CN103467580A

CN103467580A - Preparation method and application of artificial antimicrobial peptide MA-D4

Info

Publication number: CN103467580A
Application number: CN2013104272782A
Authority: CN
Inventors: 刘诚
Original assignee: Individual
Current assignee: Individual
Priority date: 2013-09-18
Filing date: 2013-09-18
Publication date: 2013-12-25
Anticipated expiration: 2033-09-18
Also published as: CN103467580B

Abstract

The invention relates to a preparation method of an application of an artificial antimicrobial peptide MA-D4. According to the invention, an amino acid sequence of the artificial antimicrobial peptide MA-D4 is designed artificially, and a nucleotide sequence encoding the antimicrobial peptide is designed by using an escherichia coli preference codon; a target gene is synthesized by an overlap region amplification gene splicing method, and a prokaryotic expression vector is constructed and is transformed into the escherichia coli BL21 or Rosetta for inducing expression; an expressed product is subjected to digestion treatment by enterokinase and is subjected to nickel ion affinity chromatography purification, so as to obtain the artificial antimicrobial peptide MA-D4. The antimicrobial peptide has higher broad-spectrum antibacterial activity, can inhibit gram-positive bacteria and gram-negative bacteria, and meanwhile, excludes hemolytic activity. Therefore, as a novel antimicrobial drug, the antimicrobial peptide has excellent application prospect on the aspects of food preservation, disease treatment and the like, and has very high developing potential. The preparation method is high in expression efficiency, easy in separation and purification, low in production cost and good in stability, therefore, the preparation method can be used for mass production.

Description

The preparation method of artificial antimicrobial peptide MA-D4 and application thereof

Technical field

The invention belongs to gene engineering technology field, be specifically related to preparation method and the application thereof of artificial antimicrobial peptide MA-D4.

Background technology

Microbiotic incorrect application widely on clinical treatment for a long time, make many pathogenic bacterias produce obvious resistance, now become the significant problem that threatens human and animal's health.Multiple antibiotic resistant strain more seriously occurred clinically, the superbug NDM-1 found in 2010 is all insensitive to most microbiotic especially.At present, developing a kind of new microbiotic generally needs about 10 years, and produce generation resistant organism, only needs 2 years.Anti-infective situation is very severe, and development and Design novel antibacterial medicine is extremely urgent.

Antibacterial peptide is the micromolecule polypeptide that can resist extraneous pathogenic infection that a class is produced by the host, is the important component part of biological innate immune defence system, by the specific gene coding, is produced.Its biological function has diversity, except possessing broad spectrum antibiotic activity, also possesses the biological activitys such as antitumor, antiviral, antimycotic, parasiticide.Antibacterial peptide extensively is present in various organisms, all is found in microorganism, plant and animal and successfully separates and obtain.Under suitable concentration, antibacterial peptide can interact with multiple-microorganism target position such as microbial film/wall moiety or born of the same parents' inner cell organs, and the former destroys the integrity of cytoplasmic membrane, and the eubolism activity of latter's interference cell finally causes bacterium death.The more important thing is that antibiotic Toplink is as immune effector molecule, start and regulate the host immune defense system, the protection host avoids the pathogenic micro-organism infringement.The mechanism of action of antibacterial peptide uniqueness, make it have the characteristics such as extensive, the difficult generation resistance of antimicrobial spectrum, and can play a role equally to the bacterial strain that has produced at present resistance.Therefore, antibacterial peptide maybe can substitute traditional microbiotic medicine, reverses the vicious cycle of microbiotic application, is the novel antibacterial medicine that a class possesses wide market outlook and development potentiality.

Batrachia skin is exposed, moist, it is fabulous microorganism living environment, but the needs of batrachia based on adapting to living environment, in long-term natural selection, formed gradually defense mechanism, the i.e. antibiotic peptide matters of, diverse in function special by skin secretion various structures, in order to resist the invasion and attack of pathogenic micro-organism.The magainin Magainin found from xenopous laevis skin, have 23 amino-acid residues, and molecular weight is about 2.5kD.Its natural isolate can show lethal effect to various bacteria, fungi, protobiont, tumour cell and virus under micromolar concentration.The cecropin D ermaseptin-4 found from leaf bubble frog skin, have 23 amino-acid residues equally, and molecular weight is about 2.5kD.Its natural isolate can show lethal effect to various bacteria, fungi and protobiont, especially pathogenic filamentous fungus and yeast.

In organism, antibacterial peptide content is lower, and the processing requirement of directly extracting is high, and difficulty is large, can't be applied to large-scale production.Can obtain the aminoacid sequence consistent with natural antibacterial peptide though artificial chemistry is synthetic, but usually can not form correct space structure, and, because there being expensive cost, make it only rest at present the laboratory test stage.By the synthetic artificial antimicrobial peptide of genetically engineered approach, it is ideal chose prepared by large-scale production.In addition, the biological activity of natural antibacterial peptide strong, exist cytotoxicity and hemolytic activity that it is applied to be subject to certain restrictions.Research shows, the different antibacterial peptide molecules of heterozygosis can effectively improve its biological activity, eliminates or reduces its cytotoxicity and hemolytic activity.There is no so far antibacterial peptide Magainin and Dermaseptin-4 heterozygosis and carry out efficient report of expressing.

Summary of the invention

The object of the invention is to solve existing natural antibacterial peptide biological activity low; and there is the problem of hemolytic activity; provide a kind of and there is high biological activity, without the artificial antimicrobial peptide MA-D4 of hemolytic activity; and the high efficiency preparation method based on escherichia expression system that is applicable to large-scale production, the application of artificial antimicrobial peptide MA-D4 for various bacteria is provided simultaneously.

Purpose of the present invention is achieved by the following technical programs.

According to the antibacterial peptide Magainin(No. 474452717 in GenBank) and Dermaseptin-4(No. P84924.1) the mature peptide aminoacid sequence, manually design the aminoacid sequence SEQ ID No.1 of the artificial antibacterial peptide MA-D4 of the present invention, adopt the nucleotide sequence of this antibacterial peptide of intestinal bacteria Preference codon design coding, and add respectively the nucleic acid restriction endonuclease recognition site at two ends, form goal gene sequence SEQ ID No.2.

Adopt the synthetic above-mentioned purpose gene of gene splicing by overlap extension.Design is 4 PCR primers of complementation in twos, and described primer P1, P2, P3 and P4 have respectively the nucleotide sequence shown in SEQ ID No.3, SEQ ID No.4, SEQ ID No.5 and SEQ ID No.6, by multistep PCR, obtain goal gene.

The goal gene obtained is connected with prokaryotic expression plasmid pET-32a (+), builds prokaryotic expression carrier, and be converted in e. coli bl21 or Rosetta screening-gene engineering positive bacteria.Add IPTG induced gene engineering bacterium expression, carry out SDS-PAGE after the ultrasonic treatment thalline, detect expressing quantity.

After using the enteropeptidase enzyme to cut the processing expression product, by the nickel ion affinity chromatograph purifying, obtain the artificial antibacterial peptide MA-D4 of the present invention.

Measure minimal inhibitory concentration (MIC) and the minimum bactericidal concentration (MBC) of artificial antimicrobial peptide MA-D4 for intestinal bacteria, streptococcus aureus, subtilis, Pseudomonas aeruginosa, streptococcus suis 2-type and anthrax bacillus by micro-dilution method.

By measuring the hemolysis rate of antibacterial peptide MA-D4 for mouse red blood cell, judge its hemolytic.

The present invention has actively useful effect.

The present invention is according to the antibacterial peptide Magainin in GenBank and Dermaseptin-4 mature peptide aminoacid sequence, manually design the artificial antibacterial peptide MA-D4 of the present invention, and adopt intestinal bacteria Preference codon to design the nucleotide sequence of this antibacterial peptide of coding, obtain in a large number artificial antimicrobial peptide MA-D4 by prokaryotic expression system.The experiment proved that the artificial antibacterial peptide MA-D4 of the present invention possesses stronger broad spectrum antibiotic activity, can suppress gram-positive microorganism and Gram-negative bacteria, do not there is hemolytic activity simultaneously.Therefore, it can be used as a class novel antibacterial medicine, at aspects such as food antiseptic, disease treatments, have a good application prospect, and great exploitation potential for its.

Preparation method's expression efficiency of the present invention is high, and the separation and purification process is simple, and production cost is low, and good stability can be applicable to large-scale production.

The accompanying drawing explanation

The multistep pcr amplification of Fig. 1 goal gene.

M. DNA molecular amount standard; 1. goal gene first half pcr amplification product; 2. goal gene latter half pcr amplification product; 3. complete goal gene pcr amplification product.

Fig. 2 is by nickel ion affinity chromatograph method purifying artificial antimicrobial peptide MA-D4.

M. protein molecular weight standard; 1. the solution of purification process; 2. the solution of purification process not.

Fig. 3 artificial antimicrobial peptide MA-D4 hemolytic activity detects.

Embodiment

Embodiment 1: build prokaryotic expression carrier and genetic engineering bacterium.

According to the antibacterial peptide Magainin(No. 474452717 in GenBank) and Dermaseptin-4(No. P84924.1) the mature peptide aminoacid sequence, the methionine(Met) (Met) of the 21st of antibacterial peptide Magainin is replaced to tryptophane (Trp), manually design the aminoacid sequence SEQ ID No.1 of the artificial antibacterial peptide MA-D4 of the present invention, wherein DDDDK is the enteropeptidase restriction enzyme site.Adopt afterwards the nucleotide sequence of this antibacterial peptide of intestinal bacteria Preference codon design coding, and add respectively nucleic acid restriction endonuclease at two ends xho

with bamH

recognition site, form goal gene, and sequence is as shown in SEQ ID No.2.

The goal gene sequence of design is 5 '-cac ctcgaggatgatgatgataaacatcatggtattggtaaatttctgcatagcgcaaaaa

Aatttggtaaagcatttgttggtgaaatttggaatagccatcatgcactgtggaaa gatattctgaaaaatgcaggtaaagcagcactgaatgaaattaatcagattgttca gcatcatgatgatgatgataaa ggatccaat-3 ', the total 204bp of total sequence, underscore is respectively nucleic acid restriction endonuclease xho

with bamH

recognition site.

Adopt the synthetic above-mentioned purpose gene of gene splicing by overlap extension.Design is 4 PCR primers of complementation in twos, wherein, between P1, P2, all contain 15 overlapping bases between P2, P3 and between P3, P4.Described primer P1, P2, P3 and P4 have respectively the nucleotide sequence shown in SEQ ID No.3, SEQ ID No.4, SEQ ID No.5 and SEQ ID No.6, and by Guangzhou English fine horse, biological company limited is synthetic.

Use above-mentioned primer to carry out multistep PCR and obtain goal gene.First take P1 and P2 is primer amplification goal gene first half sequence, then to take P3 and P4 be primer amplification goal gene latter half sequence, last before the twice PCR product be template, P1 and P4 are that primer amplification obtains complete goal gene.(50 μ L) is as follows for reaction system: 2 * Taq PCR Mastermix, 25 μ L, each 1.0 μ L of upstream primer and downstream primer, ddH ₂o 23 μ L.The PCR program is as follows: 95 ℃ of denaturation 5min; 94 ℃ of sex change 30s, 58 ℃ of annealing 30s, 72 ℃ are extended 30s, circulate 30 times; 72 ℃ are extended 10min eventually.After finishing, reaction use 1.0% sepharose to carry out the DNA electrophoretic analysis, referring to accompanying drawing 1.Product is through the order-checking of Shenzhen Hua Da Gene science Services Co., Ltd, and confirmation is in full accord with design, is placed in-20 ℃ of preservations.

Use xho

with bamH

nucleic acid restriction endonuclease carries out the double digestion operation to goal gene and the prokaryotic expression plasmid pET-32a (+) obtained simultaneously.After purifying enzyme is cut product, the goal gene fragment is connected with pET-32a (+) plasmid, builds prokaryotic expression carrier, and be converted in e. coli bl21 (DE3) pLysS or Rosetta, utilize Ampicillin Trihydrate evaluation and screening genetically engineered positive bacteria.Add the extensive induced gene engineering bacterium expression of IPTG target protein in the LB of 200mL liquid culture medium, collect thalline in 4 ℃ of centrifugal 10min of lower 5000r/min, ultrasonic treatment thalline after using PBS to clean three times, collect supernatant liquor after the centrifugal 15min of 12000r/min and carry out SDS-PAGE, the testing goal expressing quantity.

Embodiment 2: obtain and purifying artificial antimicrobial peptide MA-D4.

Use enteropeptidase, by the following enzyme system of cutting, expression product is carried out to enzyme and cut processing: 10 * Buffer, 10.0 μ L, ddH ₂o 38.0 μ L, target protein 50.0 μ L, enteropeptidase 2.0 μ L, be placed in 23 ℃ of lower 20h.

Utilize the HisPur Ni-NTA Spin Purification Kit of Thermo Scientific company, by the nickel ion affinity chromatograph purifying, obtain the artificial antibacterial peptide MA-D4 of the present invention.After by specification pre-treatment resin column, add with the enzyme of High-capacity nickel-IMAC resin equivalent and cut the supernatant liquor of processing, be placed in 4 ℃ of environment in conjunction with 1h after, eluted protein, collect elutriant and carry out the SDS-PAGE detection, referring to accompanying drawing 2.Obvious protein band is arranged between visible 4.6-10.0kD, meet the experimental design size, be artificial antimicrobial peptide MA-D4.Measuring its concentration by the Bradford method is 486.75 μ g/mL.

Embodiment 3: artificial antimicrobial peptide MA-D4 biological activity assay.

Measure minimal inhibitory concentration (MIC) and the minimum bactericidal concentration (MBC) of artificial antimicrobial peptide MA-D4 for intestinal bacteria, streptococcus aureus, subtilis, Pseudomonas aeruginosa, streptococcus suis 2-type and anthrax bacillus by micro-dilution method.Concrete experimental procedure is as follows: experimental strain is prepared into to 10 ⁶the bacterium liquid of cfu/mL, add respectively in 96 porocyte culture plates, every hole 90 μ L.Use PBS that artificial antimicrobial peptide MA-D4 solution is diluted to respectively to 40.0,20.0,10.0,8.0,6.0,4.0,2.0,1.0,0.5 μ g/mL, and add in 96 porocyte culture plates every hole 10 μ L.The blank group is set only containing the LB liquid culture medium, the condition control group only contains the bacterium liquid of experimental strain, and enzyme is cut control group and is added with without the target protein solution of enteropeptidase processing and the bacterium liquid of experimental strain.Be placed in 37 ℃ of incubators and spend the night, measure every hole next day oD _{600 nm}value.The minimum strength of solution of bacteria growing inhibiting is the MIC of artificial antimicrobial peptide MA-D4 for this experimental strain fully.Group more than MIC, in 1:100 ratio inoculation LB liquid culture medium, and is got to wherein 100 μ L and is uniformly coated on the LB solid medium, after being placed in 37 ℃ of incubator 12h, carry out enumeration.The highest strength of solution that is less than 5 bacterium colonies on solid medium is the MBC of artificial antimicrobial peptide MA-D4 for this experimental strain.Artificial antimicrobial peptide MA-D4 to take Gram-negative bacteria that intestinal bacteria are representative, gram-positive microorganism that the streptococcus suis 2-type of take is representative and at present the most serious streptococcus aureus of resistance all there is biological activity, illustrate that it has broad spectrum antibiotic activity.

MIC and the MBC unit of each experimental strain: μ g/mL

	Intestinal bacteria	Streptococcus aureus	Subtilis	Pseudomonas aeruginosa	Streptococcus suis 2-type	Anthrax bacillus
							MIC	0.5	1.0	1.0	0.5	1.0	4.0
MBC	1.0	2.0	2.0	1.0	2.0	6.0

The target protein of processing without enteropeptidase can not show biological activity for all experimental strains.

Embodiment 4: artificial antimicrobial peptide MA-D4 hemolytic activity detects.

Healthy mice is carried out to the eyeball blood sampling, the mouse blood obtained is mixed to abandoning supernatant after the centrifugal 5min of 2000r/min with A Shi liquid equal proportion.After the physiological saline washing mouse red blood cell of 10 times of volumes of use 3 times, use physiological saline that it is diluted to the red cell suspension of 2% concentration.Artificial antimicrobial peptide MA-D4 is prepared into to the diluent of different concns, mixes with red cell suspension, 37 ℃ hatch 30min after, the centrifugal 5min of 2000r/min, measure supernatant liquor in the absorption value of 540nm.Use physiological saline as negative control group, use 1%Triton X-100 as positive controls, according to the 540nm absorption value, calculate the artificial antimicrobial peptide hemolysis rate.When artificial antimicrobial peptide MA-D4 concentration is 400 μ g/mL, hemolysis rate is only 15.6%, infers its HC for mouse red blood cell ₅₀value should only need 1.0 ~ 6.0 μ g/mL and artificial antimicrobial peptide MA-D4 brings into play bioactive concentration far beyond 400 μ g/mL, can think that thus it does not show hemolytic activity.

Above-described embodiment is preferably implementation method of the present invention; but implementation method of the present invention is not restricted to the described embodiments; other are any do not deviate from spirit of the present invention and principle change, modification, substitute, combination, simplify and be equivalent method of replacing, be included in protection scope of the present invention.

Sequence table

SEQUENCE LISTING

<110 > Liu Cheng

<120 > preparation method of artificial antimicrobial peptide MA-D4 and application thereof

<160> 6

<210> 1

<211> 62

<212> PRT

<213 > artificial antimicrobial peptide MA-D4 aminoacid sequence

<400> 1

Asp Asp Asp Asp Lys His His Gly Ile Gly Lys Phe Leu His Ser Ala

1 5 10 15

Lys Lys Phe Gly Lys Ala Phe Val Gly Glu Ile Trp Asn Ser His His

20 25 30

Ala Leu Trp Lys Asp Ile Leu Lys Asn Ala Gly Lys Ala Ala Leu Asn

35 40 45

Glu Ile Asn Gln Ile Val Gln His His Asp Asp Asp Asp Lys

50 55 60

<210> 2

<211> 204

<212> DNA

<213 > artificial antimicrobial peptide MA-D4 nucleotide sequence

<400> 2

cacctcgagg atgatgatga taaacatcat ggtattggta aatttctgca tagcgcaaaa 60

aaatttggta aagcatttgt tggtgaaatt tggaatagcc atcatgcact gtggaaagat 120

attctgaaaa atgcaggtaa agcagcactg aatgaaatta atcagattgt tcagcatcat 180

gatgatgatg ataaaggatc caat 204

<210> 3

<211> 60

<212> DNA

<213 > primer P1

<400> 3

cacctcgagg atgatgatga taaacatcat ggtattggta aatttctgca tagcgcaaaa 60

<210> 4

<211> 60

<212> DNA

<213 > primer P2

<400> 4

atgatggcta ttccaaattt caccaacaaa tgctttacca aatttttttg cgctatgcag 60

<210> 5

<211> 60

<212> DNA

<213 > primer P3

<400> 5

tggaatagcc atcatgcact gtggaaagat attctgaaaa atgcaggtaa agcagcactg 60

<210> 6

<211> 68

<212> DNA

<213 > primer P4

<400> 6

attggatcct ttatcatcat catcatgatg ctgaacaatc tgattaattt cattcagtgc 60

tgctttac 68

Claims

1. an artificial antimicrobial peptide MA-D4, it is characterized in that, it is to possess the polypeptide of aminoacid sequence shown in SEQ ID No.1 in sequence table, or by aminoacid sequence shown in SEQ ID No.1 through cyclisation, N-terminal and/or C-terminal modify, L-type amino acid and D-type amino acid changes mutually, at least one processing in the sequence terminal deletion and the polypeptide of the functional equivalent that obtains.

2. polynucleotide, is characterized in that, it is to possess nucleotide sequence shown in SEQ ID No.2 in sequence table or complementary polynucleotide with it, aminoacid sequence shown in codified SEQ ID No.1.

3. a carrier, is characterized in that, possesses polynucleotide claimed in claim 2.

4. a genetically engineered host cell, is characterized in that, possesses carrier claimed in claim 3.

5. the preparation method of artificial antimicrobial peptide MA-D4 claimed in claim 1, comprise the steps:

(1) according to the antibacterial peptide Magainin in GenBank and Dermaseptin-4 mature peptide aminoacid sequence, manually design the aminoacid sequence SEQ ID No.1 of the artificial antibacterial peptide MA-D4 of the present invention, adopt afterwards the nucleotide sequence of this antibacterial peptide of intestinal bacteria Preference codon design coding, and add respectively the nucleic acid restriction endonuclease recognition site at two ends, form goal gene sequence SEQ ID No.2;

(2) adopt the synthetic above-mentioned purpose gene of gene splicing by overlap extension, design is 4 PCR primers of complementation in twos, the goal gene obtained by multistep PCR;

(3) goal gene obtained is connected with prokaryotic expression plasmid pET-32a (+), builds prokaryotic expression carrier, and be converted in e. coli bl21 or Rosetta screening-gene engineering positive bacteria;

(4) add IPTG induced gene engineering bacterium expression, carry out SDS-PAGE after the ultrasonic treatment thalline, detect expressing quantity;

(5) after using the enteropeptidase enzyme to cut the processing expression product, by the nickel ion affinity chromatograph purifying, obtain the artificial antibacterial peptide MA-D4 of the present invention.

6. the preparation method of artificial antimicrobial peptide MA-D4 according to claim 5, is characterized in that, described goal gene sequence is as shown in SEQ ID No.2.

7. the preparation method of artificial antimicrobial peptide MA-D4 according to claim 5, is characterized in that, described 4 PCR primer sequences are as shown in SEQ ID No.3 ~ 5.

8. the application of artificial antimicrobial peptide MA-D4 claimed in claim 1, is characterized in that, is applied to prepare antiseptic-germicide.

9. artificial antimicrobial peptide MA-D4 claimed in claim 8 is applied to prepare antiseptic-germicide, it is characterized in that, for intestinal bacteria, streptococcus aureus, subtilis, Pseudomonas aeruginosa, streptococcus suis 2-type and anthrax bacillus.