CN105175523A - Simulium bannaense antibacterial peptide SibaCec, and genes and applications thereof - Google Patents
Simulium bannaense antibacterial peptide SibaCec, and genes and applications thereof Download PDFInfo
- Publication number
- CN105175523A CN105175523A CN201510407103.4A CN201510407103A CN105175523A CN 105175523 A CN105175523 A CN 105175523A CN 201510407103 A CN201510407103 A CN 201510407103A CN 105175523 A CN105175523 A CN 105175523A
- Authority
- CN
- China
- Prior art keywords
- antibacterial peptide
- sibacec
- simulium
- bannaense
- version
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/43504—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates
- C07K14/43563—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from insects
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- A61K38/1767—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Zoology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Gastroenterology & Hepatology (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Animal Behavior & Ethology (AREA)
- Insects & Arthropods (AREA)
- Epidemiology (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Pharmacology & Pharmacy (AREA)
- Tropical Medicine & Parasitology (AREA)
- Toxicology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Genetics & Genomics (AREA)
- Molecular Biology (AREA)
- Engineering & Computer Science (AREA)
- Peptides Or Proteins (AREA)
Abstract
The invention relates to a Simulium bannaense antibacterial peptide SibaCec, and genes and applications thereof, and belongs to the technical field of biomedicine. The Simulium bannaense antibacterial peptide SibaCec is a straight chain polypeptide containing 34 amino acid residues; the molecular weight is 3432.12 Da; and isoelectric point is 10.73. The genes used for coding a precursor of the Simulium bannaense antibacterial peptide SibaCec are characterized in that: GenBank accession KT223121 is composed of 272 nucleotide sequences, and the nucleotide sequence is represented by SEQ ID NO:2; the 70 to 171th nucleotides are used for coding the mature sequence of the Simulium bannaense antibacterial peptide SibaCec, and the amino acid sequence is represented by SEQ ID NO:1. The invention also discloses applications of the Simulium bannaense antibacterial peptide SibaCec in preparation of medicines used for treating pathogenic microorganism infection diseases. The coding genes of the Simulium bannaense antibacterial peptide SibaCec are obtained via cloning, and the Simulium bannaense antibacterial peptide SibaCec is obtained via chemical synthesis. The Simulium bannaense antibacterial peptide SibaCec possesses excellent killing effects on escherichia coli, pseudomonas aeruginosa, salmonella typhimurium, and acinetobacter baumannii, and is low in molecular weight, simple in structure, and low in hemolytic activity; and a preparation method is simple.
Description
Technical field
The present invention relates to a kind of hematophagous bug version receive rope buffalo gnat (
simuliumbannaense) antibacterial peptide
sibacec and gene thereof and application, belong to field of biomedicine technology.
Background technology
The current drug resistance problems caused by microbiotic is increasingly serious, and the potential using value of polypeptide class antimicrobial (antibacterial peptide) medicine causes the research interest of various countries scientific research personnel.Antibacterial peptide is a kind of novel antimicrobial polypeptide, and most of antibacterial peptide molecular weight is less than 10000 dalton, positively charged, is rich in hydrophobic bases, can form amphipathic structure.Research shows, antibacterial peptide can kill the pathogenic micro-organism such as various Gram-positive and negative bacteria, fungi, parasite at low concentrations fast, and can kill kinds of tumor cells, suppresses breeding and the diffusion of virus.In addition, they, also without aberration inducing effect, without cumulative toxicity, are not easy to develop immunity to drugs.The data of some preclinical phases show, antibacterial peptide is all effective for local infection and systemic infection, promises to be antimicrobial agents of new generation.
Insect is biotic population maximum on the earth, and except ocean, all the other all ecotopes have the distribution of insect.Insect has highly single-minded acquired immune system unlike higher animal, in insect body, namely lack T and bone-marrow-derived lymphocyte system, also without immune globulin bletilla complement system.But insect can still occupy population advantage in the middle of the natural evolution of several hundred million years, show that it should have very powerful innate immune system, make insect can resist the invasion and attack of many microorganisms in environment.Research shows, the innate immune system of insect can synthesize the various germs that multiple antibacterial peptide directly kills invasion body by rapid, high volume.In addition, they can also play various defense function indirectly by participating in, regulating the immunity system of body.At present, from the antibacterial peptide in insect source, the study hotspot that potential antibiotic substitute is current educational circles is screened.These antibacterial peptides have different structures and anti-microbial activity, are the good template storehouses of novel polypeptide class antimicrobial agents exploitation.Hematophagous bug version receives rope Simulium in Insecta Diptera Simulidae Simulium, and be mainly distributed in Xishuangbanna of Yunnan province, there is not been reported for the antibacterial substance composition in its body.
Summary of the invention
A kind of version with broad spectrum antimicrobial (gram negative bacterium) is newly the object of the present invention is to provide to receive rope buffalo gnat antibacterial peptide and gene and application.
For achieving the above object, the technical solution used in the present invention is:
(1) version receives rope buffalo gnat antibacterial peptide
sibacec: antibacterial peptide
sibacec is that Chinese hematophagous bug version receives a kind of straight-chain polypeptide of rope buffalo gnat antibacterial peptide gene coding, containing 34 amino-acid residues, and molecular weight 3432.12 dalton, iso-electric point 10.73.Polypeptide complete sequence primary structure (aminoacid sequence SEQIDNO:1) is:
Gly
1-Lys
2-Leu
3-Thr
4-Lys
5-Asp
6-Lys
7-Leu
8-Lys
9-Arg
10-Gly
11-Ala
12-Lys
13-Lys
14-Ala
15-Leu
16-Asp
17-Val
18-Ala
19-Ser
20-Lys
21-Val
22-Ala
23-Pro
24-Ile
25-Val
26-Ala
27-Ala
28-Gly
29-
Ala
30-Ser
31-Ile
32-Ala
33-Arg
34。
(2) version receives rope buffalo gnat antibacterial peptide
sibathe gene clone of Cec precursor: version receives rope buffalo gnat sialisterium Total RNAs extraction, and mRNA purifying, mRNA reverse transcription and cDNA library build, design primer, utilize PCR method to screen antibacterial peptide
sibacec gene.Amplimer length is 23 Nucleotide, and its sequence is another amplimer of 5 ' ATGAACTTCAGAAATCTTTTCAT3 ', PCR is CLONTECH company SMART
tM3 ' PCRPrimer primer in cDNALibraryConstructionKit, its sequence is 5 ' ATTCTACAGGCCGAGGCGGCCGACATG3 '.The positive monoclonal that obtains carries out gene nucleotide series mensuration.The sequencing result version that shows to encode is received the gene of rope buffalo gnat antibacterial peptide precursor and be made up of (GenBankaccessionKT223121) 272 Nucleotide (SEQIDNO:2), and it is held to 3 ' terminal sequence from 5 ' and is:
atgaacttcagaaatcttttcatcattgttgccatagttatgctcgctgtttttggccaa60
accgaagctgggaaactaaccaaagacaaactaaaacgtggcgctaagaaggcattagac120
gtggcttcgaaggttgccccgattgtagccgctggagcatcgattgcgcgaggttaaggc180
ccatggattcgagtgatgacacagaggcacgcttagagcgtaactaataaaatcaaagaa240
cgttaagatccagaaaaaaaaaaaaaaaaaaa272
(3) version receives preparation method's (ordinary method) of rope buffalo gnat antibacterial peptide: the mature peptide aminoacid sequence of deriving according to gene, adopts automatic its aminoacid sequence of Peptide synthesizer chemosynthesis, C-terminal amidation.By the anti-phase C of HPLC
18column chromatography desalination, purifying.Then its purity is identified by HPLC method, molecular weight determination adopts fast atom bombardment mass spectroscopy(FABMS) method (Fastatombombardmentmassspectrometry, FAB-MS), isoelectric focusing electrophoresis measures iso-electric point, measures amino acid sequence structure with automatic Protein Sequencer.
Version of the present invention receives rope buffalo gnat antibacterial peptide
sibacec is as the application of medicine preparing cause pathogeny imcrobe infection disease.
Beneficial effect of the present invention is: the present invention clone obtains version and receives rope buffalo gnat antibacterial peptide
sibathe encoding gene of Cec, utilizes the method for chemosynthesis to synthesize
sibacec.This antibacterial peptide has strong killing action to intestinal bacteria, Pseudomonas aeruginosa, Salmonella typhimurium and Acinetobacter baumannii, has that molecular weight is little, structure is simple, hemolytic activity is low, the simple beneficial features of preparation method in addition.
Embodiment
Further illustrate essentiality content of the present invention by embodiment below, but content of the present invention is not limited thereto.
embodiment one, version receive rope buffalo gnat antibacterial peptide
sibathe gene clone of Cec precursor
(1), version receives rope buffalo gnat sialisterium Total RNAs extraction:
A. version receives rope buffalo gnat in dissecting microscope Xia Qu salivary organization, and accumulation 300mg sample, adds 3mlTrizol solution, homogenate 30 minutes in 20ml glass homogenizer.
B. add equal-volume phenol/chloroformic solution, acutely mix, room temperature places 10 minutes, 4 DEG C, centrifugal 10 minutes of 12000rpm, and reject precipitates.
C. supernatant adds isopyknic Virahol, and room temperature places 10 minutes, 4 DEG C, 12000rpm, centrifugal 10 minutes, and precipitation is washed once with 75% ethanol, dries, and throw out at the bottom of pipe is version and receives buffalo gnat sialisterium total serum IgE of restricting.
(2), version receives the purifying of rope buffalo gnat sialisterium mRNA:
Version is received rope buffalo gnat sialisterium mRNA separation and purification and is adopted the PolyATtract of PROMEGA company of the U.S.
?mRNAIsolationSystems test kit.
A. the version extracted is received rope buffalo gnat sialisterium total serum IgE and is dissolved in 500 μ lDEPC water, puts into 65 DEG C of water-baths 10 minutes, adds Oligo (dT) probe and 13 μ l20 × SSC solution of people 3 μ l, mixing, place room temperature cooling, be called A liquid.
B. the washing of magnetic bead (SA-PMP): magnetic bead is flicked mixing, adsorbs 30 seconds, abandon supernatant, add 0.5 × SSC0.3m1 to magnetic frame, adsorb 30 seconds to magnetic frame, finally adds 0.1ml0.5 × SSC and suspends, be referred to as B liquid.
C. add in B liquid by A liquid, room temperature places 10 minutes, adsorbs 30 seconds to magnetic frame, abandon supernatant, wash 4 times with 0.1 × SSC, finally abandon supernatant, add 0.LmlDEPC aqueous suspension, adsorb 30 seconds to magnetic frame, supernatant is moved to new test tube, then adds 0.15m1DEPC water Eddy diffusion, adsorb 30 seconds to magnetic frame, move supernatant to above-mentioned test tube, then in supernatant for the version of purifying receives rope buffalo gnat sialisterium mRNA.
D. add 1/10 volume 3M sodium acetate, pH5.2, equal-volume Virahol, place 30 minutes in-70 DEG C, 4 DEG C, centrifugal 10 minutes of 12000rpm, abandons supernatant, is precipitated and dissolved in 10 μ lDEPC water.
(3) version is received rope buffalo gnat sialisterium cDNA library and is built:
Adopt CLONTECH company Creator
tMsMART
tMcDNALibraryConstructionKit Construction of Plasmid cDNA Library test kit.
A.cDNA first chain synthesis (mRNA reverse transcription):
Add 1 μ l version at the centrifuge tube that 0.5ml is aseptic and receive rope buffalo gnat sialisterium mRNA, 1 μ lSMARTIV oligonucleotide, 1 μ lCDSIII/3 ' PCR primer, add 2 μ l deionized waters and make cumulative volume reach 5 μ l.
Reagent in mixing centrifuge tube with 12000rpm centrifugal 15 seconds, 72 DEG C of insulations 2 minutes.Centrifuge tube is hatched 2 minutes on ice.Following reagent 2.0 μ l5 × the first chain buffering, 1.0 μ l20mM dithiothreitol (DTT), 1.0 μ l10mMdNTP mixtures, 1.0 μ lPowerScript ThermoScript II are added in centrifuge tube.Reagent in mixing centrifuge tube with 12000rpm centrifugal 15 seconds, 42 DEG C of insulations 1 hour.Centrifuge tube is placed in and stops the first chain synthesis on ice.CDNA first chain got synthesized by 2 μ l from centrifuge tube is for subsequent use.
B. long end polymeric polymerase chain reaction (LD-PCR) method is adopted to increase the second chain
2 μ lcDNA first chains (mRNA reverse transcription), 80 μ l deionized waters, 10 μ l10 × Advantage2PCR bufferings, 2 μ l50 × dNTP mixtures, 2 μ l5 ' PCR primer, 2 μ lCDSIII/3 ' PCR primer and 2 μ l Escherichia coli polymerase centrifuge tubes are reacted by 95 DEG C of preheating PCR instrument.By following program amplification in PCR instrument: 95 DEG C, 20 seconds; 22 circulations (95 DEG C, 5 seconds; 68 DEG C, 6 minutes).After loop ends, the cDNA double-strand of synthesizing in centrifuge tube is carried out extracting.
The C.PCR product Wizard of PROMEGA company
?sVGelandPCRClean-UpSystem test kit carries out extracting and reclaiming, and step is as follows:
The cDNA double-strand obtained by PCR is added isopyknic film binding buffer and puts upside down mixing, then mixed liquid is proceeded to centrifugal purification post, room temperature leaves standstill 5 minutes, and DNA is fully combined with pellosil.Centrifugal 30 seconds of 12000rpm, outwells the waste liquid in collection tube.The elutriant (containing ethanol) adding 700 μ l, in centrifugal purification post, with 12000rpm centrifugal 30 seconds, outwells the waste liquid in collection tube.Repeating step 2.Centrifugal 5 minutes of 12000rpm, is placed in new centrifuge tube by centrifugal purification post.Add 30 μ l ultrapure waters, at room temperature leave standstill 5 minutes.Centrifugal 30 seconds of 12000rpm, solution at the bottom of pipe is the cDNA double-strand of purified mistake.
D. the preparation of bacillus coli DH 5 alpha competent cell:
Picking single DH5 α bacterium colony, is inoculated in 3ml containing the Luria-Bertani(LB of penbritin) in substratum, 37 DEG C of overnight incubation, get next day above-mentioned bacterium liquid in proportion 1:100 be inoculated in 50mlLB nutrient solution, 37 DEG C of vibrations 2 hours.Work as OD
600when value reaches 0.35, results bacterial cultures.Transferred to by bacterium in aseptic, disposable, an ice-cold 50m1 polypropylene tube, on ice, side puts 10 minutes, makes culture be cooled to 0 DEG C.In 4 DEG C with 4100rpm centrifugal 10 minutes, reclaim cell.Pour out nutrient solution, pipe is inverted and within l minute, flows to end to make last trace nutrient solution.Every 50ml initial incubation liquid and the 0.1mol/LCaCl of 30ml precooling
2-MgCl
2solution (80mmol/LMgCl
2, 20mmol/LCaCl
2) resuspended every part of cell precipitation.
In 4 DEG C with 4100rpm centrifugal 10 minutes, reclaim cell.Pour out nutrient solution, pipe is inverted and within l minute, flows to end to make last trace nutrient solution.The ice-cold 0.1mol/LCaCl of every 50m1 initial incubation thing 2m1
2resuspended every part of cell precipitation, for subsequent use after packing.
E. the conversion of product is cut, connects and connected to enzyme:
In Eppendorf tube, add 1 μ lTakarapMD18-T carrier, 4 μ l versions receive rope buffalo gnat cDNA double-strand solution, full dose is 5 μ l.Add 5 μ l(equivalent) ligase enzyme buffer mixture.16 DEG C are reacted 2 hours.Full dose (10 μ l) is added in 100 μ lDH5 α competent cells, places 30 minutes in ice.42 DEG C heating 90 seconds after, then in ice place 1 minute.Add 37 DEG C of LB substratum 890 μ l of bathing of temperature, 37 DEG C of slow shaking culture 60 minutes.To get on LB substratum that 200 μ l coat containing X-Gal, IPTG, Amp 37 DEG C to cultivate 16 hours, form single bacterium colony.Each LB plate 5mlLB liquid nutrient medium washing bacterium colony, adds 30% glycerine frozen.The cDNA built is approximately containing 1 × 10
6individual independent clone.
(4), version receives rope buffalo gnat antibacterial peptide gene
sibathe colony screening of Cec precursor:
Amplimer sequence is another amplimer of 5 ' ATGAACTTCAGAAATCTTTTCAT3 ', PCR is CLONTECH company SMART
tM3 ' PCRPrimer primer in cDNALibraryConstructionKit, its sequence is 5 ' ATTCTAGAGGCCGAGGCGGCCGACATG3 '.
PCR reaction is carried out under the following conditions: 94 DEG C, 30 seconds; 52 DEG C, 45 seconds; 72 DEG C, 2 point of 30 second, totally 35 circulations.
First the bacterium cDNA library of titration structure, then suitable bacterial concentration (about 5000 bacteria/milliliters are diluted to the LB substratum containing 100 μ g/ml penbritins, be respectively used to first run screening second with 30 bacteria/milliliters and take turns screening), by 8 × 8 matrix bed boards (totally 64 holes on 96 well culture plates, every hole 100 μ l), 37 DEG C of incubated overnight.Merge inoculum respectively by row, column, have 16 samples to carry out PCR qualification, positive hole bacteria samples of intersecting enters second and takes turns screening.
(5), version receives rope buffalo gnat antibacterial peptide gene sequencing and result:
Extract plasmid DNA dideoxy method and measure nucleotide sequence, use instrument is the full-automatic nucleotide sequencing instrument of U.S. AppliedBiosystems373A, and sequencing primer is BcaBEST
tMsequencingPrimerRV-M and BcaBEST
tMsequencingPrimerM13-47, BcaBEST
tMsequencingPrimerRV-M sequence: 5`GAGCGGATAACAATTTCACACAGG3 ', BcaBEST
tMsequencingPrimerM13-47:5 ' CGCCAGGGTTTTCCCAGTCACGAC3 '.
Gene sequencing result shows that coding version receives rope buffalo gnat antibacterial peptide
sibathe gene of Cec precursor is made up of (GenBankaccessionKT223121) 272 Nucleotide (SEQIDNO:2), from 5 ' end to 3 ' terminal sequence is:
atgaacttcagaaatcttttcatcattgttgccatagttatgctcgctgtttttggccaa60
accgaagctgggaaactaaccaaagacaaactaaaacgtggcgctaagaaggcattagac120
gtggcttcgaaggttgccccgattgtagccgctggagcatcgattgcgcgaggttaaggc180
ccatggattcgagtgatgacacagaggcacgcttagagcgtaactaataaaatcaaagaa240
cgttaagatccagaaaaaaaaaaaaaaaaaaa272
embodiment two, version receive rope buffalo gnat antibacterial peptide
sibathe preparation (ordinary method) of Cec:
(1) version receives rope buffalo gnat antibacterial peptide
sibathe chemical synthesis process of Cec: the mature peptide aminoacid sequence of deriving according to gene, synthesizes its complete sequence with automatic Peptide synthesizer (433A, AppliedBiosystems), by the desalination of HPLC reversed phase column chromatography.
(2) molecular weight determination adopts Matrix Assisted Laser Desorption ionization time of flight mass spectrometry (MALDI-TOF).
(3) version of synthesizing receives rope buffalo gnat antibacterial peptide
sibacec high-efficient liquid phase chromatogram HPLC method identifies its purity, and molecular weight determination adopts Matrix Assisted Laser Desorption ionization time of flight mass spectrometry (MALDI-TOF), and isoelectric focusing electrophoresis measures iso-electric point, measures amino acid sequence structure with automatic Protein Sequencer.
Version receives rope buffalo gnat antibacterial peptide
sibacec is that version receives rope buffalo gnat antibacterial peptide
sibaa kind of straight-chain polypeptide of Cec precursor-gene 70-171 position nucleotide coding, containing 34 amino-acid residues, molecular weight 3432.12 dalton, iso-electric point 10.73.Version receives rope buffalo gnat antibacterial peptide
sibacec complete sequence (SEQIDNO:1) is:
Gly
1-Lys
2-Leu
3-Thr
4-Lys
5-Asp
6-Lys
7-Leu
8-Lys
9-Arg
10-Gly
11-Ala
12-Lys
13-Lys
14-Ala
15-Leu
16-Asp
17-Val
18-Ala
19-Ser
20-Lys
21-Val
22-Ala
23-Pro
24-Ile
25-Val
26-Ala
27-Ala
28-Gly
29-
Ala
30-Ser
31-Ile
32-Ala
33-Arg
34, C-terminal amidation.
embodiment three, version receive rope buffalo gnat antibacterial peptide
sibathe pharmacological evaluation of Cec
(1) version receives rope buffalo gnat antibacterial peptide
sibathe anti-microbial activity of Cec detects:
Using Luria-Bertani (LB) liquid nutrient medium as developing medium.Strains tested, after the recovery of LB solid medium, becomes every milliliter containing 2 × 10 with sterilized water dilution bacterium colony
5the bacterium liquid of individual bacterium, for subsequent use.
When measuring minimal inhibitory concentration, doubling dilution is adopted to carry out antibacterial detection.Concrete grammar is as follows: in 0.19ml substratum, add 0.01ml sample as the first hole, get 0.1ml after mixing and add the 2nd hole (having added as 0.1ml fresh culture), doubling dilution successively, discard from the 6th hole sucking-off 0.1ml, the contrast of surrounding each hole system, will add the bacterium liquid (2 × 10 corrected in each hole
5cfu/ml) 0.1ml, places 37 DEG C and cultivates 18 hours, measure photoabsorption in 600nm wavelength place after mixing.Minimal inhibitory concentration is cannot see the minimum sample concentration of bacterial growth.Bacterial isolates derives from Kunming Medical University, and this test repetition four times, average, result is as table 1.
Table 1, version receives rope buffalo gnat antibacterial peptide
sibathe effect of Cec bacteria growing inhibiting:
Known by table 1, version receives rope buffalo gnat antibacterial peptide
sibacec has the significant effect suppressing gram negative bacterium growth.
(3) version receives rope buffalo gnat antibacterial peptide
sibathe hemolytic activity of Cec detects:
By the rabbit blood of collection and A Shi liquid (glucose 2.05 grams, Trisodium Citrate 0.8 gram, citric acid 0.055 gram, 0.42 gram, sodium-chlor, adding distil water to 100 milliliter, is transferred to 6.1 by pH value after heating for dissolving, autoclaving is for subsequent use after 15 minutes) mixing anti-freezing, brine 2 times resuspended one-tenth 10
7-10
8the suspension of cell/ml.The good red cell suspension of above-mentioned dilution and the version being dissolved in physiological saline receive buffalo gnat antibacterial peptide of restricting
sibacec sample mix, 37 DEG C of insulations 30 minutes, then in 1000rpm centrifugal 5 minutes, supernatant liquor surveys absorption value in 540nm.Negative control uses physiological saline, and positive control uses TritonX-100, and percent hemolysis calculates as follows: percent hemolysis (H%)=(A
sample-A
negative control)/A
positive control× 100%.When result shows that sample concentration is 100 μ g/ml, version receives rope buffalo gnat antibacterial peptide
sibathe percent hemolysis of Cec is 0.82%, illustrates that version receives rope buffalo gnat antibacterial peptide
sibacec has extremely low hemolytic activity, human erythrocyte can not be caused to break and dissolve and produce injury to human body, therefore extremely be beneficial to it in the further Application and Development of field of medicaments.
SEQUENCELISTING
<110> Kunming Medical University
<120> version receives rope buffalo gnat antibacterial peptide SibaCec and gene and application
<130>1
<160>2
<170>PatentInversion3.3
<210>1
<211>272
<212>DNA
<213>Simuliumbannaense
<400>1
atgaacttcagaaatcttttcatcattgttgccatagttatgctcgctgtttttggccaa60
accgaagctgggaaactaaccaaagacaaactaaaacgtggcgctaagaaggcattagac120
gtggcttcgaaggttgccccgattgtagccgctggagcatcgattgcgcgaggttaaggc180
ccatggattcgagtgatgacacagaggcacgcttagagcgtaactaataaaatcaaagaa240
cgttaagatccagaaaaaaaaaaaaaaaaaaa272
<210>2
<211>34
<212>PRT
<213>Simuliumbannaense
<400>2
GKLTKDKLKRGAKKALDVASKVAPIVAAGASIAR34
Claims (3)
1. a version receives rope buffalo gnat antibacterial peptide
sibacec, is characterized in that: this antibacterial peptide is that version receives a kind of straight-chain polypeptide of rope buffalo gnat antibacterial peptide gene coding, and containing 34 amino-acid residues, molecular weight 3432.12 dalton, iso-electric point 10.73, its aminoacid sequence is for shown in SEQIDNO:1.
2. version of encoding receives rope buffalo gnat antibacterial peptide
sibathe gene of Cec precursor, is characterized in that: GenBankaccessionKT223121 is made up of 272 nucleotide sequences, and its nucleotides sequence is classified as shown in SEQIDNO:2; Coding version receives rope buffalo gnat antibacterial peptide
sibacec mature sequence be the 70th – 171 Nucleotide, its aminoacid sequence is for shown in SEQIDNO:1.
3. version according to claim 1 receives rope buffalo gnat antibacterial peptide
sibacec is as the application of medicine preparing cause pathogeny imcrobe infection disease.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510407103.4A CN105175523B (en) | 2015-07-13 | 2015-07-13 | Version receives rope buffalo gnat antibacterial peptide SibaCec and its gene and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510407103.4A CN105175523B (en) | 2015-07-13 | 2015-07-13 | Version receives rope buffalo gnat antibacterial peptide SibaCec and its gene and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105175523A true CN105175523A (en) | 2015-12-23 |
| CN105175523B CN105175523B (en) | 2018-04-06 |
Family
ID=54898028
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510407103.4A Expired - Fee Related CN105175523B (en) | 2015-07-13 | 2015-07-13 | Version receives rope buffalo gnat antibacterial peptide SibaCec and its gene and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105175523B (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102250216A (en) * | 2011-06-27 | 2011-11-23 | 昆明理工大学 | Rana nigromaculata antimicrobial peptide as well as gene and application thereof |
| CN104031135A (en) * | 2014-06-25 | 2014-09-10 | 昆明医科大学 | Tree frog defence peptide PopuDef as well as gene and application thereof |
| CN104356216A (en) * | 2014-10-09 | 2015-02-18 | 昆明医科大学 | SibaDef of blood sucking insect, as well as gene and application thereof |
| CN104558121A (en) * | 2014-12-31 | 2015-04-29 | 常熟理工学院 | Tiger frog antibacterial peptide, and coding gene and application thereof |
-
2015
- 2015-07-13 CN CN201510407103.4A patent/CN105175523B/en not_active Expired - Fee Related
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102250216A (en) * | 2011-06-27 | 2011-11-23 | 昆明理工大学 | Rana nigromaculata antimicrobial peptide as well as gene and application thereof |
| CN104031135A (en) * | 2014-06-25 | 2014-09-10 | 昆明医科大学 | Tree frog defence peptide PopuDef as well as gene and application thereof |
| CN104356216A (en) * | 2014-10-09 | 2015-02-18 | 昆明医科大学 | SibaDef of blood sucking insect, as well as gene and application thereof |
| CN104558121A (en) * | 2014-12-31 | 2015-04-29 | 常熟理工学院 | Tiger frog antibacterial peptide, and coding gene and application thereof |
Non-Patent Citations (2)
| Title |
|---|
| L WEI等: "urification and characterization of a novel defensin from the salivary glands of the black fly, Simulium bannaense", 《PARASITES & VECTORS》 * |
| 蒋超: "《STN检索报告》", 1 December 2017 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105175523B (en) | 2018-04-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101412753A (en) | Bungarus fasciatus antibacterial peptide cathelicidin-BF, and genes and uses thereof | |
| CN106188265B (en) | A kind of antimicrobial peptide Cm-CATH2 and its gene, preparation method and application | |
| Apetrei et al. | Unimolecular study of the interaction between the outer membrane protein OmpF from E. coli and an analogue of the HP (2–20) antimicrobial peptide | |
| CN102924574B (en) | Antibacterial peptide LZ1 and application of antibacterial peptide in preparation of antibacterial medicament | |
| CN110156875B (en) | Antibacterial peptide H5-p5, and preparation method and application thereof | |
| CN104031135B (en) | Rhacophorus defense peptides PopuDef and gene thereof and application | |
| CN106220713A (en) | A kind of heat-resisting synthetic peptide of scorpion venom and application thereof | |
| CN102391362B (en) | Group of animal-derived cationic antibacterial peptides and its application | |
| CN104761629B (en) | A kind of broad-spectrum high efficacy antimicrobial peptide Pb CATH OH1 and its gene, preparation method and application | |
| CN104177485A (en) | Yangtze alligator antimicrobial peptide Alligatorin 6 and application thereof | |
| CN104163861B (en) | Reptile antibacterial peptide Alligatorin5 and applications thereof | |
| CN101824077A (en) | Large green frog antioxidant peptide (antioxidin-RL) as well as gene and application thereof | |
| CN114940701B (en) | Targeting antifungal peptide LI and preparation method and application thereof | |
| CN103848914A (en) | Bufrudin polypeptide with anticoagulant activity and preparation method and purpose thereof | |
| CN104356216B (en) | Version receives rope buffalo gnat defense peptides SibaDef and its gene and application | |
| CN105175523A (en) | Simulium bannaense antibacterial peptide SibaCec, and genes and applications thereof | |
| CN102516382B (en) | Antimicrobial peptide Hainanenin-5 of Amolops hainanensis, gene of antimicrobial peptide Hainanenin-5 of Amolops hainanensis, and application of gene of antimicrobial peptide Hainanenin-5 of Amolops hainanensis | |
| JPH04502904A (en) | Methods of administering amphipathic peptides and compositions thereof | |
| CN105085645A (en) | Antibacterial peptide SibaCec-A of Simulium bannaense and gene and application of antibacterial peptide | |
| CN102796176B (en) | Kunyuenin, preparation method and application | |
| CN101845092A (en) | Antimicrobial peptide Ea-CATH1 of Equus asinus and genes and application thereof | |
| CN102115496A (en) | Antimicrobial peptide Pc-CATH1 and gene thereof, chemical synthesis method and application thereof | |
| CN106399320B (en) | A kind of purposes of the gene of kaloula pulchra and its polypeptide of coding and the polypeptide | |
| CN103172721B (en) | Amolops hainanensis antimicrobial peptide Hainanenin-1, and gene, separation purification, chemical synthesis and application thereof | |
| CN106399319A (en) | Fejervarya multistriata gene, polypeptide encoded by same and application of polypeptide |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20180406 Termination date: 20180713 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |