CN104558121A - Tiger frog antibacterial peptide, and coding gene and application thereof - Google Patents
Tiger frog antibacterial peptide, and coding gene and application thereof Download PDFInfo
- Publication number
- CN104558121A CN104558121A CN201410852075.2A CN201410852075A CN104558121A CN 104558121 A CN104558121 A CN 104558121A CN 201410852075 A CN201410852075 A CN 201410852075A CN 104558121 A CN104558121 A CN 104558121A
- Authority
- CN
- China
- Prior art keywords
- antibacterial peptide
- mercuric chloride
- coding gene
- application
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Agricultural Chemicals And Associated Chemicals (AREA)
Abstract
The invention provides a tiger frog antibacterial peptide, and a coding gene and application thereof. The sequence of the tiger frog antibacterial peptide is as shown in SEQ ID NO: 2, and the coding gene is as shown in SEQ ID NO: 1; the tiger frog antibacterial peptide and the coding gene thereof can be used for preparing therapeutic drugs for pathogene microbe infected diseases. The tiger frog antibacterial peptide has the characteristics of being simple in structure, convenient for manual synthesis, wide in antibiotic spectrum and high in antibacterial activity.
Description
Technical field
The invention belongs to gene engineering technology field, particularly relate to a kind of Mercuric chloride antibacterial peptide and encoding gene thereof and application.
Background technology
In recent years, along with the drug-fast generation of conventional antibiotic, people start the research of growing interest antibacterial peptide.Antibacterial peptide is a class small peptide with anti-microbial activity, extensively be present in organic sphere, it is the important defensive substance of congenital immunity, there is broad-spectrum antimicrobial, antiviral, antimycotic, parasiticide and the biological activity such as antitumor, and not easily produce resistance, mechanism of action has the incomparable superiority of microbiotic, can kill the bacterium having produced resistance, and can selective killing tumour cell and do not destroy normal cell.The skin of amphibian animal defines the three cover systems of defense resisting cause pathogeny imcrobe infection in natural evolution process, and antibacterial skin peptide is the important component part of its innate immune system.Batrachians is as the ancient biology of a class, their the acquired immune system day after tomorrow is very fragile compared with Mammals, they develop and define a set of very effective system of defense resisting microbiological attack in long-term evolution course, wherein antibacterial frog skin peptide is the main component of its innate defence system, has efficient, wide spectrum, not easily produces the features such as resistance.
Find after deliberation, antibacterial peptide all has inhibition to more than 40 genus such as intestinal bacteria, Salmonellas, golden yellow suis, intestinal bacteria, streptococcus faecium, Pseudomonas aeruginosa Bacillus proteus, Streptococcus viridans, beta hemolysis suis, and part antibacterial peptide kills and wounds or killing action fungi.The antibacterial peptide magainin deriving from Africa xenopus and the antibacterial peptide maximin deriving from Chinese Bombina maxima in micro-molar concentration level just to the lethal effect of tumour cell showed different.Derive from anti-polyphemusins and tachyplesin of Japanese geneva crab hemolymph, just certain restraining effect is demonstrated to hiv virus when concentration 5 μ g/mL.The choosing coefficient deriving from antibacterial maximin 3 AIDS virus when concentration is 1.5 μ g/mL of Chinese Bombina maxima skin is 7.6.This is the AIDS virus resisting antibacterial peptide in the amphibian animal source of reported first.In addition, the antibacterial peptide dermaseptin obtained from South America Ye Pao frog skin also shows strong restraining effect to hcrpesviruses.The mellitin melitin deriving from honeybee has strong erythrolysis activity; Derive from the antibacterial peptide of amphibian animal, as the antibacterial peptide maximin H of Chinese Bombina maxima and the antibacterial peptide bombinH of Bombina orientalis also show strong erythrolysis activity.MaximinH just can cause the dissolving of rabbit erythrocyte 100% when 50 μ g/m L.The antibacterial peptide pseudin obtained from amphibian animal Pseudisparadoxa has regulating effect to the apoptosis controlling the change of tadpole Tail Morphology of Adult.Pseudin structurally demonstrates very high similarity with one section of region of a kind of apoptosis factor DEFY.
Mercuric chloride resource is utilized to carry out the cDNA clone of Mercuric chloride antibacterial peptide gene, the research of sequential analysis, if the biologically active substance with important value can be obtained from Mercuric chloride skin, the exploitation of Mercuric chloride will be widened, utilize new way, have important practical significance, arouse people to batrachians skin bioreactivity peptide simultaneously, especially the multifarious concern of the particular molecule of China's characteristic species, and pay attention to they biology, biomedical fundamental research and natural drug exploitation in meaning.
Summary of the invention
Main purpose of the present invention is to provide a kind of Mercuric chloride antibacterial peptide.
Object one of of the present invention is the encoding gene providing above-mentioned Mercuric chloride antibacterial peptide.
Object one of of the present invention provides above-mentioned Mercuric chloride antibacterial peptide as the application in the medicine preparing cause pathogeny imcrobe infection disease.
Another object of the present invention is to provide the application of the encoding gene of Mercuric chloride antibacterial peptide in treatment cause pathogeny imcrobe infection disease.
The present invention is achieved in that a kind of Mercuric chloride antibacterial peptide, and its sequence is as shown in SEQ ID NO:2.Wherein, the Mercuric chloride antibacterial peptide (Frog1-albumen) in the present invention is a kind of single chain polypeptide of Chinese amphibian animal Mercuric chloride genes encoding, molecular weight 1367.673Da, iso-electric point 6.04.
Invention further provides the encoding gene of above-mentioned Mercuric chloride antibacterial peptide, its sequence is as shown in SEQ ID NO:1.The full amino acid sequence of this encoding gene is as shown in SEQ ID NO:3, and wherein, described Mercuric chloride antibacterial peptide is 177th ~ 213 Nucleotide of this encoding gene.
Invention further provides above-mentioned Mercuric chloride antibacterial peptide as the application in the medicine preparing cause pathogeny imcrobe infection disease, and the application of the encoding gene of Mercuric chloride antibacterial peptide in treatment cause pathogeny imcrobe infection disease.
The present invention overcomes the deficiencies in the prior art, a kind of Mercuric chloride antibacterial peptide and encoding gene thereof and application are provided, by to Mercuric chloride antibacterial peptide Total RNAs extraction, RNA concentration determination, RNA reverse transcription, design of primers and pcr amplification screening Mercuric chloride antibacterial peptide, RACE amplification Mercuric chloride antibacterial peptide gene 3 ' end and the 5 ' design of primers etc. of holding, obtain the Mercuric chloride antibacterial peptide that Mercuric chloride antibacterial peptide gene is extremely encoded.Wherein, Mercuric chloride antibacterial peptide gene amplimer is:
CaSPI-F：5’-ATGTTCACCATGAAGAAATCCCT-3’，
CaSPI-R：5’-ATTCTACAGGCCGAGGCGGCCGACATG-3’。
The positive monoclonal that obtains carries out gene nucleotide series mensuration, Mercuric chloride antibacterial peptide encoding gene is as shown in SEQID NO:1, and Mercuric chloride antibacterial peptide is as shown in SEQ ID NO:2, and Mercuric chloride antibacterial peptide is a kind of single chain polypeptide, molecular weight 1367.673Da, iso-electric point 6.04.The full amino acid sequence of Mercuric chloride antibacterial peptide encoding gene is as shown in SEQ ID NO:3, and wherein, described Mercuric chloride antibacterial peptide is 177th ~ 213 Nucleotide of this encoding gene.
Mercuric chloride antibacterial peptide gene is as the application of preparation Mercuric chloride antibacterial peptide.
Compared to the shortcoming and defect of prior art, the present invention has following beneficial effect: the present invention utilizes bioinformatics method to derive its ripe antibacterial peptide amino acid primary sequences by Mercuric chloride antibacterial peptide encoding gene, and the Mercuric chloride antibacterial peptide of synthetic has significant anti-microbial effect; Mercuric chloride antibacterial peptide of the present invention has the advantages that structure is simple, synthetic convenient, antibacterial pedigree is wide, anti-microbial activity is strong.
Accompanying drawing explanation
Fig. 1 is 3 ' RACE pcr amplification product qualification electrophorogram in the embodiment of the present invention.
Embodiment
In order to make object of the present invention, technical scheme and advantage clearly understand, below in conjunction with drawings and Examples, the present invention is further elaborated.Should be appreciated that specific embodiment described herein only in order to explain the present invention, be not intended to limit the present invention.
The clone of embodiment 1 Mercuric chloride antibacterial peptide gene
1, Mercuric chloride skin mucus Total RNAs extraction
Extract centrifuge tube used, rifle head, gun case etc. all to spend the night and autoclaving process through 0.1%DEPC water soaking, mortar used, glass homogenizer, tweezers and scissors are all through 180 DEG C of pyroprocessing 2.5h.
Concrete operation step is:
Get Mercuric chloride skin mucus sample to be about 100mg and to add liquid nitrogen grinding powdered, pour in glass homogenizer
↓ add the further ground sample of 1ml Trizol Reagent
Homogenised sample is transferred to 1.5mlEP and manages (DEPC pipe) 15 ~ 30 DEG C placement 5min
↓ add 200 μ l chloroforms, thermal agitation 3min, 4 DEG C, the centrifugal 15min of 12000 × g
Draw supernatant to new centrifuge tube add isopyknic Virahol with supernatant, room temperature leaves standstill 10min
↓ 4 DEG C, the centrifugal 10min of 12000 × g
Abandon supernatant and add 1ml 75% ethanol purge precipitation
↓ 4 DEG C, the centrifugal 10min of 7500 × g
Abandon supernatant, room temperature is placed dry, and add DEPC water 20 ~ 50 μ l and dissolve ,-70 DEG C save backup.
2, RNA concentration determination:
The total serum IgE getting the above-mentioned DEPC of the being dissolved in water of 1 μ l is placed in Nanodrop 2000c and measures RNA concentration.Be 1 μ g according to added RNA template consumption during surveyed RNA concentration adjustment reverse transcription.
3, RNA reverse transcription:
Prepare cDNA building-up reactions system according to following and carry out reverse transcription reaction.
Reaction conditions:
42℃1h
↓
70℃15min
After reaction terminates, reaction solution is stored in-20 DEG C and is used for pcr amplification.
4, design of primers and pcr amplification condition:
According to homology species encodes district's conserved sequence and N-terminal sequencing results such as the batrachias of having announced in GenBanK, utilize Premier 5.0 software design upstream and downstream primer.
KFB-F：TGTAGGTGCCAAGGGTAG
KFB-R：TGAACAGGTCCACAGAGC
Primer is synthesized by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.
With antibacterial peptide cDNA for template, carry out pcr amplification, PCR amplification system is as following table:
5, agarose gel electrophoresis:
According to isolation of DNA fragments size, prepare 1% sepharose with 1 × TAE, adding EB when heating and melting is cooled to about 50 DEG C in microwave oven to final concentration is 0.5 μ g/ml, fully pours on the glue plate of miniature electrophoresis chamber by gel after mixing, after cooled and solidified, gel is put into electrophoresis chamber.The sample getting appropriate amount mixes with 6 × electrophoresis sample-loading buffer, uses a certain size DNA Marker during loading.Electrophoretic buffer is 1 × TAE, and voltage is chosen as 120V, stops electrophoresis, observe under ultraviolet transilluminator when tetrabromophenol sulfonphthalein indicating strip moves to gel 2/3 position.
6, DNA gel purifying:
Use Shanghai raw work SanPrep pillar DNA glue to reclaim test kit and reclaim object fragment, concrete steps are as follows:
(1) agarose gel electrophoresis detects also rubber tapping recovery object bar rapidly and brings to 1.5ml centrifuge tube.
(2) the Buffer B2 of blob of viscose weight 3 times is added, 50 DEG C of water-bath 5 ~ 10min colloidal sols.
(3) move in adsorption column by sol solutions, the centrifugal 30s of 8000 × g, outwells liquid in collection tube.
(4) add 500 μ l Wash Solution, the centrifugal 30s of 9000 × g, outwells liquid in collection tube.
(5) repeating step (4) once.
(6) suction attached column is in the centrifugal 1min of 9000 × g.
(7) adsorption column is put into a clean 1.5ml centrifuge tube, add 15 ~ 4l μ Elution Buffer in adsorption film central authorities, after room temperature leaves standstill 1min, centrifugal 1min.Preserve DNA solution in pipe for subsequent use in-20 DEG C.
7, ligation:
By following condition connect in 0.5ml centrifuge tube reaction system and 16 DEG C reaction 4h, connecting fluid be used for transform.10 μ l ligation systems are as follows:
8, the competence preparation of bacillus coli DH 5 alpha:
(1) get the E.coli BL21 bacterium liquid preserved in-80 DEG C of glycerine with the direct libation at an ancient wedding ceremony of aseptic platinum filament, in the line of LB planar surface, be inverted overnight incubation for 37 DEG C;
(2) from picking list bacterium colony LB flat board, be inoculated in 5ml LB liquid nutrient medium, 37 DEG C, 200rmp shakes overnight incubation;
(3) get the bacterium liquid of 100 μ l activated overnight, in access 5ml LB fresh culture, 200rpm 37 DEG C vibrate about 2.5h, to the visible muddiness slightly of naked eyes.
(4) nutrient solution is proceeded to 1.5ml centrifuge tube, ice bath 10min, 4 DEG C of centrifugal 10min of 4000rpm.
(5) abandon supernatant, collect thalline, add the 1.0ml 0.1M CaCl2 of precooling, gently hang, ice bath 10min, 4 DEG C of centrifugal 10min of 4000rpm.
(6) abandon supernatant, add 100 μ l 0.1M CaCl2 (precooling), gently hang, ice bath is at least available after 4h, if think long-term preservation, add sterile glycerol to final concentration 15%, in-70 DEG C of preservations.
9, product conversion is connected:
(1) full dose (10 μ l) is added in 100 μ l competent cells, places 30min in ice.
After (2) 42 DEG C of heating 45s, then place 1min in ice.
(3) 890 μ l LB liquid nutrient mediums are added, 37 DEG C of 200rpm shaking culture 60min.
(4) the centrifugal 1min of 4000rpm, abandons supernatant, stays bacterium liquid, and piping and druming suspends.
(5) be spread evenly across on the LB solid medium flat board containing X-Gal, IPTG, Amp and cultivate.
About 1h is placed in (6) 37 DEG C of incubator fronts, after bacterium liquid is absorbed by substratum completely, is inverted overnight incubation to forming the visible single bacterium colony of naked eyes for 37 DEG C.
(7) the some single colony inoculations of random choose to contain in corresponding antibiotic LB liquid nutrient medium 37 DEG C in 5ml, and 200rmp shaking table is cultivated 4 ~ 6h and is used for bacterium liquid PCR and identifies.
10, bacterium liquid PCR identifies:
With the bacterium liquid cultivated for template, carry out pcr amplification, reaction system is as following table:
amplified production is identified through 1% agarose gel electrophoresis.The correct bacterium liquid of qualification is delivered to Shanghai Sani biotech firm and carries out DNA sequencing.
11, in RACE amplification Mercuric chloride skin mucus, antibacterial peptide gene 3 ' is held and the 5 ' design of primers of holding:
The specificity inner primer of 3 '-RACE and 5 '-RACE is used for according to the part antibacterial peptide gene sequences Design obtained:
5 ' inner primer: CaSPI-F (1): GGGTCTTGATAGATGTCATAGCG
3 ' inner primer: CaSPI-R (1): CTTCAGCGTTGACTTCTCCA
Primer is synthesized by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.In addition, primer:
3’race outer primer(1)：5′-taccgtcgttccactagtgattt-3′
5’race outer primer(1)：5′-catggctacatgctgacagccta-3′
3’race inner primer(2)：5′-cgcggatcctccactagtgatttcactatagg-3′
5’race inner primer(2)：5′-cgcggatccacagcctactgatgatcagtcgatg-3’
Come from TaKaRa 3 '-Full RACE Core Set Ver.2.0 and 5 '-Full RACE Kit respectively.
12、3’RACE：
Utilize TaKaRa 3 '-Full RACE Core Set Ver.2.0 can by known cDNA sequence, highly sensitive, to increase the full length sequence of 3 ' end of cDNA with high specificity.Specific experiment working method is as follows:
(1) reverse transcription reaction.Reaction system and reaction conditions as follows:
Reaction conditions:
42℃1h
↓
70℃15min
For carrying out next step experiment after reaction terminates.
(2) sleeve type PCR reaction
Outer PCR reacts
The experimental implementation using TaKaRa LA Taq to carry out when Outer PCR reacts is as follows:
1) after PCR reaction terminates, the PCR reaction solution getting 5 ~ 10 μ l carries out agarose gel electrophoresis, confirms pcr amplification product.And carry out Inner PCR reaction.
2) Inner PCR reacts.Reaction system and reaction conditions as follows:
(3) agarose gel electrophoresis
After reaction terminates, the PCR reaction solution getting 5 ~ 10 μ l carries out agarose gel electrophoresis, confirms 3 ' RACEPCR amplified production.
(4) sequencing analysis
DNA sequencing (specific experiment operation steps is identical with abovementioned steps 6 ~ 10) will be carried out again after the object product cloning of pcr amplification to pMD-18T carrier.
13、5’RACE：
Utilize 5 '-Full RACE Kit amplification 5 ' end DNA sequence dna, comprise following concrete steps:
(1) phosphatizing treatment.
Alkaline Phosphatase (CIAP) is used to carry out dephosphorization acid-respons to 5 ' phosphate group exposed in Total RNA.
1) by following component preparation dephosphorization acid-respons liquid.
2) 50 DEG C of reaction 1h.
3) in above-mentioned reaction solution, the 3M CH3COONa (pH5.2) of 20 μ l is added, the RNaseFree dH of 130 μ l
2after O, fully mix.
4) phenol/chloroform/primary isoamyl alcohol (25:24:1) of 200 μ l is added, fully the centrifugal 5min of 13000 × g room temperature after mixing, by upper water phase transition in new Microtube.
5) chloroform of 200 μ l is added, fully the centrifugal 5min of 13000 × g room temperature after mixing, by upper water phase transition in new Microtube.
6) Homogeneous phase mixing after the NA Carrier of 2 μ l is added.
7) Virahol of 200 μ l is added, fully after mixing, cooled on ice 10min.
8) 13000 × g, 4 DEG C of centrifugal 20min, abandon supernatant.
9) 70% cold ethanol (the RNase Free dH of 500 μ l is added
2o prepares) rinsing, 13000 × g, 4 DEG C of centrifugal 5min are dry after abandoning supernatant.
10) the RNase Free dH of 7 μ l is added
2o dissolution precipitation, obtains CIAP-treated RNA.
(2) " remove cap " to react.
Use Tobacco Acid Pyrophosphatase (TAP) to remove the 5 ' cap sequence of mRNA, retain a phosphate group.
1) by following component preparation " removing cap " reaction solution.
2) 37 DEG C are reacted 1 hour.
3) this reaction solution is CIAP/TAP-treated RNA.Get 5 μ l for 5 ' RACE Adaptor ligation, remaining 5 μ l are stored in-80 DEG C.
The connection of (3) 5 ' RACE Adaptor.
1) first following solutions is prepared
2) 65 DEG C of insulations placed 2 minutes on ice after 5 minutes, then added following reagent
3) 16 DEG C of reaction 1h.
4) in above-mentioned reaction solution, add the 3M CH of 20 μ l
3cOONa (pH5.2), the RNaseFree dH of 140 μ l
2after O, fully mix.
5) phenol/chloroform/primary isoamyl alcohol (25:24:1) of 200 μ l is added, fully the centrifugal 5min of 13000 × g room temperature after mixing, by upper water phase transition in new Microtube.
6) chloroform of 200 μ l is added, fully the centrifugal 5min of 13000 × g room temperature after mixing, by upper water phase transition in new Microtube.
7) Homogeneous phase mixing after the NA Carrier of 2 μ l is added.
8) Virahol of 200 μ l is added, fully after mixing, cooled on ice 10min.
9) 13000 × g, 4 DEG C of centrifugal 20min, abandon supernatant.Add 70% cold ethanol (the RNase FreedH of 500 μ l
2o prepares) rinsing, 13000 × g, 4 DEG C of centrifugal 5min are dry after abandoning supernatant.
10) the RNase Free dH of 6 μ l is added
2o dissolution precipitation, obtains Ligated RNA.
(4) reverse transcription reaction.
1) by following component preparation inverse transcription reaction liquid.
2) reverse transcription reaction condition is as follows:
30℃10min
↓
42℃1h
↓
70℃15min
3) reaction can carry out next step experiment after terminating.
(5) Outer PCR reacts
(6) Inner PCR reacts
(7) agarose gel electrophoresis
After reaction terminates, the PCR reaction solution getting 5 ~ 10 μ l carries out agarose gel electrophoresis, and as shown in Figure 1, in Fig. 1, M is DL2000 nucleic acid molecular weight standard, and l and 2 is amplified production.3 ' RACE pcr amplification product can be confirmed from Fig. 1.
(8) sequencing analysis
DNA sequencing (specific experiment operation steps is identical with abovementioned steps 6 ~ 10) will be carried out again after the object product cloning of pcr amplification to pMD-18T carrier.
14, Mercuric chloride antibacterial peptide gene sequencing and result:
Extract plasmid DNA dideoxy method and measure nucleotide sequence, use instrument is the full-automatic nucleotide sequencing instrument of Appliedbiosystems373A.The result of genetic testing, as shown in SEQ ID NO:1, utilizes bioinformatics method derivation synthetic, and the Mercuric chloride antibacterial peptide proteins encoded of antibacterial experiment checking (as embodiment 2) is as shown in SEQ ID NO:2.The sequence of Mercuric chloride antibacterial peptide gene Nucleotide shows as: sequence length is 331 bases, sequence type: nucleic acid, chain number: strand, topology: straight-chain, sequence kind: cDNA, source: Mercuric chloride skin mucus.What encode Mercuric chloride antibacterial peptide mature sequence is Mercuric chloride antibacterial peptide gene 177 ~ 213 Nucleotide, and its nucleotide sequence is as shown in SEQ ID NO:3, and this Mercuric chloride antibacterial peptide gene is as the application of preparation Mercuric chloride antibacterial peptide.
Embodiment 2 Mercuric chloride antibacterial peptide (CaSPI) anti-microbial activity detects and minimal inhibitory concentration is determined
Test strain: intestinal bacteria Escherichia coli, streptococcus aureus Staphylococcus aureus, subtilis Bacillus dysenteriae, above bacterial classification all has laboratory to preserve.R V C A S F P L P I C Y sequent synthesis pressed by antibacterial tests Mercuric chloride antibacterial peptide sample, presses 2mg/mL concentration, be mixed with solution, put-20 DEG C of refrigerators for subsequent use with 0.1M sodium hydrogen phosphate salt buffer solution (PH 6.0) after sample synthesis.
The bacterium liquid 100 μ L getting incubated overnight is spread evenly across LB solid state rheology primary surface, the sterilized filter paper of 0.5cm diameter is put at media surface cruciform, each filter paper adds respectively the Mercuric chloride antibacterial peptide sample that 20 μ L synthesize, contrast with equivalent 0.1M sodium hydrogen phosphate salt buffer solution (PH 6.0).Then, be inverted cultivation 20 hours for 37 DEG C, observe and whether have inhibition zone to be formed.What have inhibition zone to be formed shows there is anti-microbial activity, carries out the mensuration of minimal inhibitory concentration further.
When measuring minimal inhibitory concentration, by the antibacterial detection method of standard, using LB liquid nutrient medium as developing medium.Bacterial classification after picking activates in right amount, in LB liquid nutrient medium, is cultivated 20 hours for 37 DEG C.Get a certain amount of LB liquid nutrient medium, add a certain amount of sample being dissolved in 0.1M sodium hydrogen phosphate salt buffer solution (PH 6.0) through 0.22cm aperture membrane filtration again, a series of concentration gradient is diluted to according to doubling dilution, cultivate 20 hours for 37 DEG C, measure photoabsorption in 600nm wavelength place.Minimal inhibitory concentration is cannot see the minimum sample concentration of bacterial growth.Sample protein concentration adopts following formula to calculate:
Protein concentration(mg/mL)＝(A215nm-A225nm)(0.144。
Antibacterial Establishing is as follows, the sample being dissolved in 0.1M sodium hydrogen phosphate salt buffer solution (PH 6.0) through 0.22cm aperture membrane filtration is added in 1.9mL substratum, 0.1mL is as the first pipe, get 1mL after mixing and add the 2nd pipe, doubling dilution successively, discard from the 8th pipe sucking-off 1mL, the 9th piping control tube, as shown in the table:
Bacterium liquid (105cfu/mL) 0.05mL corrected will be added in each pipe, and place 37 DEG C after mixing and cultivate 18h, measure photoabsorption in 600nm wavelength place.Minimal inhibitory concentration is cannot see the minimum sample concentration of bacterial growth.Sample protein concentration adopts following formula to calculate:
Protein concentration(mg/mL)＝(A215nm-A225nm)(0.144。
Antibacterial detected result shows, the Mercuric chloride antibacterial peptide CaSPI of synthesis all has anti-microbial activity to test strain, and CaSPI is weaker than subtilis to colibacillary suppression, is better than streptococcus aureus.
The minimal inhibitory concentration result of Mercuric chloride antibacterial peptide CaSPI is as shown in the table:
The foregoing is only preferred embodiment of the present invention, not in order to limit the present invention, all any amendments done within the spirit and principles in the present invention, equivalent replacement and improvement etc., all should be included within protection scope of the present invention.
Claims (4)
1. a Mercuric chloride antibacterial peptide, is characterized in that, its sequence is as shown in SEQ ID NO:2.
2. the encoding gene of Mercuric chloride antibacterial peptide according to claim 1, is characterized in that, its sequence is as shown in SEQ ID NO:1.
3. Mercuric chloride antibacterial peptide according to claim 1 is as the application in the medicine preparing cause pathogeny imcrobe infection disease.
4. the application of encoding gene in treatment cause pathogeny imcrobe infection disease of Mercuric chloride antibacterial peptide according to claim 2.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410852075.2A CN104558121B (en) | 2014-12-31 | 2014-12-31 | A kind of Mercuric chloride antibacterial peptide and its encoding gene and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410852075.2A CN104558121B (en) | 2014-12-31 | 2014-12-31 | A kind of Mercuric chloride antibacterial peptide and its encoding gene and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104558121A true CN104558121A (en) | 2015-04-29 |
| CN104558121B CN104558121B (en) | 2018-11-16 |
Family
ID=53075277
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410852075.2A Active CN104558121B (en) | 2014-12-31 | 2014-12-31 | A kind of Mercuric chloride antibacterial peptide and its encoding gene and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104558121B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105085645A (en) * | 2015-07-13 | 2015-11-25 | 昆明医科大学 | Antibacterial peptide SibaCec-A of Simulium bannaense and gene and application of antibacterial peptide |
| CN105175523A (en) * | 2015-07-13 | 2015-12-23 | 昆明医科大学 | Simulium bannaense antibacterial peptide SibaCec, and genes and applications thereof |
| CN106478811A (en) * | 2016-10-20 | 2017-03-08 | 南方医科大学 | Mercuric chloride protease inhibitory peptides and its gene and the application in pharmacy |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1803834A (en) * | 2006-01-12 | 2006-07-19 | 南京农业大学 | Antibacterial peptide of brown-spotted torrential frog, its gene and application in drug preparation |
| WO2007133033A1 (en) * | 2006-05-16 | 2007-11-22 | Promeditech, Inc. | Novel analogues of antimicrobial and anticancer peptide synthesized and produced from gaegurin 5 |
-
2014
- 2014-12-31 CN CN201410852075.2A patent/CN104558121B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1803834A (en) * | 2006-01-12 | 2006-07-19 | 南京农业大学 | Antibacterial peptide of brown-spotted torrential frog, its gene and application in drug preparation |
| WO2007133033A1 (en) * | 2006-05-16 | 2007-11-22 | Promeditech, Inc. | Novel analogues of antimicrobial and anticancer peptide synthesized and produced from gaegurin 5 |
Non-Patent Citations (2)
| Title |
|---|
| KORRAPATI PURNA SAI,ET AL.: "Tigerinins: Novel Antimicrobial Peptides from the Indian Frog Rana tigerina", 《THE JOURNAL OF BIOLOGICAL CHEMISTRY》 * |
| 王辉等: "虎纹蛙皮肤组织cDNA文库的构建及抗菌肽基因tigerinin-HRs的克隆", 《华北农学报》 * |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105085645A (en) * | 2015-07-13 | 2015-11-25 | 昆明医科大学 | Antibacterial peptide SibaCec-A of Simulium bannaense and gene and application of antibacterial peptide |
| CN105175523A (en) * | 2015-07-13 | 2015-12-23 | 昆明医科大学 | Simulium bannaense antibacterial peptide SibaCec, and genes and applications thereof |
| CN105085645B (en) * | 2015-07-13 | 2018-03-16 | 昆明医科大学 | Version receives rope buffalo gnat antibacterial peptide SibaCec A and its gene and application |
| CN105175523B (en) * | 2015-07-13 | 2018-04-06 | 昆明医科大学 | Version receives rope buffalo gnat antibacterial peptide SibaCec and its gene and application |
| CN106478811A (en) * | 2016-10-20 | 2017-03-08 | 南方医科大学 | Mercuric chloride protease inhibitory peptides and its gene and the application in pharmacy |
| CN106478811B (en) * | 2016-10-20 | 2020-04-17 | 南方医科大学 | Giant knotweed frog protease inhibitory peptide, gene thereof and application thereof in pharmacy |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104558121B (en) | 2018-11-16 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| RU2013117275A (en) | BACTERIOPHAGES, PHAGE PEPTIDES AND WAYS OF THEIR APPLICATION | |
| RU2011134315A (en) | BACTERIOPHAGES, PROTEINS OF BACTERIOPHAGES AND METHODS OF APPLICATION | |
| CN101412753A (en) | Bungarus fasciatus antibacterial peptide cathelicidin-BF, and genes and uses thereof | |
| Cha et al. | Molecular cloning, expression of a galectin gene in Pacific white shrimp Litopenaeus vannamei and the antibacterial activity of its recombinant protein | |
| CN107779439A (en) | New staphylophage and combinations thereof, preparation method and application | |
| CN103122347B (en) | Lyase for killing staphylococcus and application of lyase | |
| CN104558121A (en) | Tiger frog antibacterial peptide, and coding gene and application thereof | |
| Yang et al. | Characterization of grass carp (Ctenopharyngodon idella) beta-defensin 1: implications for its role in inflammation control | |
| CN101450966A (en) | Polypeptide of antimicrobial agent and use | |
| CN104031135B (en) | Rhacophorus defense peptides PopuDef and gene thereof and application | |
| CN104177485B (en) | A kind of Chinese alligator cecropin A lligatorin6 and its application | |
| CN104805066B (en) | A kind of staphylolytic enzyme and its application | |
| CN102121020A (en) | Gene complete sequence of siganus oramin L-amino acid oxidase and application thereof | |
| CN102250217A (en) | Hyla simplex skin injury repair promotion polypeptides and genes as well as application thereof | |
| CN110305193B (en) | Anti-porphyromonas gingivalis polypeptide and application thereof | |
| Peng et al. | Tissue distribution, expression, and antimicrobial activity of Anas platyrhynchos avian β-defensin 6 | |
| CN103224956A (en) | Type-II adeno-associated virus carrying neuritin genes and application thereof in restoring optic nerve injuries | |
| CN111053890B (en) | Application of galectin-8 from mandarin fish in preparing bacteriostatic agent | |
| CN102516382B (en) | Antimicrobial peptide Hainanenin-5 of Amolops hainanensis, gene of antimicrobial peptide Hainanenin-5 of Amolops hainanensis, and application of gene of antimicrobial peptide Hainanenin-5 of Amolops hainanensis | |
| CN101845092A (en) | Antimicrobial peptide Ea-CATH1 of Equus asinus and genes and application thereof | |
| CN102940874B (en) | Application of small molecular polypeptide CW14 in preparation of goat antibacterial medicament | |
| CN102115496A (en) | Antimicrobial peptide Pc-CATH1 and gene thereof, chemical synthesis method and application thereof | |
| CN103467580A (en) | Preparation method and application of artificial antimicrobial peptide MA-D4 | |
| CN103233019A (en) | Genetically engineered bacterium for efficiently expressing recombinant bacteriocin and construction method and application thereof | |
| CN117603328A (en) | Ras related protein and application thereof in resisting streptococcal infection of tilapia |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| CB03 | Change of inventor or designer information |
Inventor after: Han Yaoping Inventor after: Liang Hualiang Inventor after: Hu Yan Inventor after: Yang Shuting Inventor after: Wang Li Inventor after: Wang Haiyan Inventor after: Shi Mengqian Inventor after: Zeng Qingrui Inventor after: Kuai Qiang Inventor before: Liang Hualiang Inventor before: Hu Yan Inventor before: Yang Shuting Inventor before: Wang Li Inventor before: Wang Haiyan Inventor before: Shi Mengqian Inventor before: Zeng Qingrui Inventor before: Kuai Qiang |
|
| COR | Change of bibliographic data | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |