CN110590915A

CN110590915A - Artificial antibacterial peptide CAH, preparation method and application thereof

Info

Publication number: CN110590915A
Application number: CN201910936042.9A
Authority: CN
Inventors: 龚国利; 孙润聪; 田露
Original assignee: Shaanxi University of Science and Technology
Current assignee: Shaanxi University of Science and Technology
Priority date: 2019-09-29
Filing date: 2019-09-29
Publication date: 2019-12-20

Abstract

The invention discloses an artificial antibacterial peptide CAH, a preparation method and application thereof, and belongs to the field of antibacterial peptides. The preparation method of the artificial antibacterial peptide CAH synthesizes a heterozygous peptide CAH with antibacterial peptide potential to carry out whole gene, encodes the gene segment of the heterozygous peptide CAH according to the codon preference of escherichia coli so as to improve the expression quantity of the heterozygous peptide CAH in the escherichia coli, realizes a large amount of fusion expression of the antibacterial peptide, and lays a foundation for realizing other activity researches of the antibacterial peptide. The artificial antibacterial peptide CAH and the application thereof have the characteristics of high antibacterial activity, good stability and low hemolysis, and can be applied to the fields of food, medicine and livestock raising.

Description

Artificial antibacterial peptide CAH, preparation method and application thereof

Technical Field

The invention belongs to the field of antibacterial peptides, and particularly relates to an artificial antibacterial peptide CAH, a preparation method and application thereof.

Background

In recent years, antibiotics appear to effectively treat a plurality of diseases, but in recent years, along with the heavy use and even abuse of antibiotics, drug-resistant strains and even multi-drug-resistant strains appear, and the health problem of human beings is seriously threatened. The antibacterial peptide has stable physicochemical properties and broad-spectrum antibacterial property, has different action targets and mechanisms from antibiotics, has good antibacterial effect on antibiotic-resistant bacteria and is not easy to generate drug resistance on target strains, is hopeful to become a substitute of antibiotics, and is widely concerned by researchers in various fields.

However, the extraction and separation process of natural antibacterial peptide is difficult and complicated, and the separated antibacterial peptide has low antibacterial activity and high hemolytic property, and is limited in application in food, medicine, agriculture and other fields. The artificial antibacterial peptide CAH can overcome the defects of natural antibacterial peptide and has important development value. The artificial antibacterial peptide CAH can be synthesized in a laboratory, and a large amount of target peptides can be effectively synthesized in a genetic engineering mode, so that the cost is lower than that of a natural extraction mode, but the accuracy needs to be optimized at present.

Disclosure of Invention

The invention aims to overcome the defects of the prior art and provides an artificial antibacterial peptide CAH, a preparation method and application thereof.

In order to achieve the purpose, the invention adopts the following technical scheme to realize the purpose:

an artificial antibacterial peptide CAH, the amino acid sequence of which is shown in Seq ID No. 1.

A polynucleotide is a polynucleotide with a nucleotide sequence shown in Seq ID No.2 in a sequence table, and can encode an amino acid sequence shown in Seq ID No. 1.

A vector comprising the polynucleotide.

The preparation method of the artificial antibacterial peptide CAH comprises the following steps:

1) designing a nucleotide sequence Seq ID No.2 of the artificial antibacterial peptide CAH according to the amino acid sequences of parent peptides Cecropins, AR-23 and Hs-AFP in an antibacterial peptide database;

2) adding EcoR I and Xho I sites on the upstream and downstream of the nucleotide sequence Seq ID No.2 respectively, carrying out double enzyme digestion by utilizing EcoR I and Xho I, connecting with an expression vector pET32a subjected to double enzyme digestion by utilizing EcoR I and Xho I, transferring into escherichia coli for carrying out recombinant plasmid, and screening out a high-expression strain;

3) adding IPTG (isopropyl thiogalactoside) for induction expression to obtain target protein;

4) renaturation is carried out to remove the inclusion body of the target protein, and then the inclusion body is purified by a nickel ion affinity chromatography column to obtain the artificial antibacterial peptide CAH.

The artificial antibacterial peptide CAH is applied to the preparation of antibacterial agents.

Furthermore, the antibacterial agent is directed against Escherichia coli, Bacillus subtilis and Staphylococcus aureus.

Compared with the prior art, the invention has the following beneficial effects:

the preparation method of the artificial antibacterial peptide CAH synthesizes a heterozygous peptide CAH with antibacterial peptide potential to carry out whole gene, encodes the gene segment of the heterozygous peptide CAH according to the codon preference of escherichia coli so as to improve the expression quantity of the heterozygous peptide CAH in the escherichia coli, realizes a large amount of fusion expression of the antibacterial peptide, and lays a foundation for realizing other activity researches of the antibacterial peptide.

The artificial antibacterial peptide CAH and the application thereof have the characteristics of high antibacterial activity, good stability and low hemolysis, and can be applied to the fields of food, medicine and livestock raising.

Drawings

FIG. 1 is the CAH PCR amplification electrophoresis chart of the artificial antibacterial peptide of the present invention;

FIG. 2 is the electrophoresis diagram of the target protein expression of the artificial antibacterial peptide CAH of the present invention.

Detailed Description

In order to make the technical solutions of the present invention better understood, the technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

It should be noted that the terms "first," "second," and the like in the description and claims of the present invention and in the drawings described above are used for distinguishing between similar elements and not necessarily for describing a particular sequential or chronological order. It is to be understood that the data so used is interchangeable under appropriate circumstances such that the embodiments of the invention described herein are capable of operation in sequences other than those illustrated or described herein. Furthermore, the terms "comprises," "comprising," and "having," and any variations thereof, are intended to cover a non-exclusive inclusion, such that a process, method, system, article, or apparatus that comprises a list of steps or elements is not necessarily limited to those steps or elements expressly listed, but may include other steps or elements not expressly listed or inherent to such process, method, article, or apparatus.

1) constructing Escherichia coli recombinant plasmid of the antibacterial peptide

Constructing a recombinant plasmid CAH-pET32a by the nucleic acid sequence of the artificial antibacterial peptide CAH and the pET32a vector in a double enzyme digestion mode;

2) transformation and selection of recombinant plasmids

Transferring an expression vector CAH-pET32a into an escherichia coli competent cell BL21 by a thermal transformation method, coating the cell on an LB (lysogeny broth) plate containing 20ug/mL ampicillin (Amp), inverting the plate to culture overnight at 37 ℃, generating a transformant, and screening out a high-expression strain;

3) performing PCR amplification of CAH Gene

Randomly picked colonies are cultured on an LB (lysogeny broth) plate, PCR (polymerase chain reaction) amplification of CAH (cytochrome oxidase) genes is carried out by taking the colonies as a template, and an empty plasmid pET32a is used as negative control, and an electrophoresis result shows that the sequences are consistent with the sequence of the artificial antibacterial peptide CAH, which indicates that the construction of the efficient strain is successful;

4) inducible expression

Selecting a single colony of the recombinant strain, inoculating the single colony in 5mL of LB + Amp culture medium, and culturing overnight at a constant temperature of 37 ℃ and 220 rpm; and (3) performing overnight culture on the activated bacteria liquid according to the volume ratio of 1: 100 was inoculated into 10mL of LB + Amp liquid medium and cultured at 37 ℃ and 200rpm to OD₆₀₀A value of about 0.6 (about 3.5 h); 1.0mM IPTG was added to the medium for inducible expressionInducing expression for 3h at 37 ℃ and 220rpm, and displaying target protein expression by electrophoresis;

5) renaturation and purification

Due to the presence of inclusion bodies, purification of the target protein is carried out after renaturation, and the renaturation steps are as follows:

filling artificial antibacterial peptide CAH liquid into dialysis bag, and filling into dialysis bag containing H₂O, dialyzing and desalting overnight in a big beaker, then putting the big beaker into which TGE dialysis renaturation liquid is filled, dialyzing for 48 hours at 4 ℃, and replacing the TGE dialysis renaturation liquid for 4-8 hours;

by Ni²⁺Purifying with affinity chromatography column to obtain purified protein sample with protein content up to 150 mg/L;

obtaining artificial antibacterial peptide CAH powder by freeze drying, adding 10mM of freeze-drying protective agent glycine into renatured fusion protein liquid, uniformly mixing, pre-freezing for 12h at-40 ℃, then freezing for 24h by a vacuum freeze dryer under the conditions of-50 ℃ and 6.93Pa to obtain the artificial antibacterial peptide CAH powder, and storing for later use at 4 ℃.

Example 1

The cloning, expression vector and expression strain of the artificial antibacterial peptide CAH gene are constructed as follows:

selecting parent peptides according to an antibacterial peptide database for hybridization, wherein the amino acid sequences are as follows:

Glycine Tryptophan Leucine Arginine Asparticacid Phenylalanine Glycine Lysine Arginine Isoleucine Glutamicacid Arginine Valine GlycineGlutarnine Histidine Threonine Glutamicacid Asparticacid Alanine ThreonineIsoleucine Glutarnine Alanine Isoleucine Glycine Valine Alanine GlutarnineGlutarnine Alanine Alanine Asparagine Valine Alanine Alanine Threonine ValineArginine Glycine Alanine Isoleucine Glycine Serine Isoleucine Leucine GlycineAlanine Leucine Alanine Lysine Glycine Leucine Proline Threonine LeucineIsoleucine Serine Tryptophan Isoleucine Lysine Asparagine Arginine AsparagineGlycine Valine Lysine Leucine Cystine Asparticacid Valine Proline SerineGlycine Threonine Tryptophan Serine Glycine Histidine Cystine Glycine SerineSerine Serine Lysine Cystine Serine Glutarnine Cystine Lysine AsparticacidArginine Glutamicacid Histidine Phenylalanine Alanine Tyrosine GlycineGlycine Alanine Cystine Histidine Tyrosine Glutarnine Phenylalanine ProlineSerine Valine Lysine Cystine Phenylalanine Cystine Lysine Arginine GlutarnineCystine。

the nucleotide sequence is as follows:

GGCTGGCTGCGTGATTTTGGCAAACGTATTGAACGTGTGGGCCAGCATACCCGTGATGCGACCATTCAGGCGATTGGCGTGGCGCAGCAGGCGGCGAACGTGGCGGCGACCGTGCGTGGCGCGATTGGCAGCATTCTGGGCGCGCTGGCGAAAGGCCTGCCGACCCTGATTAGCTGGATTAAAAACCGTGATGGCGTGAAACTGTGCGATGTGCCGAGCGGCACCTGGAGCGGCCATTGCGGCAGCAGCAGCAAATGCAGCCAGCAGTGCAAAGATCGTGAACATTTTGCGTATGGCGGCGCGTGCCATTATCAGTTTCCGAGCGTGAAATGCTTTTGCAAACGTCAGTGC。

TABLE 1 parent peptide amino acid names, sequences and sources

Constructing the artificial antibacterial peptide CAH recombinant plasmid of the invention:

according to the characteristics of the nucleic acid sequence of the artificial antibacterial peptide CAH and the restriction enzyme site characteristics of an expression vector pET32a, adding EcoR I and Xho I sites on the upper and lower streams of a target gene sequence respectively, carrying out double enzyme digestion by using EcoR I and Xho I, connecting with pET32a subjected to double enzyme digestion by using EcoR I and Xho I, transforming into DH5 alpha bacteria, constructing a recombinant plasmid CAH-pET32a, extracting the plasmid, carrying out double enzyme digestion by using EcoR I and Xho I, sequencing and identifying, and confirming that the construction of the recombinant plasmid is successful;

coli (BL21) transformation and screening:

placing competent E.coli BL21 cells stored in an ultra-low temperature refrigerator at-80 ℃ on ice, and thawing; sucking 5 mu L of recombinant plasmid CAH-pET32a, adding the recombinant plasmid CAH-pET32a into 50 mu L of competent cells, gently mixing the cells uniformly, and standing the mixture for 30min on ice; carrying out heat shock in a constant-temperature water bath at 42 ℃ for 90 s; after the heat shock is finished, quickly transferring the mixed system to ice, and standing for 5 min; adding 1LLB liquid culture medium into the system, and culturing at constant temperature of 37 ℃ for 1h under the condition of 80 rpm; after that, the mixture was centrifuged at 8000rpm for 2min, and after centrifugation, most of the supernatant was discarded, about 100. mu.L of the supernatant was again suspended and applied to LB solid medium containing Amp, and the plate was inverted and cultured overnight at 37 ℃. And (3) taking a single colony of overnight cultured thalli selected from an LB solid culture medium as a template, carrying out colony PCR verification, screening a positive clone strain of the recombinant plasmid, and taking an empty plasmid template of pET-32a as a negative control.

Determining the expression form of the target protein by using the artificial antibacterial peptide CAH and purifying:

inducing expression: carrying out small-scale expression, selecting a single colony of a recombinant strain, inoculating the single colony in 5mL of LB + Amp culture medium, and carrying out constant-temperature overnight culture at 37 ℃ and 220 rpm; and (3) performing overnight culture on the activated bacteria liquid according to the volume ratio of 1: 100 was inoculated into 10mL of LB + Amp liquid medium and cultured at 37 ℃ and 200rpm to OD₆₀₀A value of around 0.6 (about 3.5 h); adding 1.0mM IPTG into the culture medium for induced expression, and carrying out induced expression for 3h at 37 ℃ and 220 rpm;

in order to determine whether the fusion protein exists mainly in the supernatant or exists in the precipitate in the form of inclusion body, which is convenient for the subsequent purification work, the test adopts an ultrasonic method to break the thallus and then uses SDS-PAGE to detect the protein solubility, and the specific steps are as follows:

selecting a single colony of a positive clone of the recombinant protein, inoculating the single colony in 5mL of LB + Amp liquid culture medium, culturing at 37 ℃ and 220rpm overnight;

1) the overnight-cultured bacterial liquid was inoculated in 100mL of LB + Amp liquid medium at an inoculum size of 1% (by volume) and cultured to OD₆₀₀A value of around 0.6 (about 3.5 h);

2) respectively placing 10mL of bacterial liquid into two test tubes, and taking one test tube without adding IPTG as a negative control; adding an appropriate amount of IPTG into the other test tube until the final concentration is 1mM, placing the two test tubes in a shaking table at 37 ℃, and culturing for 3h at 220 rpm;

3) after the culture is finished, collecting bacterial liquid, centrifuging at 12000rpm for 10min, and collecting bacterial precipitation;

4) adding 1mL of PBS buffer solution into the thallus precipitate, resuspending and cleaning the thallus, centrifuging for 3min at the rotating speed of 12000rpm, and repeating twice;

5) adding 1mL of sterile deionized water into the cleaned thallus precipitate, resuspending the thallus by using a gun head, uniformly mixing the thallus, placing the mixed solution into an ultrasonic cell crusher for cell disruption, performing ultrasonic treatment for 0.5s at intervals of 1s for 15min (placing the bacteria solution on ice in the ultrasonic treatment);

6) after ultrasonication, centrifugation was carried out at 12000rpm for 10min, and the supernatant and the precipitate were collected separately, and the supernatant was concentrated to 200. mu.L and the precipitate was resuspended in 200. mu.L of PBS;

7) mixing the supernatant and the precipitate with the sample buffer respectively, boiling water bathing for 5min, and performing SDS-PAGE electrophoresis detection.

Because of the inclusion body, the purification of the target protein is needed after renaturation, and the renaturation steps are as follows:

putting the artificial antibacterial peptide CAH liquid into a dialysis bag, putting into a big beaker filled with dd H2O, dialyzing overnight for desalting, then putting into a big beaker filled with TGE dialysis renaturation liquid, dialyzing for 48H at 4 ℃, and changing the TGE dialysis renaturation liquid once in the period of 4-8H;

The performance of the artificial antibacterial peptide CAH prepared in example 1 was tested as follows:

1. the artificial antibacterial peptide CAH is used for testing the bacteriostatic effect of the laboratory preservation indicator bacterium:

respectively inoculating escherichia coli, bacillus subtilis, staphylococcus aureus and saccharomyces cerevisiae which are stored in a laboratory into a test tube, and performing overnight activation culture at 37 ℃ and 220 rpm;

diluting the broth to 2 × 10 with sterilized LB, beef extract peptone and YPD liquid culture medium respectively⁵-7×10⁵CFU/mL；

Artificial antimicrobial peptide CAH was diluted with sterile PBS (pH 7.0) buffer to ten concentration gradients of 200, 100, 50, 25, 12.5, 6.25, 3.13, 1.56, 3.13, and 1.56 μ M;

using a 96-well cell culture plate, adding 50 mu L of diluted bacteria liquid into the 1 st to 11 th wells of each row, and adding 50 mu L of culture medium into the 12 th well as taking blank control; respectively adding 20 mu L of diluted artificial antibacterial peptide CAH into 1-10 holes from high to low according to the concentration, and culturing overnight at 37 ℃ under the condition of 200rpm (three parallel experiments are carried out in each group of experiments);

after the culture is finished, the light absorption value is measured at the position with the wavelength of 490nm, and the result shows that the artificial antibacterial peptide CAH has a good inhibition effect on Escherichia coli, the size of an inhibition zone is 7.5mm, ampicillin inhibits the growth of bacteria by inhibiting the synthesis of peptidoglycan in the cell wall of the bacteria, and the cell wall of the saccharomyces cerevisiae does not contain oil peptidoglycan, so Amp has no inhibition effect on the saccharomyces cerevisiae.

2. Determination of CAH hemolytic Properties of Artificial antimicrobial peptide prepared in example 1

The activity of the artificial antimicrobial peptide CAH was determined by measuring the amount of released erythromycin. Centrifuging the collected fresh sheep blood for 10min at 8000rpm, discarding supernatant, washing erythrocytes with PBS, repeating for three times, and adding appropriate amount of physiological saline to prepare 2% erythrocyte suspension. Mixing the prepared 2% red blood cell liquid with artificial antibacterial peptide CAH to make the concentration of the artificial antibacterial peptide CAH 6.25, 12.5, 25, 50, 100 μ M, culturing at 37 ℃ for 1h, centrifuging at 2500rpm for 10min, collecting supernatant, adding the supernatant into 96-well cell culture plate, measuring the absorbance at 570nm, using the absorbance of 0.01M PBS (pH 7.4) solution at 570nm as negative control, the percentage of hemolysis is 0%, the absorbance of 1% (volume ratio) Trition X-100 at 570nm as positive control, and the percentage of hemolysis is 100%.

TABLE 2 determination of CAH hemolysis

3. Stability assay of the Artificial antimicrobial peptide CAH prepared in example 1

3.1 Effect of Water bath on Artificial antimicrobial peptide CAH

Diluting artificial antibacterial peptide CAH powder to 200 μ M with PBS (pH 7.0), subpackaging in six small centrifuge tubes, placing in boiling water bath, and standing for 2, 5, 10, 20, 40, and 60min respectively. Performing an antibacterial experiment by taking staphylococcus aureus as pathogenic bacteria, diluting activated staphylococcus aureus bacterial liquid with an LB liquid culture medium until the OD value is about 0.1, adding 50 mu L of diluted bacterial liquid and 20 mu L of artificial antibacterial peptide CAH subjected to water bath treatment into each hole by using a 96-hole cell culture plate, performing overnight culture at 37 ℃ and 200rpm, and measuring the light absorption value at the wavelength of 550nm by using an enzyme labeling instrument (each group of experiments is performed with three parallel experiments, and the average value is taken); when the artificial antibacterial peptide CAH is in boiling water bath for 40min, the antibacterial activity of staphylococcus aureus is hardly influenced, and after 40min, the activity of the artificial antibacterial peptide CAH is slightly reduced, but higher activity is still maintained, which indicates that the artificial antibacterial peptide CAH has better thermal stability.

TABLE 3100 ℃ Water bath time Effect on antimicrobial peptide Activity

3.2 influence of pH value on artificial antibacterial peptide CAH

PBS (buffer solution is used for diluting artificial antibacterial peptide CAH powder to 200 mu M, staphylococcus aureus is used as pathogenic bacteria for bacteriostasis experiments, activated staphylococcus aureus liquid is diluted to an OD value of about 0.1 by an LB liquid culture medium, 96-hole cell culture plates are used, 50 mu L of diluted liquid and 20 mu L of artificial antibacterial peptide CAH with different pH values are added into each hole, overnight culture is carried out at 37 ℃ and 200rpm, and an enzyme reader is used for measuring the light absorption value at the wavelength of 550nm (three parallel experiments are carried out in each group of experiments, and the average value is taken).

TABLE 4 influence of pH on the CAH Activity of Artificial antimicrobial peptides

Bioinformatics indexes of the artificial antimicrobial peptide CAH obtained in example 1 are shown in table 5:

TABLE 5 bioinformatics indices of Artificial antimicrobial peptides CAH

The above-mentioned contents are only for illustrating the technical idea of the present invention, and the protection scope of the present invention is not limited thereby, and any modification made on the basis of the technical idea of the present invention falls within the protection scope of the claims of the present invention.

Sequence listing

<120> artificial antibacterial peptide CAH, preparation method and application thereof

<160> 1

<170> SIPOSequenceListing 1.0

<210> 1

<211> 116

<212> PRT

<213> Artificial antimicrobial peptide CAH

<400> 1

Gly Thr Leu Ala Ala Pro Gly Leu Ala Ile Gly Ala Val Gly Gly His

1 5 10 15

Thr Gly Ala Ala Thr Ile Gly Ala Ile Gly Val Ala Gly Gly Ala Ala

20 25 30

Ala Val Ala Ala Thr Val Ala Gly Ala Ile Gly Ser Ile Leu Gly Ala

35 40 45

Leu Ala Leu Gly Leu Pro Thr Leu Ile Ser Thr Ile Leu Ala Ala Ala

50 55 60

Gly Val Leu Leu Cys Ala Val Pro Ser Gly Thr Thr Ser Gly His Cys

65 70 75 80

Gly Ser Ser Ser Leu Cys Ser Gly Cys Leu Ala Ala Gly His Pro Ala

85 90 95

Thr Gly Gly Ala Cys His Thr Gly Pro Pro Ser Val Leu Cys Pro Cys

100 105 110

Leu Ala Gly Cys

115

<160> 2

<170> SIPOSequenceListing 1.0

<210> 2

<211> 351

<212> DNA

<213> Artificial antimicrobial peptide CAH

<400> 2

ggctggctgc gtgattttgg caaacgtatt gaacgtgtgg gccagcatac ccgtgatgcg 60

accattcagg cgattggcgt ggcgcagcag gcggcgaacg tggcggcgac cgtgcgtggc 120

gcgattggca gcattctggg cgcgctggcg aaaggcctgc cgaccctgat tagctggatt 180

aaaaaccgtg atggcgtgaa actgtgcgat gtgccgagcg gcacctggag cggccattgc 240

ggcagcagca gcaaatgcag ccagcagtgc aaagatcgtg aacattttgc gtatggcggc 300

gcgtgccatt atcagtttcc gagcgtgaaa tgcttttgca aacgtcagtg c 351

Claims

1. An artificial antibacterial peptide CAH, which is characterized in that the amino acid sequence is shown as Seq ID No. 1.

2. A polynucleotide having a nucleotide sequence shown in Seq ID No.2 of the sequence Listing, which encodes an amino acid sequence shown in Seq ID No. 1.

3. A vector comprising the polynucleotide according to claim 2.

4. A method for preparing the artificial antibacterial peptide CAH of claim 1, which comprises the following steps:

5. Use of the artificial antimicrobial peptide CAH according to claim 1 for the preparation of an antimicrobial agent.

6. The use of the artificial antimicrobial peptide CAH according to claim 5 for the preparation of an antimicrobial agent against Escherichia coli, Bacillus subtilis and Staphylococcus aureus.