CN105175523B - Version receives rope buffalo gnat antibacterial peptide SibaCec and its gene and application - Google Patents
Version receives rope buffalo gnat antibacterial peptide SibaCec and its gene and application Download PDFInfo
- Publication number
- CN105175523B CN105175523B CN201510407103.4A CN201510407103A CN105175523B CN 105175523 B CN105175523 B CN 105175523B CN 201510407103 A CN201510407103 A CN 201510407103A CN 105175523 B CN105175523 B CN 105175523B
- Authority
- CN
- China
- Prior art keywords
- antibacterial peptide
- sibacec
- version
- buffalo gnat
- rope
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/43504—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates
- C07K14/43563—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from insects
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- A61K38/1767—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Zoology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Gastroenterology & Hepatology (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Animal Behavior & Ethology (AREA)
- Insects & Arthropods (AREA)
- Epidemiology (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Pharmacology & Pharmacy (AREA)
- Tropical Medicine & Parasitology (AREA)
- Toxicology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Genetics & Genomics (AREA)
- Molecular Biology (AREA)
- Engineering & Computer Science (AREA)
- Peptides Or Proteins (AREA)
Abstract
Rope buffalo gnat antibacterial peptide SibaCec and its gene and application is received the present invention relates to a kind of version, belongs to field of biomedicine technology.Version receive rope buffalo gnat antibacterial peptide SibaCec be straight-chain polypeptide, be SEQ ID NO containing 34 amino acid residues, the dalton of molecular weight 3432.12, isoelectric point 10.73, its amino acid sequence:Shown in 1.Coding version receive rope buffalo gnat antibacterial peptide SibaCec precursors gene GenBank accession KT223121 be made up of 272 nucleotide sequences, nucleotides sequence is classified as SEQ ID NO:Shown in 2;The encoding gene that wherein the 70th -171 nucleotides is ripe antibacterial peptide SibaCec.Version receives applications of the rope buffalo gnat antibacterial peptide SibaCec as the medicine for preparing cause pathogeny imcrobe infection disease.The beneficial effects of the present invention are:A kind of new buffalo gnat antibacterial peptide with broad spectrum antimicrobial (gramnegative bacterium) is provided, the antibacterial peptide has the function that significant bacteria growing inhibiting, can be in the application in preparing the medicine to be caught as caused by Escherichia coli, Pseudomonas aeruginosa, salmonella typhimurium and Acinetobacter baumannii.
Description
Technical field:
Rope buffalo gnat (Simulium bannaense) antibacterial peptide SibaCec and its base is received the present invention relates to a kind of hematophagus version
Cause and application, belong to field of biomedicine technology.
Background technology:
Currently drug resistance problems are increasingly serious as caused by antibiotic, antimicrobial (antibacterial peptide) medicine of polypeptide it is potential
Application value causes the research interest of various countries scientific research personnel.Antibacterial peptide is a kind of new antimicrobial polypeptide, most of anti-
Bacterium peptide is made up of 5-50 amino acid residue, rich in hydrophobic bases, can form amphipathic structure, molecular weight is less than 10000
Dalton.Research shows, antibacterial peptide can quickly kill at low concentrations various Gram-positives and negative bacteria, fungi and
The microorganisms such as parasite, and kinds of tumor cells can be killed, suppress the duplication and diffusion of virus.In addition, they are also without cause
Distortion acts on, no cumulative toxicity, it is not easy to develop immunity to drugs.Some antibacterial peptides come into the clinical verification stage, the results showed that
Antibacterial peptide is all effective in cure for local infection and general infection, has a good application prospect.
Insect is biotic population maximum on the earth, and in addition to ocean, remaining all ecological environment has the distribution of insect.
Insect has highly single-minded acquired immune system unlike higher mammal, i.e., lacks T and bone-marrow-derived lymphocyte in insect bodies
System, also without immune globulin bletilla complement system.But population still to be occupied among the natural evolution of several hundred million years excellent for insect
Gesture, show that it there should be very powerful innate immune system so that insect can resist the invasion and attack of many microorganisms in environment.
Research shows, the innate immune system of insect can rapid, high volume synthesize the various diseases that a variety of antibacterial peptides directly kill invasion body
Bacterium.In addition, they can also play various defense functions indirectly by participating in, adjusting the immune system of body.At present, from difference
Insect bodies in the potential antibiotic substitute of screening be current educational circles study hotspot.These antibacterial peptides have different structures
And antibacterial activity, it is the treasure-house that novel polypeptide class antimicrobial agents are developed.Version receives rope Simulium in Insecta Diptera Simulidae buffalo gnat
Category, is distributed mainly on Yunnan Province of China and saves the domestic stream of Xishuangbanna autonomous prefecture, and its internal antibiotic active molecular is still at present
Have no report.
The content of the invention:
Rope is received it is an object of the invention to provide a kind of new version with broad spectrum antimicrobial (gramnegative bacterium)
Buffalo gnat antibacterial peptide and its gene and application.
It is that Chinese hematophagus version receives the one of rope buffalo gnat antibacterial peptide gene coding that the version of the present invention, which receives rope buffalo gnat antibacterial peptide SibaCec,
Kind straight-chain polypeptide, contains 34 amino acid residues, the dalton of molecular weight 3432.12, isoelectric point 10.73.Polypeptide complete sequence one-level
Structure (amino acid sequence SEQ ID NO:1) it is:
Gly1-Lys2-Leu3-Thr4-Lys5-Asp6-Lys7-Leu8-Lys9-Arg10-Gly11-Ala12-Lys13-Lys14-
Ala15-Leu16-Asp17-Val18-Ala19-Ser20-Lys21-Val22-Ala23-Pro24-Ile25-Val26-Ala27-Ala28-
Gly29-Ala30-Ser31-Ile32-Ala33-Arg34。
Coding version receive rope buffalo gnat antibacterial peptide SibaCec precursors gene by 272 nucleotides (SEQ ID NO:2) form
(GenBank accession KT223121), it is from 5 ' end to 3 ' terminal sequences:
The encoding gene that wherein the 70th -171 nucleotides is ripe antibacterial peptide SibaCec.
The present invention version receive rope buffalo gnat antibacterial peptide SibaCec prepare by Escherichia coli, Pseudomonas aeruginosa, salmonella typhimurium
With Acinetobacter baumannii caused by application in the medicine that catches.
The beneficial effects of the present invention are:A kind of new resisting with broad spectrum antimicrobial (gramnegative bacterium) is provided
Bacterium peptide, the antibacterial peptide have the function that significant bacteria growing inhibiting, can be hindered preparing by Escherichia coli, Pseudomonas aeruginosa, mouse
Application in the medicine of infectious disease caused by cold salmonella and Acinetobacter baumannii.
Embodiment:
The essentiality content of the present invention is further illustrated with embodiment below, but present disclosure is not limited to
This.
Embodiment one, version receive rope buffalo gnat antibacterial peptide SibaCec precursors gene cloning
(1), version receive rope buffalo gnat salivary gland Total RNAs extraction:
A. version receives rope buffalo gnat in disecting microscope Xia Qu salivary organizations, accumulates 300mg samples, adds 3mlTrizol solution,
It is homogenized 30 minutes in 20ml glass homogenizers.
B. isometric phenol/chloroformic solution is added, is acutely mixed, room temperature is placed 10 minutes, and 4 DEG C, 12000rpm centrifuges 10 points
Clock, reject precipitation.
C. supernatant adds isometric isopropanol, and room temperature is placed 10 minutes, 4 DEG C, 12000rpm, centrifuged 10 minutes, precipitation
Washed once, dried with 75% ethanol, ttom of pipe sediment be version receive rope buffalo gnat salivary gland total serum IgE.
(2), version receives rope buffalo gnat salivary gland mRNA purifying:
Version receive rope buffalo gnat salivary gland mRNA isolate and purify using PROMEGA companies of the U.S.mRNA
Isolation Systems kits.
A. the version extracted is received rope buffalo gnat salivary gland total serum IgE and is dissolved in 500 μ l DEPC water, is put into 65 DEG C of water-baths 10 minutes, adds people
3 μ l Oligo (dT) probes and 13 μ l 20 × SSC solution, mix, place room temperature cooling, referred to as A liquid.
B. the washing of magnetic bead (SA-PMP):Magnetic bead is flicked into mixing, is adsorbed 30 seconds to magnetic frame, abandons supernatant, add 0.5 ×
SSC 0.3m1, adsorbed 30 seconds to magnetic frame, finally plus 0.5 × SSC of 0.1ml suspend, referred to as B liquid.
C. A liquid is added in B liquid, room temperature is placed 10 minutes, is adsorbed 30 seconds to magnetic frame, is abandoned supernatant, washed with 0.1 × SSC
Wash 4 times, finally abandon supernatant, add 0.L ml DEPC aqueous suspensions, to magnetic frame on adsorb 30 seconds, supernatant is moved to new test tube, then
Add 0.15m1DEPC water to suspend again, adsorbed 30 seconds to magnetic frame, move supernatant to above-mentioned test tube, be then the version of purifying in supernatant
Receive rope buffalo gnat salivary gland mRNA.
D. 1/10 volume 3M sodium acetates are added, pH5.2, isometric isopropanol places 30 minutes in -70 DEG C, 4 DEG C,
12000rpm is centrifuged 10 minutes, is abandoned supernatant, is precipitated and dissolved in 10 μ l DEPC water.
(3) version receives rope buffalo gnat salivary gland cDNA library structure:
Using CLONTECH companies CreatorTM SMART TMCDNA Library Construction Kit plasmids
CDNA library builds kit.
The chains of A.cDNA first synthesize:
1 μ l versions, which are added, in the sterile centrifuge tubes of 0.5ml receives rope buffalo gnat salivary gland mRNA, 1 μ l SMART IV oligonucleotides, 1
μ l CDS III/3 ' PCR primers, add 2 μ l deionized waters cumulative volume is reached 5 μ l.Mix centrifuge tube in reagent and with
12000rpm is centrifuged 15 seconds, and 72 DEG C are incubated 2 minutes.Centrifuge tube is incubated 2 minutes on ice.Following reagent is added in centrifuge tube
The chains of 2.0 μ l 5 × the first buffering, 1.0 μ l20mM dithiothreitol (DTT)s, 1.0 μ l 10mM dNTP mixtures, 1.0 μ l
PowerScript reverse transcriptase.Mix reagent in centrifuge tube and centrifuged 15 seconds with 12000rpm, 1 hour is incubated at 42 DEG C.Will be from
Heart pipe is placed in stops the synthesis of the first chain on ice.Take the chains of cDNA first synthesized by 2 μ l standby from centrifuge tube.
B. the second chain is expanded using long end polymeric PCR (LD-PCR) method
95 DEG C of preheating PCR instruments, by 2 the first chains of μ l cDNA (mRNA reverse transcriptions), 80 μ l deionized waters, 10 μ l 10 ×
Advantage 2PCR bufferings, 2 μ 50 × dNTP of l mixtures, the PCR primers of 2 μ l 5 ', 2 μ l CDS III/3 ' PCR primers and
2 μ l Escherichia coli polymerase centrifuge tubes are reacted.Expanded in PCR instrument by following procedure:95 DEG C, 20 seconds;22 circulations
(95 DEG C, 5 seconds;68 DEG C, 6 minutes).After circulation terminates, the cDNA double-strands synthesized in centrifuge tube are stripped.
C.PCR products PROMEGA companiesSV Gel and PCR Clean-Up System kits enter
Row extracting and reclaiming, step are as follows:
The cDNA double-strands obtained by PCR are added to isometric reverse mixing of film combination buffering, then turned mixed liquor
Enter centrifugal purification post, be stored at room temperature 5 minutes, DNA is fully combined with pellosil.12000rpm is centrifuged 30 seconds, outwells collecting pipe
In waste liquid.700 μ l eluent (containing ethanol) is added in centrifugal purification post, is centrifuged 30 seconds with 12000rpm, outwells collection
Waste liquid in pipe.Repeat step 2.12000rpm is centrifuged 5 minutes, centrifugal purification post is placed in new centrifuge tube.Add 30 μ l
Ultra-pure water, stand 5 minutes at room temperature.12000rpm is centrifuged 30 seconds, and ttom of pipe solution is the cDNA double-strands of purified mistake.
D. the preparation of bacillus coli DH 5 alpha competent cell:
The single DH5 α bacterium colonies of picking, it is inoculated in Luria-Bertani (LB) culture mediums of 3ml without ampicillin,
37 DEG C of overnight incubations, next day take above-mentioned bacterium solution in proportion 1:100 are inoculated in 50ml LB nutrient solutions, and 37 DEG C vibrate 2 hours.
Work as OD600When value reaches 0.35, bacterial cultures is harvested.By bacterium be transferred to one it is sterile, disposable, with ice precooling
50m1 PA tubes in, on ice side put 10 minutes, culture is cooled to 0 DEG C.Centrifuged 10 minutes with 4100rpm in 4 DEG C,
Reclaim cell.Nutrient solution is poured out, pipe is inverted l/min so that last trace nutrient solution flows to end.Per 50ml initial incubations liquid and
The 0.1mol/LCaCl of 30ml precoolings2-MgCl2Solution (80mmol/L MgCl2,20mmol/L CaCl2) be resuspended every part of cell sink
Form sediment.Centrifuged 10 minutes with 4100rpm in 4 DEG C, reclaim cell.Nutrient solution is poured out, pipe is inverted l/min so that last trace is trained
Nutrient solution is flow to end.Per the 50m1 initial incubations thing ice-cold 0.1mol/L CaCl of 2m12Every part of cell precipitation is resuspended, after packing
It is standby.
E. the conversion of digestion, connection and connection product:
1 μ l Takara pMD18-T carriers are added in microcentrifugal tube, 4 μ l versions receive rope buffalo gnat cDNA double-strand solution, full dose
For 5 μ l.Add 5 μ l (equivalent) ligase buffer mixture.16 DEG C are reacted 2 hours.Full dose (10 μ l) is added to 100 μ l DH5
In α competent cells, placed 30 minutes in ice.After 42 DEG C are heated 90 seconds, then placed 1 minute in ice.Add 37 DEG C of warm bath
The LB culture mediums 890 μ l crossed, 37 DEG C of slowly vibrating cultures 60 minutes.200 μ l are taken to be coated on the LB containing X-Gal, IPTG, Amp
Cultivated 16 hours for 37 DEG C on culture medium, form single bacterium colony.Each LB plates wash bacterium colony with 5mlLB fluid nutrient mediums, add 30%
Glycerine freezes.The cDNA of structure is greatly containing about 1 × 106Individual individually clone.
(4), version receive rope buffalo gnat antibacterial peptide gene SibaCec precursors colony screening:
Amplimer sequence is 5 ' ATGAACTTCAGAAATCTTTTCAT 3 ', and another amplimers of PCR are CLONTECH
Company SMARTTM3 ' PCR Primer primers in cDNA Library Construction Kit, its sequence are 5 '
ATTCTAGAGGCCGAGGCGGCCGACATG 3’。
PCR reactions are carried out under the following conditions:94 DEG C, 30 seconds;52 DEG C, 45 seconds;72 DEG C, 2 points 30 seconds, totally 35
Circulation.
The bacterium cDNA library of structure is titrated first, is then diluted to the LB culture mediums containing 100 μ g/ml ampicillins
(about 5000 bacteria/milliliters, and 30 bacteria/milliliters are respectively used to first run screening the second wheel sieve to appropriate bacterial concentration
Choosing), by 8 × 8 matrix bed boards (totally 64 hole, per μ l of hole 100) on 96 well culture plates, 37 DEG C are incubated overnight.Closed respectively by row, column
And inoculum, there are 16 samples to enter performing PCR identification, intersect positive hole bacteria samples and screened into the second wheel.
(5), version receives rope buffalo gnat antibacterial peptide gene sequencing and result:
Extract DNA and determine nucleotide sequence with dideoxy, the use of instrument is U.S. Applied
The full-automatic nucleotide sequencing instrument of Biosystems373A, sequencing primer BcaBESTTM Sequencing Primer RV-
M and BcaBESTTMSequencing Primer M13-47, BcaBESTTMSequencing Primer RV-M sequences:5`
GAGCGGATAACAATTTCAC ACAGG 3 ', BcaBESTTMSequencing Primer M13-47:5’
CGCCAGGGTTTTC CCAGTCACGAC 3’。
Gene sequencing result show encode version receive rope buffalo gnat antibacterial peptide SibaCec precursors gene by 272 nucleotides (SEQ
ID NO:2) (GenBank accession KT223121) is formed, is from 5 ' end to 3 ' terminal sequences:
The encoding gene that wherein the 70th -171 nucleotides is ripe antibacterial peptide SibaCec.
Embodiment two, version receive rope buffalo gnat antibacterial peptide SibaCec preparation (conventional method):
(1) version receives rope buffalo gnat antibacterial peptide SibaCec chemical synthesis process:The ripe peptide ammino acid sequence derived according to gene
Row, synthesize its complete sequence with automatic Peptide synthesizer (433A, Applied Biosystems), are taken off by HPLC reversed phase column chromatographies
Salt.
(2) molecular weight determination uses MALDI-TOF-MS (MALDI-TOF).
(3) synthesis version receive rope buffalo gnat antibacterial peptide SibaCec identify its purity, molecular weight with high-efficient liquid phase chromatogram HPLC method
Measure uses MALDI-TOF-MS (MALDI-TOF), isoelectric focusing electrophoresis measure isoelectric point, uses
Automatic Protein Sequencer measure amino acid sequence structure.
It is that version receives rope buffalo gnat antibacterial peptide SibaCec precursor-gene 70-171 positions nucleotides that version, which receives rope buffalo gnat antibacterial peptide SibaCec,
A kind of straight-chain polypeptide of coding, contains 34 amino acid residues, the dalton of molecular weight 3432.12, isoelectric point 10.73.Version receives rope
Buffalo gnat antibacterial peptide SibaCec complete sequences (SEQ ID NO:1) it is:
Gly1-Lys2-Leu3-Thr4-Lys5-Asp6-Lys7-Leu8-Lys9-Arg10-Gly11-Ala12-Lys13-Lys14-
Ala15-Leu16-Asp17-Val18-Ala19-Ser20-Lys21-Val22-Ala23-Pro24-Ile25-Val26-Ala27-Ala28-
Gly29-Ala30-Ser31-Ile32-Ala33-Arg34, C-terminal amidatioon.
Embodiment three, version receive rope buffalo gnat antibacterial peptide SibaCec pharmacological evaluation
(1) version receives rope buffalo gnat antibacterial peptide SibaCec antibacterial activity detection:
Culture medium is used as using Luria-Bertani (LB) fluid nutrient mediums.Strains tested is recovered through LB solid mediums
Afterwards, dilute bacterium colony with sterilized water and contain 2 × 10 into every milliliter5The bacterium solution of individual bacterium, it is standby.
When determining minimal inhibitory concentration, antibacterial detection is carried out using doubling dilution.Specific method is as follows:Trained in 0.19ml
Support and 0.01ml samples added in base as the first hole, take 0.1ml to add the 2nd hole (plus such as 0.1ml fresh cultures) after mixing,
Doubling dilution successively, suction out 0.1ml from the 6th hole and discard, the control of each hole system of surrounding, by added in each hole corrected bacterium solution (2 ×
105Cfu/ml) 0.1ml, 37 DEG C is placed after mixing and is cultivated 18 hours, light absorbs are determined at 600nm wavelength.Minimal inhibitory concentration
Not see the minimum sample concentration of bacterial growth.Bacterium bacterial strain derives from Kunming Medical University, and this experiment is repeated four times, and is made even
Average, as a result such as table 1.
Table 1, version receive rope buffalo gnat antibacterial peptide SibaCec bacteria growing inhibitings effect:
Known by table 1, version, which receives rope buffalo gnat antibacterial peptide SibaCec, to be had the function that significantly to suppress gramnegative bacterium and grow.
(2) version receives rope buffalo gnat antibacterial peptide SibaCec hemolytic activity detection:
By the 15ml rabbits blood of collection and Alsever's Solution (2.05 grams of glucose, 0.8 gram of sodium citrate, 0.055 gram of citric acid, chlorine
Change 0.42 gram of sodium, add distilled water to 100 milliliters, pH value is transferred to 6.1 after heating for dissolving, autoclaving is standby after 15 minutes) it is mixed
Anti-freezing is closed, brine 2 times is simultaneously resuspended into 107-108Cell/ml suspension.The good red cell suspension of above-mentioned dilution with
The antibacterial peptide SibaCec samples mixing of physiological saline is dissolved in, 37 DEG C are incubated 30 minutes, are centrifuged 5 minutes then at 1000rpm, on
Clear liquid surveys absorption value in 540nm.Negative control uses physiological saline, and positive control uses Triton X-100, percent hemolysis
Calculate as follows:Percent hemolysis (H%)=(ASample-ANegative control)/APositive control× 100%.As a result show that sample concentration is
During 100 μ g/ml, it is 0.82% that version, which receives rope buffalo gnat antibacterial peptide SibaCec percent hemolysis, illustrate that version receives buffalo gnat antibacterial peptide of restricting
SibaCec has extremely low hemolytic activity, will not cause human erythrocyte rupture dissolving and injury is produced to human body, characteristic profit
In it in the further development and application of field of medicaments.
SEQUENCE LISTING
<110>Kunming Medical University
<120>Version receives rope buffalo gnat antibacterial peptide SibaCec and its gene and application
<130> 2017
<160> 2
<170> PatentIn version 3.5
<210> 1
<211> 34
<212> PRT
<213> Simulium bannaense
<400> 1
Gly Lys Leu Thr Lys Asp Lys Leu Lys Arg Gly Ala Lys Lys Ala Leu
1 5 10 15
Asp Val Ala Ser Lys Val Ala Pro Ile Val Ala Ala Gly Ala Ser Ile
20 25 30
Ala Arg
<210> 2
<211> 272
<212> DNA
<213> Simulium bannaense
<400> 2
atgaacttca gaaatctttt catcattgtt gccatagtta tgctcgctgt ttttggccaa 60
accgaagctg ggaaactaac caaagacaaa ctaaaacgtg gcgctaagaa ggcattagac 120
gtggcttcga aggttgcccc gattgtagcc gctggagcat cgattgcgcg aggttaaggc 180
ccatggattc gagtgatgac acagaggcac gcttagagcg taactaataa aatcaaagaa 240
cgttaagatc cagaaaaaaa aaaaaaaaaa aa 272
Claims (3)
1. a kind of version receives rope buffalo gnat antibacterial peptide SibaCec, it is characterised in that:The antibacterial peptide be Chinese hematophagus version receive rope buffalo gnat antibacterial
A kind of straight-chain polypeptide of peptide gene coding, containing 34 amino acid residues, the dalton of molecular weight 3432.12, isoelectric point 10.73,
Its amino acid sequence is SEQ ID NO:Shown in 1.
2. coding version receive rope buffalo gnat antibacterial peptide SibaCec precursors gene, it is characterised in that:Precursor-gene GenBank
Accession No.KT223121 are made up of 272 nucleotides, and its nucleotides sequence is classified as SEQ ID NO:Shown in 2;Wherein
The encoding gene that 70-171 nucleotides are ripe antibacterial peptide SibaCec.
3. the version described in claim 1 receive rope buffalo gnat antibacterial peptide SibaCec prepare it is husky by Escherichia coli, Pseudomonas aeruginosa, mouse typhus
Application in the medicine of infectious disease caused by door Salmonella and Acinetobacter baumannii.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201510407103.4A CN105175523B (en) | 2015-07-13 | 2015-07-13 | Version receives rope buffalo gnat antibacterial peptide SibaCec and its gene and application |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201510407103.4A CN105175523B (en) | 2015-07-13 | 2015-07-13 | Version receives rope buffalo gnat antibacterial peptide SibaCec and its gene and application |
Publications (2)
Publication Number | Publication Date |
---|---|
CN105175523A CN105175523A (en) | 2015-12-23 |
CN105175523B true CN105175523B (en) | 2018-04-06 |
Family
ID=54898028
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201510407103.4A Expired - Fee Related CN105175523B (en) | 2015-07-13 | 2015-07-13 | Version receives rope buffalo gnat antibacterial peptide SibaCec and its gene and application |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN105175523B (en) |
Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN102250216A (en) * | 2011-06-27 | 2011-11-23 | 昆明理工大学 | Rana nigromaculata antimicrobial peptide as well as gene and application thereof |
CN104031135A (en) * | 2014-06-25 | 2014-09-10 | 昆明医科大学 | Tree frog defence peptide PopuDef as well as gene and application thereof |
CN104356216A (en) * | 2014-10-09 | 2015-02-18 | 昆明医科大学 | SibaDef of blood sucking insect, as well as gene and application thereof |
CN104558121A (en) * | 2014-12-31 | 2015-04-29 | 常熟理工学院 | Tiger frog antibacterial peptide, and coding gene and application thereof |
-
2015
- 2015-07-13 CN CN201510407103.4A patent/CN105175523B/en not_active Expired - Fee Related
Patent Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN102250216A (en) * | 2011-06-27 | 2011-11-23 | 昆明理工大学 | Rana nigromaculata antimicrobial peptide as well as gene and application thereof |
CN104031135A (en) * | 2014-06-25 | 2014-09-10 | 昆明医科大学 | Tree frog defence peptide PopuDef as well as gene and application thereof |
CN104356216A (en) * | 2014-10-09 | 2015-02-18 | 昆明医科大学 | SibaDef of blood sucking insect, as well as gene and application thereof |
CN104558121A (en) * | 2014-12-31 | 2015-04-29 | 常熟理工学院 | Tiger frog antibacterial peptide, and coding gene and application thereof |
Non-Patent Citations (1)
Title |
---|
urification and characterization of a novel defensin from the salivary glands of the black fly, Simulium bannaense;L Wei等;《Parasites & Vectors》;PUBMED;20150204;第8卷(第1期);第1-11页 * |
Also Published As
Publication number | Publication date |
---|---|
CN105175523A (en) | 2015-12-23 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN101412753A (en) | Bungarus fasciatus antibacterial peptide cathelicidin-BF, and genes and uses thereof | |
CN106749595B (en) | Tree frog defense peptides cathelicidin-PP and its gene and application | |
CN108484747B (en) | Japan frog skin repair peptide cathelicidin-NV and its gene and application | |
CN104031135B (en) | Rhacophorus defense peptides PopuDef and gene thereof and application | |
CN110950947B (en) | Rana temporaria chensinensis host defense peptide DMS-PS2, and gene and application thereof | |
CN110156875B (en) | Antibacterial peptide H5-p5, and preparation method and application thereof | |
CN104761629B (en) | A kind of broad-spectrum high efficacy antimicrobial peptide Pb CATH OH1 and its gene, preparation method and application | |
CN104177485A (en) | Yangtze alligator antimicrobial peptide Alligatorin 6 and application thereof | |
CN105497884B (en) | Application of the outer membrane protein Omp22 as Acinetobacter bauamnnii vaccine target spot | |
CN105175523B (en) | Version receives rope buffalo gnat antibacterial peptide SibaCec and its gene and application | |
CN104356216B (en) | Version receives rope buffalo gnat defense peptides SibaDef and its gene and application | |
CN105085645B (en) | Version receives rope buffalo gnat antibacterial peptide SibaCec A and its gene and application | |
CN102516382B (en) | Antimicrobial peptide Hainanenin-5 of Amolops hainanensis, gene of antimicrobial peptide Hainanenin-5 of Amolops hainanensis, and application of gene of antimicrobial peptide Hainanenin-5 of Amolops hainanensis | |
CN106399319B (en) | It is a kind of pool land frog gene and its coding polypeptide and the polypeptide purposes | |
CN115043925A (en) | Modified antibacterial peptide oNCM and application thereof | |
CN100581584C (en) | Serine protease inhibitor of Rana grahami, and its application | |
CN104910265B (en) | A kind of gene and the application of Hejiang spine frog antibacterial peptide and its coded sequence | |
CN108611388A (en) | A method of improving bacillus amyloliquefaciens Q-426 Cyclic lipopeptide antibiotic yield | |
WO2022104863A1 (en) | Antibacterial peptide derived from taihu white fish and application thereof | |
CN102250216A (en) | Rana nigromaculata antimicrobial peptide as well as gene and application thereof | |
CN106399320B (en) | A kind of purposes of the gene of kaloula pulchra and its polypeptide of coding and the polypeptide | |
CN109602894B (en) | Application of cecropin derived peptide | |
CN104119434B (en) | Bufo melanostictus antibacterial peptide and its gene and application | |
CN101845092A (en) | Antimicrobial peptide Ea-CATH1 of Equus asinus and genes and application thereof | |
CN102115496A (en) | Antimicrobial peptide Pc-CATH1 and gene thereof, chemical synthesis method and application thereof |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant | ||
CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20180406 Termination date: 20180713 |
|
CF01 | Termination of patent right due to non-payment of annual fee |