CN103172721B

CN103172721B - Amolops hainanensis antimicrobial peptide Hainanenin-1, and gene, separation purification, chemical synthesis and application thereof

Info

Publication number: CN103172721B
Application number: CN201110440181.6A
Authority: CN
Inventors: 于海宁; 王义鹏; 冯菲菲; 广慧娟; 何伟玉
Original assignee: Dalian University of Technology
Current assignee: Dalian University of Technology
Priority date: 2011-12-26
Filing date: 2011-12-26
Publication date: 2015-04-29
Anticipated expiration: 2031-12-26
Also published as: CN103172721A

Abstract

The invention relates to an Amolops hainanensis antimicrobial peptide Hainanenin-1, and a gene, separation purification, chemical synthesis and application thereof, belonging to the technical field of biomedicine. The Hainanenin-1 is a small peptide containing heptatomic ring at the C terminal, which is prepared by the following steps: electrically stimulating Amolops hainanensis, collecting the skin secretion, centrifuging, freeze-drying, carrying out Sephadex column chromatography and RP-HPLC (reversed phase-high performance liquid chromatography), and purifying. The molecular weight of the Hainanenin-1 is 2278.90, and the isoelectric point is 9.50. The primary structure is phenylalanine-alanine-leucine-glycine-alanine-valine-threonine-lysine-leucine-leucine-proline-serine-leucine-leucine-cysteine-methionine-isoleucine-threonine-arginine-lysine-cysteine. The precursor gene for coding the Hainanenin-1 is composed of 320 nucleotides, and the part for coding the mature peptide is 139th-201st nucleotides. When being used for preparing therapeutic drugs for pathogenic microbe infectious diseases, the Hainanenin-1 has the characteristics of broad-spectrum antimicrobial activity and low hemolysis.

Description

The rapid frog antimicrobial peptide Hainanenin-1 in a kind of Hainan and gene, separation and purification, chemosynthesis and application

Technical field

The invention provides one and derive from the broad spectrum antimicrobial peptide Hainanenin-1 of the rapid frog (Amolops hainanensis) in Hainan and gene, separation and chemical synthesis process and the application in field of biological pharmacy, belong to field of biomedicine technology.

Background technology

Extensively, in a large number use along with antibiotic, pathogenic micro-organism also improves gradually to the resistance that microbiotic produces, become the difficult point of infectious diseases treatment, occurred the threat of " superbug " especially in the recent period, all force people to go to find novel anti-microbial agents.Recent research finds, peptide antibiotics has the anti-microbial activity of wide spectrum, has the superiority that " conventional antibiotic " is incomparable simultaneously: as when least action concentration, fast wide spectrum ground killing microorganisms (comprising current clinical anti-medicine bacterium); Also restraining effect is had to fungi; The generation of drug resistance strain can not be induced; All effective for local infection and systemic infection, promise to be antiseptic-germicide of new generation, its development is in widespread attention at present.Simultaneously also to have molecular weight little for antibacterial peptide, and stability is high, not easily develop immunity to drugs the features such as power.Antibacterial peptide is that the class produced through induction in organism has bioactive micromolecule polypeptide, and antibacterial peptide is extensively present in bacterium, plant and animal body, is an important component part of host immune defenses system.

Different from traditional microbiotic, batrachians antibacterial skin peptide causes plasma membrane permeability to increase by interference prokaryotic cell prokaryocyte membrane structure, thus cause antibacterial or germicidal action, and pathogenic agent not easily develops immunity to drugs to it.Batrachians antibacterial peptide, except having efficient, wide spectrum and not easily producing except the anti-microbial activity of resistance, also has antitumor, virus, protozoon isoreactivity, and to human normal cell almost without acting on.Therefore, constantly occur in antibiotics resistant pathogenic strains, the diseases such as virus and tumour cause to class health the today having threat, and antibacterial peptide becomes the resisting pathogenic microbes of a new generation and the medicine of tumour by being expected to.According to domestic and foreign literature, be separated from various biogenetic derivation and obtained different active polypeptide, and some enters clinical treatment.As the active polypeptide Magainin tool broad spectrum antimicrobial effect obtained from Xenopus laevis (Xenopus laevis) Skin exudate, there is anti-tumor activity simultaneously, got permission as extensive pedigree antibiotic in the U.S., it is clinical that its gene engineering product entered for three phases; The active polypeptide IB-367 that Intrabiotics company produces has got permission to be used for the treatment of stomatocace one clinical trial phase that cancer patient causes because various bacteria infects; The clinical trial that Applied Microbiology company and Astra company cooperation active polypeptide nisin treat stomach ulcer also obtains good curative effect.

China has abundant amphibian animal resource, and it is the important component part of Chinese biological resource, and wherein a lot of species have the value such as edible or medicinal, have very large developing and utilizingpotentiality.Amphibians is owing to living in humidity for a long time, under environment that darkness, microorganism grow in a large number, three cover defense mechanisms are defined: (1) physical barriers in long-term natural evolution process, the a large amount of glycoprotein of mucus glands secrete and proteoglycan, be wrapped in skin appearance face, hinder the intrusion of pathogenic bacteria; (2) acquired immune system, containing IgG antibody in Amphibians skin; (3) innate immune system, is formed primarily of a large amount of antibacterial peptides.At present, to batrachia antibacterial peptide in batrachians especially skin and enteron aisle antibacterial peptide research the clearest.After Zasloff is separated to Magainins from water frog skin, from different batrachias, be in succession separated to many antibacterial peptide families (as Dermaseptins, Temporins, Ranatuerins, Brevinins, Tigerinins) with the bacteriostatic activity of wide spectrum, some also have unique anti-mycotic activity.The application of China to batrachians medicine has long history, but mainly concentrates on the organic molecules such as alkaloid to its activeconstituents and pharmacological Quality Research, also rarely has report to the research of its skin activity peptide matters.The rapid frog (Amolops hainanebsis) in Hainan is the Amphibians of the rapid Rana of Ranidae, is the endemic species of China, is distributed in the ground such as Hainan.

Hainan of the present invention rapid frog (Amolops hainanensis) ring-type antibacterial peptide Hainanenin-1 molecular weight is little, and structure is simple, only containing a disulfide linkage, facilitates chemosynthesis and preparation.Other family's antibacterial peptides reported in Amphibians of comparing source, Hainanenin-1 antimicrobial acivity is stronger, and there is the antimicrobial acivity of wide spectrum, all activity is had to gram positive bacterium, gram negative bacterium and fungi, comprising a large amount of clinical separation Resistant strain, there is hemolytic low beneficial features in addition, all make Hainanenin-1 become the good template of externally used antimicrobial drug development.

Summary of the invention

The invention provides a kind of a kind of antimicrobial peptide Hainanenin-1 deriving from the rapid frog (Amolops hainanensis) in Hainan and gene, separation and purification, chemosynthesis and the application with very strong antimicrobial acivity.

In order to realize object of the present invention, the invention provides following technical scheme:

Hainan rapid frog antimicrobial peptide Hainanenin-1 is first through Sephadex G-50 gel-filtration from the rapid frog Skin exudate in batrachians Hainan, then reverse phase HPLC (RP-HPLC) is separated the ring type polypeptide of a kind of C end containing seven yuan of Rana Box obtained, molecular weight is 2278.90 dalton, and iso-electric point is 9.50.Polypeptide complete sequence primary structure is: phenylalanine-Ala-Leu-Gly-Ala-α-amino-isovaleric acid-thr-lys-Leu-Leu-proline(Pro)-serine-leucine-leucine-halfcystine-methionine(Met)-isoleucine-threonine-arginine-lysine-halfcystine.Containing 3 alkaline amino acid residues (1 arginine and 2 Methionins), no acidic amino-acid residue, static charge is+3, illustrates that it is a kind of basic polypeptide.15 and the 21 halfcystine form intramolecular disulfide bond.

Construct the rapid frog (Amolops hainanensis) the skin cDNA library in Hainan, therefrom screening obtains the precursor sequence of Hainanenin-1, gene sequencing result shows that the gene of the rapid frog (Amolops hainanensis) the Hainanenin-1 precursor in coding Hainan is made up of 321 Nucleotide, from 5 ' end to 3 ' terminal sequence is:

1 ATGTTGCCCT TGAAGAAATC CATGTTACTC CTTTTCTTCC TTGGGACCAT CAACTTATCT 61 CTCTGTGAGCAAGAGAGAGA TGCCGAAGAA GAAAGAAGAG ACGATGAAGA TAAAAGGGAT

121 GTTGAAGTGG AAAAACGATT TGCATTAGGT GCGGTTACTA AGCTTTTGCC ATCACTGTTA

181 TGTATGATTA CCAGAAAATG TTGAAGCTTG AGCTGGAAAT CATCTGATGA GAAATATAAT 241TTAGCTAAAT GCACATCAGA TATCTTATAA AAAATAAAAA TTCTCACATA TAAAAAAAAA 301 AAAAAAAAAAAAAAAAAAAA

The rapid frog (Amolops hainanensis) the mature peptide Hainanenin-1 in coding Hainan is 139-201 position Nucleotide, and its aminoacid sequence is: Phe ¹ala ²leu ³gly ⁴ala ⁵val ⁶thr ⁷lys ⁸leu ⁹leu ¹⁰pro ¹¹ser ¹²leu ¹³leu ¹⁴cys ¹⁵met ¹⁶ile ¹⁷thr ¹⁸arg ¹⁹lys ²⁰cys ²¹(FALGAVT KLLPSLLCMITRKC).

The chemical synthesis process of Hainanenin-1: according to the aminoacid sequence of the rapid frog (Amolops hainanensis) the antibacterial peptide Hainanenin-1 mature peptide in coding Hainan, synthesize its complete sequence with automatic Peptide synthesizer; By HPLC reversed phase column chromatography desalting and purifying, and determine that its purity is greater than 95%; Its molecular weight is measured with Matrix Assisted Laser Desorption ionization time of flight mass spectrometry (MALDI-TOF-MS).

The high purity Hainanenin-1 antimicrobial peptide that chemosynthesis obtains can be dissolved in sterilizing ultrapure water, detects for pharmacologically active.

Beneficial effect of the present invention is that separation and purification obtains antimicrobial peptide Hainanenin-1 from the rapid frog skin secretion lyophilized powder of Hainan, obtaining the gene of coding antimicrobial peptide Hainanenin-1 precursor from building clone the rapid frog (Amolops hainanensis) cDNA library in Hainan, obtaining mature peptide Hainanenin-1 by chemical synthesis process.This ring-type antibacterial peptide Hainanenin-1 molecular weight is little, and structure is simple, only containing a disulfide linkage, facilitates chemosynthesis and preparation.Other family's antibacterial peptides reported in Amphibians of comparing source, Hainanenin-1 antimicrobial acivity is stronger, and there is the antimicrobial acivity of wide spectrum, all activity is had to gram positive bacterium, gram negative bacterium and fungi, comprising a large amount of clinical separation Resistant strain, there is hemolytic low beneficial features in addition, all make Hainanenin-1 become the good template of externally used antimicrobial drug development.

Accompanying drawing explanation

Figure 1A is the SephadexG-50 gel filtration chromatography figure of the rapid frog (Amolops hainanensis) the antimicrobial peptide Hainanenin-1 in Hainan of the present invention.Arrow is depicted as Peak Activity.

Figure 1B is Hainan of the present invention rapid frog (Amolops hainanensis) antibacterial peptide Hainanenin-1 reverse-phase HPLC figure.Arrow h is depicted as Hainanenin-1.

Embodiment

Describe specific embodiments of the invention in detail below in conjunction with technical scheme, but content of the present invention is not limited thereto.

Embodiment 1

The separation and purification of Hainanenin-1: choose the adult the Hainan rapid frog (A.hainanensis) (n=5) be in a good state of health, with ultrapure water drip washing back.Adopt electrostimulation to collect skin secretion, with electric shock device, electricity irritation is carried out to frog skin of back, voltage I0V, electric shock time 3ms, after stimulating, by skin secretion with in the extremely clean container of the normal saline flushing of 0.9%, the centrifugal 20min of 12000rpm, preserves after abandoning supernatant, lyophilize.-20 DEG C save backup.

The first step Sephadex G-50 gel permeation chromatography: 0.9g A.hainanensis skin of back secretory product lyophilized powder 10ml0.1M phosphoric acid salt (Na ₂hPO ₄-NaH ₂pO ₄pH 6.0) buffer solution, the centrifugal 10min of 12000rpm, get supernatant liquor and be splined on the Sephadex G-50 gel exclusion chromatography post (1.6cm x 90cm, Amersham Bioscience) balanced, use same buffer solution elution, flow velocity 3mL/10min, collect 3mL/ pipe with automatic Fraction Collector, 220nm detects and collects each blob detection anti-microbial activity, and freeze-drying is for subsequent use.

Second step reverse phase HPLC (RP-HPLC) is: the peak that Sephadex G-50 gel exclusion chromatography is separated the activeconstituents obtained is dissolved in pure water again, 4 DEG C, the centrifugal 15min of 12000rpm, get supernatant liquor, with 0.45 μm of membrane filtration, collection filtrate is splined on C18 reversed-phase column (the Hypersil BDS C18 through fully balancing containing the ultrapure water of 1 ‰ trifluoroacetic acids, 30cm x 0.46cm) carry out gradient elution by the elution system that acetonitrile (containing 1 ‰ trifluoroacetic acids) is formed, 215nm detects peptide concentration.Collect each peak obtained, freeze-drying concentrates, and again dissolves and carry out anti-microbial activity detection with the deionized water of sterilizing.

The Hainanenin-1 molecular weight determination of the 3rd step Primary Structure Analysis purifying adopts electron spray(ES) level Four bar flight time tandem mass spectrometry (ESI-Q-TOF-MS, Biosystems/MDS Sciex Toronto, Canada).Isoelectric focusing electrophoresis measures iso-electric point, measures amino acid sequence structure with automatic Protein Sequencer.

Embodiment 2

The clone of antimicrobial peptide Hainanenin-1 precursor-gene and gene sequencing, comprising:

Adopt AxyPrepTM Multisource Total RNA Miniprep Kit to extract the rapid frog (Amolops hainanensis) the skin total serum IgE in Hainan, utilize Creator ^tMsMART ^tMcDNA library builds storehouse test kit and builds the rapid frog (Amolops hainanensis) the skin cDNA library in Hainan. reverse Transcriptase reverse transcription synthesis cDNA first chain, primer is:

Forward SMARTer V Oligonucleotide:5 '-AAGCAGTGGTATCAACGCAGAGTACXXXXX-3 ' (X=undisclosed base in the proprietary SMARTer oligo sequence)

Reverse 3 ' In-Fusion SMARTer CDS Primer:

5’-CGGGGTACGATGAGACACCATTTTTTTTTTTTTTTTTTTTVN-3’(N＝A，C，G，or T；V＝A，G，or C)。

Utilize Advantage DNA Polymerase to synthesize the second chain, primer is: forward 5 '-primer:5 '-AAGCAGTGGTATCAACGCAGAGT-3 '.Reverse primer is all 3 ' In-Fusion SMARTer CDS Primer.

Design a specific forward primer (P1) and a reverse non-specific universal primer (3 '-primer), with the rapid frog (Amolops hainanensis) the skin cDNA library in Hainan for template, the cDNA of pcr amplification Hainanenin-1 precursor.

Forward P1:5 '-CCAAAGATGTTSMCCWYGAAG-3 ' (M=A or C; W=A or T; Y=C or T)

Reverse non-specific universal primer is 3 '-primer, its sequence by: 5 '-CGGGGTACGATGAGACACCAT-3 ' is obtained positive monoclonal and is carried out gene nucleotide series mensuration, pMD ^tM19-T vector checks order universal primer:

Forward M13F:5 '-CGCCAGGGTTTTCCCAGTCACGAC-3 ';

Reverse M13R:5 '-GAGCGGATAACAATTTCACACAGG-3 ';

Concrete steps are as follows:

The first step, AxyPrepTM Multisource Total RNA Miniprep Kit extract the rapid frog (Amolops hainanensis) the skin total serum IgE in Hainan (experiment utensil used and reagent are all through process below, without RNase):

A. cut a fritter skin histology from the rapid frog (Amolops hainanensis) back, fresh Hainan of slaughtering, put into the cell cryopreservation tube of Liquid nitrogen precooler, then put into rapidly liquid nitrogen and preserve;

B. the organization material be kept in liquid nitrogen is taken out, put into the mortar of precooling, fully grinding rapidly, period constantly adds a little liquid nitrogen in mortar, grind into powder, add 400 μ l Buffer R-I, repeatedly aspirate 8-10 time with syringe, proceed in 1.5ml centrifuge tube (test kit provides).Add 150 μ l Buffer R-II, vortex oscillation 15-30s, 12,000 × g centrifugal 5min.

C. the supernatant after centrifugal is transferred in new 1.5ml centrifuge tube, adds 250 μ l Virahols, mix.Be placed in 2ml centrifuge tube (test kit provides) by preparing pipe, the mixed solution in transfer step 4 to preparing in pipe, 6,000 × g centrifugal 1min.Abandon filtrate, put get back to preparing pipe in 2ml centrifuge tube, prepare in pipe and add 500 μ l Buffer W1A, 12,000 × g centrifugal 1min.Abandon filtrate, put get back to preparing pipe in 2ml centrifuge tube, prepare in pipe and add 700 μ l Buffer W2,12,000 × g centrifugal 1min; Wash once with 700 μ l Buffer W2 more in the same way.Abandon filtrate, put preparing pipe and get back in 2ml centrifuge tube, 12,000 × g centrifugal 1min.Putting into a clean 1.5ml centrifuge tube (test kit provides) by preparing pipe, adding 70-100 μ l Buffer TE preparing periosteum central authorities.Room temperature leaves standstill 1min, and 12,000 × g centrifugal 1min, wash-out obtains RNA.

Second step, Creator ^tMsMART ^tMcDNA library builds storehouse test kit and builds the rapid frog (Amolops hainanensis) the skin cDNA library in Hainan:

The synthesis (mRNA reverse transcription) of the first chain:

A. the following mixed solution of preparation in new 0.2ml PCR pipe (without DNase and RNase):

RNase free ddH2O is supplemented to 10 μ l, after mixing, of short duration centrifugal; In PCR instrument after 65 DEG C of insulation 5min, rapidly at chilling 2min on ice; Of short duration centrifugal after, in above-mentioned pipe, be formulated as follows inverse transcription reaction liquid:

RNase free dH2O is supplemented to 20 μ l systems, after mixing, of short duration centrifugal; Following program is completed: 42 DEG C, 60min in PCR instrument; 70 DEG C, 15min; 4 DEG C, preserve.CDNA is stored in-80 DEG C.

The synthesis of the second chain:

The gene clone screening of the 3rd step, the rapid frog (Amolops hainanensis) the antibacterial peptide Hainanenin-1 in Hainan

1, design of primers

According to the signal peptide conserved sequence design forward degenerated primer of the batrachia antibacterial peptide precursor reported

5’-CCAAAGATGTTSMCCWYGAAG-3’(M＝A or C；W＝A or T；Y＝C or T)。The centrifugal 5min of first 12000rpm before primer uses, then adds the ddH of respective volume according to the mole number indicated ₂o is dissolved to 20 μMs of concentration.

2, pcr amplification

With the skin cDNA of synthesis for template, combine the adapter-primer built storehouse test kit and provide with above-mentioned degenerated primer: 3 '-primer:5 '-ATTCTAGAGGCCGAGGCGGCCGAC-3 ', carry out pcr amplification.Following reagent (cumulative volume 20 μ l) is added in 0.2ml PCR pipe:

After mixing, of short duration centrifugal.PCR condition is: 94 DEG C of sex change 5min; 30 circulations: 94 DEG C of sex change 30s, 56 DEG C of annealing 30s, 72 DEG C extend 40s; 72 DEG C extend 10min; 4 DEG C of preservations.After reaction terminates, get 5 μ l products in 1% agarose gel electrophoresis testing goal band.

3, object fragment reclaims

The rear glue that increased reclaims test kit (sky root is biological) and carries out the recovery of object fragment.By the target DNA fragment of recovery and sequencing vector pMD ^tM19-T vector connects, and is transformed into CaCl ₂-MgCl ₂the DH5 α competent cell that method prepares.Getting 100 μ l transformed bacteria liquid is uniformly coated on the LB nutrient agar flat board containing 100 μ g/ml penbritins (Amp); After surface is dried, be placed in 37 DEG C of constant incubators to be inverted and cultivate 12-16h, the bacterium colony grown carries out lower step bacterium colony PCR and measures.

4, object fragment sequence measures

Picking list bacterium colony does template, and with M13-F and M13-R for primer, bacterium colony PCR detects Insert Fragment size in single bacterium colony.

Primer sequence is as follows:

M 13-F：5’-GTAAAACGACGGCCAGTG-3’

M 13-R：5’-CAGGAAACAGCTATGACC-3’

The positive colony selected containing object fragment delivers to the order-checking of DNA sequencing company.In sequencing result and GeneBank database, sequence is compared.

The gene sequencing of the 4th step, the rapid frog (Amolops hainanensis) the antibacterial peptide Hainanenin-1 precursor in Hainan and result: the gene of the rapid frog (Amolops hainanensis) the antimicrobial peptide Hainanenin-1 precursor in coding Hainan is made up of 320 Nucleotide, from 5 ' end to 3 ' terminal sequence is:

1 ATGTTGCCCT TGAAGAAATC CATGTTACTC CTTTTCTTCC TTGGGACCAT CAACTTATCT

61 CTCTGTGAGC AAGAGAGAGA TGCCGAAGAA GAAAGAAGAG ACGATGAAGA TAAAAGGGAT

121 GTTGAAGTGG AAAAACGATT TGCATTAGGT GCGGTTACTA AGCTTTTGCC ATCACTGTTA

181 TGTATGATTA CCAGAAAATG TTGAAGCTTG AGCTGGAAAT CATCTGATGA GAAATATAAT

241 TTAGCTAAAT GCACATCAGA TATCTTATAA AAAATAAAAA TTCTCACATA TAAAAAAAAA

301 AAAAAAAAAA AAAAAAAAAA

The sequence table of the cDNA Nucleotide of the rapid frog (Amolops hainanensis) antimicrobial peptide hainanenin-5 coding region, Hainan is: sequence length is 320 bases, sequence type: nucleic acid, chain number: strand, topology: ring texture, sequence kind: cDNA, source: the rapid frog (Amolops hainanensis) skin histology in Hainan.

Embodiment 3

The chemical synthesis process of antimicrobial peptide Hainanenin-1:

1, according to the mature peptide Hainanenin-1 aminoacid sequence of inferring, its complete sequence is synthesized, by HPLC reversed phase column chromatography desalting and purifying with automatic Peptide synthesizer (Applied Biosystems).

2, molecular weight determination adopts Matrix Assisted Laser Desorption ionization time of flight mass spectrometry (MALDI-TOF-MS).

Embodiment 4

The pharmacological evaluation of antimicrobial peptide Hainanenin-1:

1.Hainanenin-1 antimicrobial acivity detects:

1.1 inhibition zone analytical methods: the Hainanenin-1 of chemosynthesis is dissolved in aseptic ultrapure water with the concentration of 2mg/ml.Microbionation, on Luria-Bertani (LB) solid medium, is inverted in 37 DEG C of incubators and is cultivated.After bacterium colony grows, be spread evenly across LB solid culture primary surface with transfering loop picking list bacterium colony, the little filter paper being 0.5cm by the diameter through sterilizing is pasted on media surface, gets 10 μ l testing samples and drips on filter paper.Be inverted in 37 DEG C of incubators and cultivate 18-20h, observe inhibition zone and whether formed, have inhibition zone to be formed and then represent that sample has bacteriostatic activity.The size of inhibition zone can weigh the power of anti-microbial activity.Record to the bacterial strain of Hainanenin-1 sensitivity.

1.2Hainanenin-1 measures sensitive strain minimal inhibitory concentration (Minimum Inhibitory Concentration, MIC).

This experiment makes positive control with conventional antibiotic penbritin, and sterile liquid MH makes negative control; Minimal inhibitory concentration is defined as the minimum peptide concentration suppressing microorganism growth completely that naked eyes can be observed, or absorbance value is not higher than the minimum concentration of negative control 5%.

The microorganism that picking newly activates, is seeded to sterile liquid MH substratum, and in 37 DEG C of constant temperature oscillators, 200rpm cultivates 10-16h to logarithmic phase; Survey the light absorption value at bacterium liquid 600nm light wave place with ultraviolet spectrophotometer, when light absorption value is 1, concentration is approximately 10 ⁹cFU/ml, is diluted to 10 by bacterium liquid sterile liquid MH substratum ⁶cFU/ml, stand-by on ice; On 96 microwell plates, compound concentration gradient is the Hainanenin-1 sample solution through 0.22 μm of aperture membrane filtration of 200 μ g/ml, 100 μ g/ml, 50 μ g/ml, 25 μ g/ml, 12.5 μ g/ml, 6.25 μ g/ml, 3.13 μ g/ml, 1.56 μ g/ml, 0.78 μ g/ml, 0.39 μ g/ml, 0.20 μ g/ml, every hole 50 μ l; Every hole adds 50 μ l above-mentioned dilution bacterium liquid; In constant temperature oscillator 37 DEG C, 100rpm shaking culture 18h; Microplate reader is used to survey 600nm light absorption value or visual inspection; Above-mentioned experiment repeats 3 times, averages.

From table 1, we can find out that Hainanenin-1 shows the strong anti-microbial activity of wide spectrum, particularly to the endurance strain of clinical separation.Much less than penbritin of the test result display MIC of Hainanenin-1 to many bacterium, illustrate that the anti-microbial activity of Hainanenin-1 to these bacterium is stronger than penbritin.Such as in the gram-positive microorganism of 5 kinds of tests, Hainanenin-1 is the strongest to the anti-microbial activity of faecium 1299, and MIC is only 4.69 μ g/ml, and positive control penbritin is to the MIC > 100 μ g/ml of faecium.Hainanenin-1, except having anti-microbial effect to gram-positive microorganism and Gram-negative bacteria, also has the MIC that stronger anti-mycotic activity such as Hainanenin-1 dialogue reads ATCC2002 and is only 2.34 μ g/ml.

The anti-microbial activity of table 1 Hainanenin-1 antimicrobial peptide

^*mIC: minimal inhibitory concentration, concentration value is the mean value repeating for 3 times to test; > 100 μ g/ml:2mg/ml dosage scraps of paper bacteriostatic test has inhibition zone, and 100 μ g/ml dosage are without bacteriostatic activity; IS: Clinical isolation.Above result is independently repeat laboratory mean values three times.

2, the hemolytic activity analysis of Hainanenin-1

This experiment makes positive control with 1%Triton X-100, makes negative control with physiological saline.Prepare red corpuscle: get 1ml human blood, be placed in 15ml centrifuge tube, add 10ml physiological saline, the centrifugal 5min of 2000rpm after mixing, resuspended with physiological saline, repeated centrifugation is not to supernatant liquor takes on a red color; With the resuspended erythroprecipitin of 1ml physiological saline, the re-suspension liquid that takes a morsel adds in small beaker, with normal saline dilution to being blush; Often kind of test sample preparation 1000 μ l system:

10 μ l polypeptide sample+990 μ l erythrocyte diluting fluids Hainanenin-1 (final concentration is 20 μ g/ml)

10 μ l 1 ‰ Triton X-100+990 μ l erythrocyte diluting fluid positive controls

10 μ l physiological saline+990 μ l erythrocyte diluting fluid negative controls

3 repetition systems are respectively done in Hainanenin-1 and positive and negative contrast.The centrifugal 5min of 37 DEG C of incubation 30min, 3000rpm; Collect supernatant 200 μ l, survey 540nm place absorbance value respectively, calculate 3 mean values repeated; Hemolysis rate=(sample 540nm absorbance value-negative control) × 100%/(positive control-negative control).

Experimental result shows, when Hainanenin-1 concentration is 25 μ g/ml and 50 μ g/ml (5 ~ 10 times for minimal inhibitory concentration), it is only 10.72% and 12.34% respectively to the hemolysis rate of human red cell, shows its strong selectivity to microorganism cells.

Claims

1. the purposes of the rapid frog antimicrobial peptide Hainanenin-1 in Hainan in the medicine preparing cause pathogeny imcrobe infection disease, it has the effect of anti-microbial infection; Described Hainan rapid frog antimicrobial peptide Hainanenin-1 is a kind of ring type polypeptide of C end containing seven yuan of Rana Box separated from the rapid frog Skin exudate in Hainan, molecular weight is 2278.90 dalton, iso-electric point is 9.50, and polypeptide complete sequence primary structure is: phenylalanine-Ala-Leu-Gly-Ala-α-amino-isovaleric acid-thr-lys-Leu-Leu-proline(Pro)-serine-leucine-leucine-halfcystine-methionine(Met)-isoleucine-threonine-arginine-lysine-halfcystine;

The gene of antimicrobial peptide Hainanenin-1 precursor is made up of 320 Nucleotide, from 5 ' end to 3 ' terminal sequence is:

Coding Hainan rapid frog mature peptide Hainanenin-1 is 139-201 position Nucleotide.

2. purposes according to claim 1, is characterized in that, Hainanenin-1 antimicrobial peptide is dissolved in sterilizing ultrapure water, detects for pharmacologically active.