, thereby proves that immune magnetic ball catches the ELISA method and improved more than 100 times than the sensitivity of traditional E LISA method.
The invention has the beneficial effects as follows:
The immune magnetic ball that utilizes immune magnetic microsphere technology of the present invention to set up is caught the ELISA method, replace the carrier of the ELISA Plate of traditional E LISA method as the solid phase adsorption antibody/antigen, not only increased the area of absorption widely, and so that carry, have the 1.5mL centrifuge tube of lid, the ELISA Plate that substituted volume is bigger, thereby make detecting operation easy, quick, to can't higher recall rate being arranged detected antibody below the traditional E LISA response limit.Its sensitivity has improved more than 100 times than traditional E LISA method.The present invention is applicable to clinical labororatory's detection and disease surveillance work, is particularly useful for the use of grass-roots unit.The present invention provides a kind of novel, quick, easy and detection method of being easy to promote for clinical trial detects, early diagnosis and preventing and controlling to hemorrhagic fever with renal syndrome have bigger economic benefit and social benefit.
Description of drawings
Fig. 1: the electrophoretogram of amplification Hantaan virus Z10 and L99 strain S gene order;
Fig. 2: the Western-blot of Hantaan virus S gene recombinant protein analyzes.
Embodiment:
Embodiment 1:
One, the preparation and the mark of Hantaan virus S dna recombinant expression albumen:
1. Bing Du cultivation and RNA extract:
Z10, L99 Strain are inoculated the Vero-E6 cell routinely, and indirect immunofluorescence (IFA) is checked the cell infection degree.When 75% above cell has infected, collect cell.The extraction of cell total rna, the RNeasy Mini Kit of use Qiagen company, and the step of by specification is extracted.
2. utilize the RT-PCR technology to obtain the S gene of coding destination protein:
The total RNA that extracts infection cell is synthesized cDNA as the template of reverse transcription, and RNA Kit (AMV) kit that uses TaKaRa company is by the explanation operation.The reverse transcription product is directly used in pcr amplification.Reaction conditions is: 94 ℃ of pre-sex change of 2min; 94 ℃ of 50sec, 58 ℃ of 50sec, 72 ℃ of 90sec, totally 30 circulations; 72 ℃ are extended 10min.The PCR product is identified through 1.0% agarose gel electrophoresis, the results are shown in Figure 1, and 1 is DL2000marker among the figure, and 2 is Z10 strain S genetic fragment, and 3 is L99 strain S genetic fragment.
3. based on the structure of the pET-32a expression system of e. coli strain bl21: utilize EcoRI and XhoI the PCR purified product and the pET-32a carrier of double digestion L99 Strain respectively, utilize SacI and XhoI the PCR purified product and the pET-32a carrier of double digestion Z10 Strain respectively, reclaim the purpose fragment, after linking to each other, the T4 ligase changes the competent cell of E.coliBL21 bacterial strain over to, recombinant plasmid PCR and double digestion are identified, obtain to contain the S Prokaryotic Expression system of ET32a-L99S and pET32a-Z1OS recombinant plasmid.
4. the expression of Hantaan virus S gene recombinant protein and evaluation: the positive recombinant bacterial strain inoculation of picking 5mL LB nutrient solution (containing ampicillin 100 μ g/mL), 37 ℃ of shaken cultivation are to OD
600Reaching at 0.8 o'clock, is that the IPTG of 2mM/L induced 4 hours with final concentration.The thalline of collecting is resuspended with 2 * gel sample-loading buffer, handles 10min for 100 ℃, makes cellular lysate, and lysate carries out SDS-PAGE and analyzes; And adopting complete wet transfer printing that albumen is transferred on the nitrocellulose filter, Western-blot identifies (anti-and two anti-horseradish peroxidase mark goat anti-human iggs that are respectively HFRS patient's pooled serum and dilution in 1: 500), the results are shown in Figure 2.1 is albumen marker as seen from the figure; 2 Western blot analysis results for pET32a-L99S/E.coliBL21 expression destination protein; 3 Western blot analysis results for pET32a-Z1OS/E.coliBL21 expression destination protein; Show that it has good antigenicity.
5. the extraction of Hantaan virus S gene recombinant protein and purifying: the zymocyte liquid after will inducing is through the centrifugal 10min of 5000r/min, collecting thalline gives a baby a bath on the third day after its birth time with the phosphate buffer (PBS) of pH7.4, bacterial sediment is resuspended with PBS, ultrasonication thalline, 12000r/min, 4 ℃ centrifugal 1 hour, collect supernatant, use nickel ion affinity chromatographic column (Ni-NTA) purifying expressed proteins at last, collect eluent, through vacuum freeze drying, it is standby to prepare the pure product of Hantaan virus S gene recombinant protein.
6. the biotin labeling of Hantaan virus S gene recombinant protein: get the recombinant protein 10mg behind the purifying, be dissolved in 0.05M/L NaHCO
3(pH8.5) among the damping fluid 5mL, add activation biotin 3mg, stir, room temperature reaction 1 hour adds glycocoll 50mg, cessation reaction.Biotin labeled recombinant protein is behind saturated ammonium sulphate 2 times, and sediment dissolves with 2mLPBS, and after the dialysis, vacuum freeze drying is preserved.
Two, the preparation of immune magnetic microsphere:
Adopt 1mL activation magnetic microsphere (being selected from Chinese patent ZL03144274.9), add 5mL through pH9.6,0.1M carbonate buffer solution dilutes good goat-anti people IgM (μ chain), 4 ℃ of reactions are spent the night, after the PBS washing, add 10% rabbit anteserum (RSA) 5mL and after 1 hour, clean the immune magnetic microsphere that can obtain being used for the IgM detection with PBS in 37 ℃ of sealings.
Three, detect the method for hemorrhagic fever with renal syndrome patient-specific IgM antibody:
Add 1 in by the centrifuge tube of the immune magnetic microsphere of goat-anti people IgM (μ chain) sensitization containing 15 μ L respectively: the patients serum 1mL to be measured of 100PBS dilution, feminine gender and each 1mL of positive control, 37 ℃ of oscillating reactionss 1 hour, fixedly microballoon is assembled in magnetic field with magnet outside centrifugal tube wall, discard reactant liquor, clean repeatedly 3 times with PBS.The judgement that develops the color of enzyme indicated weight histone antigen, its method is: (wherein PBS concentration is all 0.01mM in following each embodiment to add 80 times of PBS dilutions in the experiment centrifuge tube, pH is 7.4) biotin labeled expressing protein 1mL, 37 ℃ of oscillating reactionss 1 hour.The chromogenic substrate 1mL that adds new preparation after the cleaning again, reaction 10min.Observe change color, blank and negative control are colourless, and it is blue that positive control shows, and then the result sets up.The detector tube colour developing is deeper than the positive control color, shows that experimental result is positive.
Embodiment 2:
One, the preparation of Hantaan virus S gene recombinant protein and mark: (with embodiment 1)
Two, the preparation of immune magnetic microsphere: (with embodiment 1)
Three, detect the method for hemorrhagic fever with renal syndrome patient-specific IgM antibody:
Add 1 in by the centrifuge tube of the immune magnetic microsphere of goat-anti people IgM (μ chain) sensitization containing 15 μ L respectively: the patients serum 1mL to be measured of 100PBS dilution, feminine gender and each 1mL of positive control, 37 ℃ of oscillating reactionss 1 hour, fixedly microballoon is assembled in magnetic field with magnet outside centrifugal tube wall, discard reactant liquor, clean repeatedly 3 times with PBS.Enzyme indicated weight histone antigen develops the color judges it is the biotin labeled expressing protein 1mL that adds 100 times of PBS dilutions in the experiment centrifuge tube, 37 ℃ of oscillating reactionss 1 hour.The chromogenic substrate 1mL that adds new preparation after the cleaning again, reaction 10min.Observe change color, blank and negative control are colourless, and it is blue that positive control shows, and then the result sets up.This moment, the detector tube demonstration was colourless, showed that experimental result is negative.
Embodiment 3:
One, the preparation of Hantaan virus S gene recombinant protein and mark: (with embodiment 1)
Two, the preparation of immune magnetic microsphere: (with embodiment 1)
Three, detect the method for hemorrhagic fever with renal syndrome patient-specific IgM antibody:
Add 1 in by the centrifuge tube of the immune magnetic microsphere of goat-anti people IgM (μ chain) sensitization containing 15 μ L respectively: the patients serum 1mL to be measured of 100PBS dilution, feminine gender and each 1mL of positive control, 37 ℃ of oscillating reactionss 1 hour, fixedly microballoon is assembled in magnetic field with magnet outside centrifugal tube wall, discard reactant liquor, clean repeatedly 3 times with PBS.Enzyme indicated weight histone antigen develops the color judges it is the biotin labeled expressing protein 1mL that adds 100 times of PBS dilutions in the experiment centrifuge tube, 37 ℃ of oscillating reactionss 1 hour.The chromogenic substrate 1mL that adds new preparation after the cleaning again, reaction 10min.Observe change color, blank and negative control are colourless, and it is blue that positive control shows, and then the result sets up.This moment, the detector tube demonstration was shallower than the positive control color, showed that experimental result is negative.
Embodiment 4:
One, the preparation of Hantaan virus S gene recombinant protein and mark:
1. Bing Du cultivation and RNA extract: (with embodiment 1)
2. utilize the RT-PCR technology to obtain the S gene of coding destination protein: (with embodiment 1)
3. based on the structure of the pET-32a expression system of e. coli strain bl21: (with embodiment 1)
4. the expression of Hantaan virus S gene recombinant protein and evaluation: (with embodiment 1)
5. the extraction of Hantaan virus S gene recombinant protein and purifying: (with embodiment 1)
6. the horseradish peroxidase of Hantaan virus S gene recombinant protein (HRP) mark: 2mg HRP is dissolved in the 5mL distilled water, adds freshly prepared 0.06M NaIO
4Solution 1mL, mixing is placed 30min for 4 ℃, adds 0.16M ethylene glycol-NaCl solution 1mL, precooling absolute ethyl alcohol 4mL, room temperature is placed 30min, and centrifugal, taking precipitate makes it to dissolve fully with distilled water, is hydroformylation HRP.Add the solution 1mL of 15mg expressing protein, mixing is also adorned bag filter, slowly stirs dialysis 10 hours for 4 ℃ with 0.05M pH9.5 carbonate buffer solution, makes it combination.Sucking-off adds KBH then
4Solution (5mg/mL) 0.2mL placed 2 hours for 4 ℃, added the equal-volume saturated ammonium sulfate.Sediment makes it to dissolve fully with PBS, and dialysed overnight.Next day is centrifugal again, removes insolubles and promptly gets the enzyme labeling thing.After adding to 5mL dialysis with PBS, vacuum freeze drying is preserved.
Two, the preparation of immune magnetic microsphere:
Get the activation magnetic microsphere (being selected from Chinese invention patent ZL03144274.9) that 1mL prepares, add 5mL through pH9.6,0.1M carbonate buffer solution dilutes good goat anti-human igg, 4 ℃ of reactions are spent the night, after the PBS washing, add 10% rabbit anteserum (RSA) 8mL and after 1 hour, clean the immune magnetic microsphere that can obtain being used for the IgG detection with PBS in 37 ℃ of sealings.
Three, detect the method for hemorrhagic fever with renal syndrome patient-specific IgG antibody: add 1 in by the centrifuge tube of the immune magnetic microsphere of goat anti-human igg's sensitization containing 15 μ L respectively: the patients serum 1mL to be measured of 80PBS dilution, feminine gender and each 1mL of positive control, 37 ℃ of oscillating reactionss 1 hour, fixedly microballoon is assembled in magnetic field with magnet outside centrifugal tube wall, discard reactant liquor, clean repeatedly 3 times with PBS.Enzyme indicated weight group antigen develops the color judges it is the HRP mark recombinant protein antigen 1mL that adds 100 times of PBS dilutions in the experiment centrifuge tube, 37 ℃ of oscillating reactionss 1 hour.The chromogenic substrate 1mL that adds new preparation after the cleaning again, reaction 10min.This measures OD
450Value result's P/N＞2.1 events as calculated is judged to be the positive, wherein P/N=(test serum OD
450Value-blank OD
450Value)/(negative control OD
450Value-blank OD
450Value).
Embodiment 5:
One, the preparation and the mark of Hantaan virus S dna recombinant expression albumen: (with embodiment 1)
Two, the preparation of immune magnetic microsphere:
Get the activation magnetic microsphere (being selected from Chinese invention patent ZL03144274.9) that 1mL prepares, add 6mL through pH9.6,0.1M carbonate buffer solution dilutes good goat anti-human igg, 4 ℃ of reactions are spent the night, after the PBS washing, add 10% rabbit anteserum (RSA) 6mL and after 1 hour, clean the immune magnetic microsphere that can obtain being used for the IgG detection with PBS in 37 ℃ of sealings.
Three, detect the method for hemorrhagic fever with renal syndrome patient-specific IgG antibody: add 1 in by the centrifuge tube of the immune magnetic microsphere of goat anti-human igg's sensitization containing 15 μ L respectively: the patients serum 1mL to be measured of 100PBS dilution, each 1mL of feminine gender or positive control, 37 ℃ of oscillating reactionss 1 hour, fixedly microballoon is assembled in magnetic field with magnet outside centrifugal tube wall, discard reactant liquor, clean repeatedly 3 times with PBS.Enzyme indicated weight group antigen develops the color judges it is the biotin labeling expressing protein 1mL that adds 80 times of PBS dilutions in each test centrifuge tube, 37 ℃ of oscillating reactionss 1 hour.The chromogenic substrate 1mL that adds new preparation after the cleaning again, reaction 10min.This measures OD
450Value result's P/N＜2.1 events as calculated is judged to be feminine gender, wherein P/N=(test serum OD
450Value-blank OD
450Value)/(negative control OD
450Value-blank OD
450Value).
Sequence table
SEQUENCE LISTING
＜110〉Tianjin Center for Disease Control and Prevention, Medical University Of Tianjin, Nankai University
＜120〉method of detection nephrotic syndrome hemorrhagic fever antibody
<130>051228
<160>5
<170>PatentIn version 3.2
<210>1
<211>14
<212>DNA
＜213〉artificial sequence
<220>
<221>prim_bind
<222>(1)..(14)
<400>1
tagtagtaga ctcc
14
<210>2
<211>27
<212>DNA
＜213〉artificial sequence
<220>
<221>prim_bind
<222>(1)..(27)
<400>2
ggggtaccgc aactatggag gaactac
27
<210>3
<211>27
<212>DNA
＜213〉artificial sequence
<220>
<221>prim_bind
<222>(1)..(27)
<400>3
cgctctagaa gttttaaagg ctcttgg
27
<210>4
<211>28
<212>DNA
＜213〉artificial sequence
<220>
<221>prim_bind
<222>(1)..(27)
<400>4
cgcatcgatg gcaactatgg aagaaatc
28
<210>5
<211>27
<212>DNA
＜213〉artificial sequence
<220>
<221>prim_bind
<222>(1)..(14)
<400>5
tcgggtacca atttcatagg ttcctgg
27
Claims (4)
1. detect the method for nephrotic syndrome hemorrhagic fever antibody, it is characterized in that it adopts goat-anti people IgM (μ chain) or goat anti-human igg antibody to link to each other with magnetic microsphere, the preparation immune magnetic microsphere is as the solid phase adsorption carrier, set up the novel immune magnetic microsphere-ELISA method that detects hemorrhagic fever with renal syndrome patients serum IgM/IgG antibody, its key step is as follows:
1) preparation of Hantaan virus (HV) the S gene recombinant protein of biotin or horseradish peroxidase (HRP) mark;
2) be used to catch the preparation of the immune magnetic microsphere of human serum antibody IgM/IgG;
3) detect hemorrhagic fever with renal syndrome patient antibody.
2. according to the method for the described detection nephrotic syndrome hemorrhagic fever antibody of claim 1, it is characterized in that: the enzyme labeling recombinant protein of preparation is the recombinant protein of Hantaan virus S gene expression, and its preparation technology comprises following process:
1) Bing Du cultivation and RNA extract:
The Hantaan virus S gene source of choosing is in the popular type standard virus of China's advantage strain Z10 and L99, depositary institution is prevention of CDC (CDC) virosis and control institute, Z10, L99 Strain are inoculated the Vero-E6 cell routinely, indirect immunofluorescence (IFA) is checked the cell infection degree, when 75%～100% cell has infected, collect cell, the RNeasy Mini Kit of Qiagen company is used in the extraction of cell total rna, and the step of by specification is extracted;
2) utilize the RT-PCR technology to obtain the S gene of coding destination protein:
To extract total RNA of infection cell as the synthetic cDNA of the template of reverse transcription, the primer sequence of the synthetic cDNA of reverse transcription is P14 (TAGTAGTAGACTCC), RNA Kit (AMV) kit that uses TaKaRa company is by the explanation operation, the reverse transcription product is directly used in pcr amplification, and the primer sequence P1 and the P2 of amplification Z10 strain S gene are respectively GGGGTACCGCAACTATGGAGGAACTAC and CGCTCTAGAAGTTTTAAAGGCTCTTGG; The primer sequence P3 and the P4 of pcr amplification L99 strain S gene are respectively CGCATCGATGGCAACTATGGAAGAAATC and TCGGGTACCAATTTCATAGGTTCCTGG, above-mentioned primer sequence is synthetic by Ying Jun Bioisystech Co., Ltd, and reaction conditions is: 94 ℃ of pre-sex change of 2min; 94 ℃ of 50sec, 50 ℃～62 ℃, 50～75sec, 72 ℃ of 90sec, totally 30～35 circulations; 72 ℃ are extended 5～10min, and above-mentioned pcr amplification product is through sequential analysis, and its result is consistent with the Z10 strain sequence (AF184987) and the L99 strain sequence (AF288299) of GenBank login respectively, and examining order provides service by Ying Jun Bioisystech Co., Ltd;
3) based on the structure of the Hantaan virus S gene pET-32a expression system of e. coli strain bl21:
S gene PCR purified product and pET-32a carrier with restriction endonuclease EcoRI and XhoI difference double digestion L99 Strain, S gene PCR purified product and pET-32a carrier with SacI and XhoI difference double digestion Z10 Strain, reclaim the purpose fragment, after connecting, the T4 ligase changes the competent cell of E.coliBL21 bacterial strain over to, recombinant plasmid is identified through PCR and double digestion, is obtained to contain the E.coliBL21 prokaryotic expression system of pET32a-L99S and pET32a-Z10S recombinant plasmid;
4) expression of Hantaan virus S gene recombinant protein and evaluation:
Recombinant bacterial strain is inoculated in 2～5mL contains in the LB nutrient solution of ampicillin 100 μ g/mL, 37 ℃ of shaken cultivation are to OD
600Reaching at 0.6～0.8 o'clock, is that the IPTG of 0.1～2mmol/L induced 4 hours with final concentration, and the thalline of collection is resuspended with 2 * gel sample-loading buffer, handles 1～10min for 100 ℃, makes cellular lysate, and lysate carries out the SDS-PAGE electrophoretic analysis; And employing is wet entirely or half-dried transfer printing is transferred to albumen on the nitrocellulose filter, carrying out Western-blot identifies, wherein one resists and the two anti-horseradish peroxidase mark goat anti-human iggs that are respectively HFRS patient's pooled serum and 1: 100～500PBS dilution, wherein PBS concentration is all 0.01mM in the method, pH is 7.4, SDS-PAGE result shows that the recombinant bacterial strain pET32a-L99S/E.coliBL21 of structure and pET32a-Z10S/E.coliBL21 all express a 67.1kDa destination protein, the result of Western-blot shows that for specific band appears in this recombinant protein and HV infected patient seroreaction it has good antigenicity;
5) extraction of Hantaan virus S gene recombinant protein and purifying:
With the zymocyte liquid after inducing through the centrifugal 10min of 5000r/min, collecting thalline gives a baby a bath on the third day after its birth time with the phosphate buffer (PBS) of pH7.4, bacterial sediment is resuspended with PBS, the ultrasonication thalline, 12000r/min, 4 ℃ centrifugal 1 hour, collect supernatant, use nickel ion affinity chromatographic column (Ni-NTA) purifying expressed proteins at last, collect eluent, through vacuum freeze drying, prepare the pure product of Hantaan virus S gene recombinant protein, be 95～98% through the purity of SDS-PAGE or HPLC chromatography determination recombinant protein;
6) mark of Hantaan virus S gene recombinant protein, it comprises biotin and two kinds of methods of HRP mark:
(A) implementation step of mark biotin is as follows: get the expressing protein 10～30mg behind the purifying, be dissolved in 0.05～0.2M/L NaHCO
3(pH8.5) among damping fluid 2～10mL, add activation biotin 3～5mg, stir, room temperature reaction 1～4 hour adds glycocoll 50～100mg, cessation reaction, biotin labeled recombinant protein is behind saturated ammonium sulphate 2 times, sediment is with 2～5mLPBS dissolving, and after the dialysis, vacuum freeze drying is preserved;
(B) utilize the implementation step of sodium periodate method mark HRP as follows: 1～5mg HRP to be dissolved in 1～10mL distilled water, to add freshly prepared 0.06M NaIO
4Solution 0.1～1mL, mixing is placed 30min for 4 ℃, add 0.16M ethylene glycol-NaCl solution 0.5～1mL, precooling absolute ethyl alcohol 1～10mL room temperature is placed 30min, and is centrifugal, taking precipitate makes it to dissolve fully with distilled water, be hydroformylation HRP, add the solution 1mL of 5～20mg expressing protein, mixing is also adorned bag filter, with 0.05M carbonate buffer solution pH9.5,4 ℃ are slowly stirred dialysis 6～18 hours, make it combination, and sucking-off adds NaBH then
4Or KBH
4Solution (5mg/mL) 0.05～0.2mL placed 2 hours for 4 ℃, added the equal-volume saturated ammonium sulfate, sediment is dissolved among the PBS fully, and dialysed overnight, next day is centrifugal again, remove insolubles and promptly get the enzyme labeling thing, after adding to 1～5mL and measure with PBS, vacuum freeze drying is preserved.
3. according to the method for the described detection nephrotic syndrome hemorrhagic fever antibody of claim 1, it is characterized in that: the immune magnetic microsphere that preparation is used to catch human serum antibody IgM/IgG, be that the magnetic microsphere that Chinese patent ZL03144274.9 activates is connected with goat-anti people IgM (μ chain)/goat anti-human igg's antibody, sensitization is immune magnetic microsphere; The concrete practice is: under 2～8 ℃, get the good magnetic microsphere 1～5mL of above-mentioned activation, adding is through pH9.6,0.1M goat-anti people IgM (μ chain)/goat anti-human igg 5～10mL that carbonate buffer solution diluted, fully reaction is after PBS drip washing, add 10% rabbit anteserum (RSA), 5～10mL and after 1 hour, clean the immune magnetic microsphere that can obtain being used for the IgM/IgG detection with PBS in 37 ℃ of sealings.
4. according to the method for the described detection nephrotic syndrome hemorrhagic fever antibody of claim 1, it is characterized in that: the method that detects hemorrhagic fever with renal syndrome patient antibody, concrete experimental procedure is: containing the patients serum 1mL to be measured that 15 μ L add 1: 50～100PBS dilution in by the centrifuge tube of the immune magnetic microsphere of goat-anti people IgM (μ chain)/goat anti-human igg's sensitization respectively, feminine gender and each 1mL of positive control, 37 ℃ of oscillating reactionss 1 hour, outside centrifugal tube wall, assemble fixedly microballoon with magnet, discard reactant liquor, clean repeatedly 3 times with PBS, carrying out the colour developing of enzyme indicated weight group antigen then judges, method is HRP or the biotin labeled recombinant protein 1mL that adds 80～100 times of PBS dilutions in the experiment centrifuge tube, 37 ℃ of oscillating reactionss 1 hour, the chromogenic substrate 1mL that adds new preparation after the cleaning again, reaction 10min, the visual inspection change color, blank and negative control are colourless, it is blue that positive control shows, then the result sets up, the detector tube colour developing is deeper than or equals the positive control color and shows that then experimental result is positive, and perhaps measures OD
450Value is calculated the positive that is judged to be of P/N 〉=2.1, P/N＜2.1 be judged to be feminine gender, wherein P/N=(test serum OD
450Value-blank OD
450Value)/(negative control OD
450Value-blank OD
450Value).
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200610013151 CN1811451A (en) | 2006-01-27 | 2006-01-27 | Method for detecting nephrotic syndrome hemorrhagic fever antibody |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200610013151 CN1811451A (en) | 2006-01-27 | 2006-01-27 | Method for detecting nephrotic syndrome hemorrhagic fever antibody |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN1811451A true CN1811451A (en) | 2006-08-02 |
Family
ID=36844493
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 200610013151 Pending CN1811451A (en) | 2006-01-27 | 2006-01-27 | Method for detecting nephrotic syndrome hemorrhagic fever antibody |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1811451A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101294957B (en) * | 2007-04-29 | 2012-11-14 | 郭志程 | HLA-B27 magnetic ELISA reagent kit and method for producing the same |
| CN106636139A (en) * | 2017-01-24 | 2017-05-10 | 蔡亮 | Method for preparing hantavirus S gene monoclonal antibody through cloning and expressing and application of hantavirus S gene monoclonal antibody |
| CN114561362A (en) * | 2021-12-28 | 2022-05-31 | 江西省疾病预防控制中心 | Separation method of hantavirus with hemorrhagic fever with human renal syndrome |
-
2006
- 2006-01-27 CN CN 200610013151 patent/CN1811451A/en active Pending
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101294957B (en) * | 2007-04-29 | 2012-11-14 | 郭志程 | HLA-B27 magnetic ELISA reagent kit and method for producing the same |
| CN106636139A (en) * | 2017-01-24 | 2017-05-10 | 蔡亮 | Method for preparing hantavirus S gene monoclonal antibody through cloning and expressing and application of hantavirus S gene monoclonal antibody |
| CN114561362A (en) * | 2021-12-28 | 2022-05-31 | 江西省疾病预防控制中心 | Separation method of hantavirus with hemorrhagic fever with human renal syndrome |
| CN114561362B (en) * | 2021-12-28 | 2023-12-15 | 江西省疾病预防控制中心 | Separation method of human-derived kidney syndrome hemorrhagic fever Hantaan virus |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Nadala Jr et al. | Detection of yellowhead virus and Chinese baculovirus in penaeid shrimp by the Western blot technique | |
| CN102121009B (en) | Nucleic acid aptamer specifically combined with hepatitis C virus core protein and application thereof | |
| Mazalovska et al. | Detection of serum antibodies to hepatitis E virus based on HEV genotype 3 ORF2 capsid protein expressed in nicotiana benthamiana | |
| CN111647055B (en) | N protein for detecting novel coronavirus, preparation and application thereof | |
| CN104086657B (en) | Artificial antigen for joint-detection Epstein-Barr virus Rta protein antibodies and eb early antigen EA antibody and test kit | |
| CN1712964A (en) | Specific antigenic mark for rheumatoid arthritis and its use | |
| CN1811451A (en) | Method for detecting nephrotic syndrome hemorrhagic fever antibody | |
| CN1887901A (en) | Human tumor M2-type pyruvate kinase antigen determinant polypeptide and antibody and their application in diagnositic kit | |
| Zhang et al. | Oyster heat shock protein 70 plays a role in binding of human noroviruses | |
| CN114152748A (en) | Double-antibody sandwich ELISA diagnostic kit for detecting African swine fever virus and method thereof | |
| CN111848750B (en) | Method and kit for rapidly enriching and detecting 2019-nCoV | |
| CN1687406A (en) | Monoclonal antibody, testing kit including the monoclonal antibody and application | |
| CN1916633A (en) | Method and kit for detecting treponema pallidum | |
| Lokanathan et al. | Cryptocaryon irritans recombinant proteins as potential antigens for sero‐surveillance of cryptocaryonosis | |
| CN109280644B (en) | Anti-human IgG monoclonal antibody, hybridoma cell strain and application thereof | |
| CN1928562A (en) | Enzyme linked immunoreaction reagent kit for detecting rabies virus | |
| CN101054594A (en) | Double-function fusion protein CBD-ProA carrier, immunity magnetic microsphere prepared from the same and application | |
| CN1645145A (en) | Method and reagent box for inspecting mycelian protein antibody of white candida | |
| CN1557838A (en) | SARS coronavirus nucleocapsid protein monoclonal antibody, hybridoma for producing the same, detection agent containing the same and use thereof | |
| CN105254724B (en) | Truncated-type Hepatitis C Virus HCV NS3 antigens and its preparation and application | |
| CN1292254C (en) | Reagent box for inspecting infection of swine pleuropneumonia actinomyces | |
| CN113444154A (en) | Polypeptide and application thereof in novel coronavirus detection and antibody or vaccine screening | |
| CN111398594A (en) | Immunodiagnosis kit for specifically detecting yellow fever virus NS1 antigen | |
| JP5614409B2 (en) | Recombinant antigen for detecting toxocariasis | |
| CN104897834A (en) | Method for detecting toxoplasma acute infection and target protein thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Open date: 20060802 |