CN105085645B - Version receives rope buffalo gnat antibacterial peptide SibaCec A and its gene and application - Google Patents
Version receives rope buffalo gnat antibacterial peptide SibaCec A and its gene and application Download PDFInfo
- Publication number
- CN105085645B CN105085645B CN201510407322.2A CN201510407322A CN105085645B CN 105085645 B CN105085645 B CN 105085645B CN 201510407322 A CN201510407322 A CN 201510407322A CN 105085645 B CN105085645 B CN 105085645B
- Authority
- CN
- China
- Prior art keywords
- antibacterial peptide
- sibacec
- buffalo gnat
- version
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/43504—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates
- C07K14/43563—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from insects
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Abstract
Rope buffalo gnat antibacterial peptide and its gene and application is received the present invention relates to a kind of version, belongs to field of biomedicine technology.Version receive rope buffalo gnat antibacterial peptide SibaCec A be straight-chain polypeptide, be SEQ ID NO containing 33 amino acid residues, the dalton of molecular weight 3361.09, isoelectric point 11.47, its amino acid sequence:Shown in 1.Coding version receive rope buffalo gnat antibacterial peptide SibaCec A precursors gene GenBank accession No.KT223122 be made up of 282 nucleotides, nucleotides sequence is classified as SEQ ID NO:Shown in 2, wherein the encoding gene that the 70th -168 nucleotides is ripe antibacterial peptide SibaCec A.The beneficial effects of the present invention are：A kind of new buffalo gnat antibacterial peptide with broad spectrum antimicrobial (gramnegative bacterium) is provided, the antibacterial peptide has the function that significant bacteria growing inhibiting, can be in the application in preparing the medicine to be caught as caused by Escherichia coli, Pseudomonas aeruginosa, salmonella typhimurium and Acinetobacter baumannii.
Description
Technical field：
The present invention relates to a kind of hematophagus version receive rope buffalo gnat (Simulium bannaense) antibacterial peptide SibaCec-A and its
Gene and application, belong to field of biomedicine technology.
Background technology：
With the extensive and incorrect use of antibiotic, microorganism generates increasingly stronger tolerance to conventional antibiotic
Property, clinically there is the microorganism that can be largely resistant to the conventional antibiotics such as penicillin completely, existing antibiotic
It is helpless to these pathogenic microorganisms.The potential using value of antimicrobial (antibacterial peptide) medicine of polypeptide causes section of various countries
Grind the research interest of personnel.Antibacterial peptide is a kind of new antimicrobial polypeptide, and most of antibacterial peptide molecular weights are less than 10000
Er Dun, positively charged, rich in hydrophobic bases, amphipathic structure can be formed.Research shows that antibacterial peptide can be fast at low concentrations
Speed kills the pathogenic microorganisms such as various Gram-positives and negative bacteria, fungi, parasite, and it is thin to kill kinds of tumors
Born of the same parents, suppress the breeding and diffusion of virus.The bactericidal mechanism of antibacterial peptide is mainly attracted by electrostatic interaction and is attached to band
The bacterial cell membrane surface of negative electricity, the hole of cross-film is further formed on bacterial cell membrane, causes bacterial cell contents
Leak, so as to cause the death of bacterial cell.In addition, they are also acted on without aberration inducing, no cumulative toxicity, it is not easy to produce anti-medicine
Property.The as shown by data of some preclinical phases, antibacterial peptide is all effective for local infection and general infection, promises to be a new generation
Antimicrobial agents.
Insect is biotic population maximum on the earth, and in addition to ocean, remaining all ecological environment has the distribution of insect.
Insect easily contacts various pathogenic microorganisms in living environment, and in order to avoid microorganism infection, insect evolution has gone out powerful
Innate immune system, wherein antibacterial peptide are the important components in insect innate immune system.Research shows, the congenital immunity of insect
System can rapid, high volume synthesize the various germs that a variety of antibacterial peptides directly kill invasion body.In addition, they can also pass through
Participate in, the immune system of regulation body plays various defense functions indirectly.At present, screened from the antibacterial peptide in insect source potential
Antibiotic substitute be current educational circles study hotspot.These antibacterial peptides have different structures and antibacterial activity, are new
The good template storehouse of polypeptide antimicrobial agents exploitation.Hematophagus version receives rope Simulium in Insecta Diptera Simulidae Simulium,
Xishuangbanna of Yunnan province is distributed mainly on, there is not been reported for its internal antibacterial substance composition.
The content of the invention：
Rope is received it is an object of the invention to provide a kind of new version with broad spectrum antimicrobial (gramnegative bacterium)
Buffalo gnat antibacterial peptide SibaCec-A and its gene and application.
It is that Chinese hematophagus version receives rope buffalo gnat antibacterial peptide gene coding that the version of the present invention, which receives rope buffalo gnat antibacterial peptide SibaCec-A,
A kind of straight-chain polypeptide, contain 33 amino acid residues, the dalton of molecular weight 3361.09, isoelectric point 11.47.Polypeptide complete sequence one
Level structure (amino acid sequence SEQ ID NO:1) it is：
Coding version receive rope buffalo gnat antibacterial peptide SibaCec-A precursors gene by 282 nucleotides (SEQ ID NO:2) form
(GenBank accession KT223122), it is from 5 ' end to 3 ' terminal sequences：
The encoding gene that wherein the 70th -168 nucleotides is ripe antibacterial peptide SibaCec-A.
The present invention version receive rope buffalo gnat antibacterial peptide SibaCec-A prepare by Escherichia coli, Pseudomonas aeruginosa, Salmonella typhimurium
Application in the medicine of infectious disease caused by bacterium and Acinetobacter baumannii.
The beneficial effects of the present invention are：A kind of new buffalo gnat with broad spectrum antimicrobial (gramnegative bacterium) is provided
Antibacterial peptide, the antibacterial peptide have the function that significant bacteria growing inhibiting, can prepare by Escherichia coli, Pseudomonas aeruginosa, mouse
Application in the medicine of infectious disease caused by salmonella typhi and Acinetobacter baumannii.
Embodiment：
The essentiality content of the present invention is further illustrated with embodiment below, but present disclosure is not limited to
This.
Embodiment one, version receive rope buffalo gnat antibacterial peptide SibaCec-A precursors gene cloning
(1), version receive rope buffalo gnat salivary gland Total RNAs extraction：
A. version receives rope buffalo gnat in disecting microscope Xia Qu salivary organizations, accumulates 300mg samples, it is molten to add 3ml Trizol
Liquid, it is homogenized 30 minutes in 20ml glass homogenizers.
B. isometric phenol/chloroformic solution is added, is acutely mixed, room temperature is placed 10 minutes, and 4 DEG C, 12000rpm centrifuges 10 points
Clock, reject precipitation.
C. supernatant adds isometric isopropanol, and room temperature is placed 10 minutes, 4 DEG C, 12000rpm, centrifuged 10 minutes, precipitation
Washed once, dried with 75% ethanol, ttom of pipe sediment be version receive rope buffalo gnat salivary gland total serum IgE.
(2), version receives rope buffalo gnat salivary gland mRNA purifying：
Version receive rope buffalo gnat salivary gland mRNA isolate and purify using PROMEGA companies of the U.S.
MRNA Isolation Systems kits.
A. the version extracted is received rope buffalo gnat salivary gland total serum IgE and is dissolved in 500 μ l DEPC water, is put into 65 DEG C of water-baths 10 minutes, adds people
3 μ l Oligo (dT) probes and 13 μ l 20 × SSC solution, mix, place room temperature cooling, referred to as A liquid.
B. the washing of magnetic bead (SA-PMP)：Magnetic bead is flicked into mixing, is adsorbed 30 seconds to magnetic frame, abandons supernatant, add 0.5 ×
SSC 0.3m1, adsorbed 30 seconds to magnetic frame, finally plus 0.5 × SSC of 0.1ml suspend, referred to as B liquid.
C. A liquid is added in B liquid, room temperature is placed 10 minutes, is adsorbed 30 seconds to magnetic frame, is abandoned supernatant, washed with 0.1 × SSC
Wash 4 times, finally abandon supernatant, add 0.L ml DEPC aqueous suspensions, to magnetic frame on adsorb 30 seconds, supernatant is moved to new test tube, then
Add 0.15m1DEPC water to suspend again, adsorbed 30 seconds to magnetic frame, move supernatant to above-mentioned test tube, be then the version of purifying in supernatant
Receive rope buffalo gnat salivary gland mRNA.
D. 1/10 volume 3M sodium acetates are added, pH5.2, isometric isopropanol places 30 minutes in -70 DEG C, 4 DEG C,
12000rpm is centrifuged 10 minutes, is abandoned supernatant, is precipitated and dissolved in 10 μ l DEPC water.
(3) version receives rope buffalo gnat salivary gland cDNA library structure：
Using CLONTECH companies CreatorTM SMART TMCDNA Library Construction Kit plasmids
CDNA library builds kit.
The chains of A.cDNA first synthesize (mRNA reverse transcriptions)：
1 μ l versions, which are added, in the sterile centrifuge tubes of 0.5ml receives rope buffalo gnat salivary gland mRNA, 1 μ l SMART IV oligonucleotides, 1
μ l CDS III/3 ' PCR primers, add 2 μ l deionized waters cumulative volume is reached 5 μ l.Mix centrifuge tube in reagent and with
12000rpm is centrifuged 15 seconds, and 72 DEG C are incubated 2 minutes.Centrifuge tube is incubated 2 minutes on ice.Following reagent is added in centrifuge tube
The chains of 2.0 μ l 5 × the first buffering, 1.0 μ l20mM dithiothreitol (DTT)s, 1.0 μ l 10mM dNTP mixtures, 1.0 μ l
PowerScript reverse transcriptase.Mix reagent in centrifuge tube and centrifuged 15 seconds with 12000rpm, 1 hour is incubated at 42 DEG C.Will be from
Heart pipe is placed in stops the synthesis of the first chain on ice.Take the chains of cDNA first synthesized by 2 μ l standby from centrifuge tube.
B. 95 DEG C of preheating PCR instruments of the second chain are expanded using long end polymeric PCR (LD-PCR) method, by 2 μ l
The chains of cDNA first (mRNA reverse transcriptions), 80 μ l deionized waters, 10 μ 10 × Advantage of l 2PCR bufferings, 2 50 × dNTP of μ l
Mixture, the PCR primers of 2 μ l 5 ', 2 μ l CDS III/3 ' PCR primers and 2 μ l Escherichia coli polymerases centrifuge tubes carry out anti-
Should.Expanded in PCR instrument by following procedure：95 DEG C, 20 seconds；22 circulate (95 DEG C, 5 seconds；68 DEG C, 6 minutes).Circulation knot
Shu Hou, the cDNA double-strands synthesized in centrifuge tube are stripped.
C.PCR products PROMEGA companiesSV Gel and PCR Clean-Up System kits enter
Row extracting and reclaiming, step are as follows：
The cDNA double-strands obtained by PCR are added to isometric reverse mixing of film combination buffering, then turned mixed liquor
Enter centrifugal purification post, be stored at room temperature 5 minutes, DNA is fully combined with pellosil.12000rpm is centrifuged 30 seconds, outwells collecting pipe
In waste liquid.700 μ l eluent (containing ethanol) is added in centrifugal purification post, is centrifuged 30 seconds with 12000rpm, outwells collection
Waste liquid in pipe.Repeat step 2.12000rpm is centrifuged 5 minutes, centrifugal purification post is placed in new centrifuge tube.Add 30 μ l
Ultra-pure water, stand 5 minutes at room temperature.12000rpm is centrifuged 30 seconds, and ttom of pipe solution is the cDNA double-strands of purified mistake.
D. the preparation of bacillus coli DH 5 alpha competent cell：
The single DH5 α bacterium colonies of picking, it is inoculated in Luria-Bertani (LB) culture mediums of 3ml without ampicillin,
37 DEG C of overnight incubations, next day take above-mentioned bacterium solution in proportion 1:100 are inoculated in 50ml LB nutrient solutions, and 37 DEG C vibrate 2 hours.
Work as OD600When value reaches 0.35, bacterial cultures is harvested.By bacterium be transferred to one it is sterile, disposable, with ice precooling
50m1 PA tubes in, on ice side put 10 minutes, culture is cooled to 0 DEG C.Centrifuged 10 minutes with 4100rpm in 4 DEG C,
Reclaim cell.Nutrient solution is poured out, pipe is inverted l/min so that last trace nutrient solution flows to end.Per 50ml initial incubations liquid and
The 0.1mol/LCaCl of 30ml precoolings2-MgCl2Solution (80mmol/L MgCl2,20mmol/L CaCl2) be resuspended every part of cell sink
Form sediment.
Centrifuged 10 minutes with 4100rpm in 4 DEG C, reclaim cell.Nutrient solution is poured out, pipe is inverted l/min so that last
Trace nutrient solution flows to end.Per the 50m1 initial incubations thing ice-cold 0.1mol/L CaCl of 2m12Every part of cell precipitation is resuspended,
It is standby after packing.
E. the conversion of digestion, connection and connection product：
1 μ l Takara pMD18-T carriers are added in microcentrifugal tube, 4 μ l versions receive rope buffalo gnat cDNA double-strand solution, full dose
For 5 μ l.Add 5 μ l (equivalent) ligase buffer mixture.16 DEG C are reacted 2 hours.Full dose (10 μ l) is added to 100 μ l DH5
In α competent cells, placed 30 minutes in ice.After 42 DEG C are heated 90 seconds, then placed 1 minute in ice.Add 37 DEG C of warm bath
The LB culture mediums 890 μ l crossed, 37 DEG C of slowly vibrating cultures 60 minutes.200 μ l are taken to be coated on the LB containing X-Gal, IPTG, Amp
Cultivated 16 hours for 37 DEG C on culture medium, form single bacterium colony.Each LB plates wash bacterium colony with 5ml LB fluid nutrient mediums, add 30%
Glycerine freezes.The cDNA of structure is greatly containing about 1 × 106Individual individually clone.
(4), version receives rope buffalo gnat antibacterial peptide gene SibaCec-A colony screening：
Amplimer sequence is 5 ' ATGAACTTCAAAAATCTCTTCTT 3 ', and another amplimers of PCR are CLONTECH
Company SMARTTM3 ' PCR Primer primers in cDNA Library Construction Kit, its sequence are 5 '
ATTCTAGAGGCCGAGGCGGCCGACATG 3’。
PCR reactions are carried out under the following conditions：94 DEG C, 30 seconds；52 DEG C, 45 seconds；72 DEG C, 2 points 30 seconds, totally 35
Circulation.
The bacterium cDNA library of structure is titrated first, is then diluted to the LB culture mediums containing 100 μ g/ml ampicillins
(about 5000 bacteria/milliliters, and 30 bacteria/milliliters are respectively used to first run screening the second wheel sieve to appropriate bacterial concentration
Choosing), by 8 × 8 matrix bed boards (totally 64 hole, per μ l of hole 100) on 96 well culture plates, 37 DEG C are incubated overnight.Closed respectively by row, column
And inoculum, there are 16 samples to enter performing PCR identification, intersect positive hole bacteria samples and screened into the second wheel.
(5), version receives rope buffalo gnat antibacterial peptide gene sequencing and result：
Extract DNA and determine nucleotide sequence with dideoxy, the use of instrument is U.S. Applied
The full-automatic nucleotide sequencing instrument of Biosystems373A, sequencing primer BcaBESTTM Sequencing Primer RV-
M and BcaBESTTMSequencing Primer M13-47, BcaBESTTMSequencing Primer RV-M sequences：5’
GAGCGGATAACAATTTCAC ACAGG 3 ', BcaBESTTMSequencing Primer M13-47：5’
CGCCAGGGTTTTC CCAGTCACGAC 3’。
Gene sequencing result show encode version receive rope buffalo gnat antibacterial peptide SibaCec-A precursors gene by 282 nucleotides
(SEQ ID NO:2) (GenBank accession KT223122) is formed, is from 5 ' end to 3 ' terminal sequences:
The encoding gene that wherein the 70th -168 nucleotides is ripe antibacterial peptide SibaCec-A.
Embodiment two, version receive rope buffalo gnat antibacterial peptide SibaCec-A preparation (conventional method)：
(1) version receives rope buffalo gnat antibacterial peptide SibaCec-A chemical synthesis process：The ripe peptide ammino acid sequence derived according to gene
Row, synthesize its complete sequence with automatic Peptide synthesizer (433A, Applied Biosystems), are taken off by HPLC reversed phase column chromatographies
Salt.
(2) molecular weight determination uses MALDI-TOF-MS (MALDI-TOF).
(3) synthesis version receive rope buffalo gnat antibacterial peptide SibaCec-A identify its purity, molecule with high-efficient liquid phase chromatogram HPLC method
Measurement uses MALDI-TOF-MS (MALDI-TOF) surely, and isoelectric focusing electrophoresis determines isoelectric point,
Amino acid sequence structure is determined with automatic Protein Sequencer.
Embodiment three, version receive rope buffalo gnat antibacterial peptide SibaCec-A pharmacological evaluation
(1) version receives rope buffalo gnat antibacterial peptide SibaCec-A antibacterial activity detection：
Culture medium is used as using Luria-Bertani (LB) fluid nutrient mediums.Strains tested is recovered through LB solid mediums
Afterwards, dilute bacterium colony with sterilized water and contain 2 × 10 into every milliliter5The bacterium solution of individual bacterium, it is standby.
When determining minimal inhibitory concentration, antibacterial detection is carried out using doubling dilution.Specific method is as follows：Trained in 0.19ml
Support and 0.01ml samples added in base as the first hole, take 0.1ml to add the 2nd hole (plus such as 0.1ml fresh cultures) after mixing,
Doubling dilution successively, suction out 0.1ml from the 6th hole and discard, the control of each hole system of surrounding, by added in each hole corrected bacterium solution (2 ×
105Cfu/ml) 0.1ml, 37 DEG C is placed after mixing and is cultivated 18 hours, light absorbs are determined at 600nm wavelength.Minimal inhibitory concentration
Not see the minimum sample concentration of bacterial growth.Bacterium bacterial strain derives from Kunming Medical University, and this experiment is repeated four times, and is made even
Average, as a result such as table 1.
Table 1, version receive rope buffalo gnat antibacterial peptide SibaCec-A bacteria growing inhibitings effect：
From table 1, version receives rope buffalo gnat antibacterial peptide SibaCec-A with the significant work for suppressing gramnegative bacterium growth
With.
(2) version receives rope buffalo gnat antibacterial peptide SibaCec-A hemolytic activity detection：
By the rabbit blood of collection and Alsever's Solution (2.05 grams of glucose, 0.8 gram of sodium citrate, 0.055 gram of citric acid, sodium chloride
0.42 gram, adding distilled water to 100 milliliters, pH value be transferred to 6.1 after heating for dissolving, autoclaving is standby after 15 minutes) mixing is anti-
Solidifying, brine 2 times is simultaneously resuspended into 107-108Cell/ml suspension.The good red cell suspension of above-mentioned dilution and dissolving
Rope buffalo gnat antibacterial peptide SibaCec-A samples mixing is received in the version of physiological saline, and 37 DEG C are incubated 30 minutes, and 5 points are centrifuged then at 1000rpm
Clock, supernatant survey absorption value in 540nm.Negative control uses physiological saline, and positive control uses Triton X-100, haemolysis hundred
Ratio is divided to calculate as follows：Percent hemolysis (H%)=(ASample-ANegative control)/APositive control× 100%.As a result sample concentration is shown
For 100 μ g/ml when, it is 0.68% that version, which receives rope buffalo gnat antibacterial peptide SibaCec-A percent hemolysis, illustrate that version receives buffalo gnat antibacterial peptide of restricting
SibaCec-A has extremely low hemolytic activity, will not cause human erythrocyte rupture dissolving and injury, therefore ten are produced to human body
Divide and be beneficial to it in the further development and application of field of medicaments.
SEQUENCE LISTING
<110>Kunming Medical University
<120>Version receives rope buffalo gnat antibacterial peptide SibaCec-A and its gene and application
<130> 2017
<160> 2
<170> PatentIn version 3.5
<210> 1
<211> 33
<212> PRT
<213> Simulium bannaense
<400> 1
Lys Ile Asn Lys Gln Lys Ile Lys Asn Gly Ala Lys Lys Ala Leu Gly
1 5 10 15
Val Ala Ser Lys Val Ala Pro Val Val Ala Ala Phe Ala Ala Ile Ala
20 25 30
Arg
<210> 2
<211> 282
<212> DNA
<213> Simulium bannaense
<400> 2
atgaacttca aaaatctctt cttaatcgtt gtcgctatct tattcgctgt tttcggccaa 60
gctgaagcta aaatcaacaa gcaaaaaatt aaaaatggtg caaagaaagc tcttggagta 120
gctagtaagg ttgcacccgt tgttgccgct tttgcagcta ttgcgcgagg ttaaagagat 180
ttatggccaa ataagcagaa aaagtgatac tttgttgaga tcgtaaagcg aataaaagtg 240
acacacgacc agaacctcaa atgcacaaaa aaaaaaaaaa aa 282
Claims (3)
1. a kind of version receives rope buffalo gnat antibacterial peptide SibaCec-A, it is characterised in that：The antibacterial peptide be Chinese hematophagus version receive rope buffalo gnat prevent
A kind of straight-chain polypeptide of imperial peptide gene coding, the dalton of molecular weight 3361.09, isoelectric point 11.47, its amino acid sequence is SEQ
ID NO:Shown in 1.
2. coding version receive rope buffalo gnat antibacterial peptide SibaCec-A precursors gene, it is characterised in that precursor-gene GenBank
Accession No.KT223122 are made up of 282 nucleotides, and its nucleotides sequence is classified as SEQ ID NO:Shown in 2；Wherein
The encoding gene that 70-168 nucleotides are ripe antibacterial peptide SibaCec-A.
3. the version described in claim 1 receive rope buffalo gnat antibacterial peptide SibaCec-A prepare by Escherichia coli, Pseudomonas aeruginosa, mouse typhus
Application in the medicine of infectious disease caused by salmonella and Acinetobacter baumannii.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510407322.2A CN105085645B (en) | 2015-07-13 | 2015-07-13 | Version receives rope buffalo gnat antibacterial peptide SibaCec A and its gene and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510407322.2A CN105085645B (en) | 2015-07-13 | 2015-07-13 | Version receives rope buffalo gnat antibacterial peptide SibaCec A and its gene and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105085645A CN105085645A (en) | 2015-11-25 |
| CN105085645B true CN105085645B (en) | 2018-03-16 |
Family
ID=54567044
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510407322.2A Expired - Fee Related CN105085645B (en) | 2015-07-13 | 2015-07-13 | Version receives rope buffalo gnat antibacterial peptide SibaCec A and its gene and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105085645B (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102250216B (en) * | 2011-06-27 | 2013-03-06 | 昆明理工大学 | Rana nigromaculata antimicrobial peptide as well as gene and application thereof |
| CN104031135A (en) * | 2014-06-25 | 2014-09-10 | 昆明医科大学 | Tree frog defence peptide PopuDef as well as gene and application thereof |
| CN104356216A (en) * | 2014-10-09 | 2015-02-18 | 昆明医科大学 | SibaDef of blood sucking insect, as well as gene and application thereof |
| CN104558121A (en) * | 2014-12-31 | 2015-04-29 | 常熟理工学院 | Tiger frog antibacterial peptide, and coding gene and application thereof |
-
2015
- 2015-07-13 CN CN201510407322.2A patent/CN105085645B/en not_active Expired - Fee Related
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102250216B (en) * | 2011-06-27 | 2013-03-06 | 昆明理工大学 | Rana nigromaculata antimicrobial peptide as well as gene and application thereof |
| CN104031135A (en) * | 2014-06-25 | 2014-09-10 | 昆明医科大学 | Tree frog defence peptide PopuDef as well as gene and application thereof |
| CN104356216A (en) * | 2014-10-09 | 2015-02-18 | 昆明医科大学 | SibaDef of blood sucking insect, as well as gene and application thereof |
| CN104558121A (en) * | 2014-12-31 | 2015-04-29 | 常熟理工学院 | Tiger frog antibacterial peptide, and coding gene and application thereof |
Non-Patent Citations (1)
| Title |
|---|
| Purification and characterization of a novel defensin from the salivary glands of the black fly, Simulium bannaense;L Wei等;《Parasites & Vectors》;pubmed;20150204;第8卷(第1期);第1-11页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105085645A (en) | 2015-11-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101412753A (en) | Bungarus fasciatus antibacterial peptide cathelicidin-BF, and genes and uses thereof | |
| CN104151415B (en) | A kind of natural antibacterial peptide Alligatorin4 and its application | |
| CN106749595B (en) | Tree frog defense peptides cathelicidin-PP and its gene and application | |
| CN105566452A (en) | Antibacterial peptide with annular structure and preparation method and application thereof | |
| CN104031135B (en) | Rhacophorus defense peptides PopuDef and gene thereof and application | |
| CN110156875B (en) | Antibacterial peptide H5-p5, and preparation method and application thereof | |
| CN104761629B (en) | A kind of broad-spectrum high efficacy antimicrobial peptide Pb CATH OH1 and its gene, preparation method and application | |
| CN107344958A (en) | Antibacterial pentapeptide derivative and its application | |
| CN104163861B (en) | Reptile antibacterial peptide Alligatorin5 and applications thereof | |
| TW201132350A (en) | Low hemolysis antibacterial peptide pharmaceutical compositions and use thereof | |
| CN105085645B (en) | Version receives rope buffalo gnat antibacterial peptide SibaCec A and its gene and application | |
| CN109438559B (en) | Polypeptide for resisting multiple drug-resistant acinetobacter baumannii | |
| CN114702598B (en) | Recombinant antibacterial peptide and application thereof | |
| CN105175523B (en) | Version receives rope buffalo gnat antibacterial peptide SibaCec and its gene and application | |
| CN102516382B (en) | Antimicrobial peptide Hainanenin-5 of Amolops hainanensis, gene of antimicrobial peptide Hainanenin-5 of Amolops hainanensis, and application of gene of antimicrobial peptide Hainanenin-5 of Amolops hainanensis | |
| CN104356216B (en) | Version receives rope buffalo gnat defense peptides SibaDef and its gene and application | |
| JPH04502904A (en) | Methods of administering amphipathic peptides and compositions thereof | |
| CN104910265B (en) | A kind of gene and the application of Hejiang spine frog antibacterial peptide and its coded sequence | |
| CN102796176B (en) | Kunyuenin, preparation method and application | |
| CN115043925A (en) | Modified antibacterial peptide oNCM and application thereof | |
| WO2022104863A1 (en) | Antibacterial peptide derived from taihu white fish and application thereof | |
| CN110615830B (en) | Application of antibacterial peptide in anti-mycobacterial infection medicine | |
| CN103172721B (en) | Amolops hainanensis antimicrobial peptide Hainanenin-1, and gene, separation purification, chemical synthesis and application thereof | |
| CN106188242A (en) | The application in the medicine of preparation suppression tubercule bacillus of a kind of Novel ring peptide compounds | |
| CN101845092A (en) | Antimicrobial peptide Ea-CATH1 of Equus asinus and genes and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20180316 Termination date: 20180713 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |