CN103103196A

CN103103196A - Modified goat defensin gene and preparation method and application thereof

Info

Publication number: CN103103196A
Application number: CN2013100425083A
Authority: CN
Inventors: 刘桂琼; 姜勋平; 刘胜敏; 康建锋
Original assignee: Huazhong Agricultural University
Current assignee: Huazhong Agricultural University
Priority date: 2013-02-04
Filing date: 2013-02-04
Publication date: 2013-05-15

Abstract

The invention discloses a modified goat defensin gene and a preparation method and an application thereof. The preparation method comprises the following steps of: modifying a goat defensin gene aiming at codon usage bias of pichia pastoris, so as to obtain the optimized goat defensin gene; and linking a target gene into a pPICZalphaA expression vector to obtain a recombinant expression plasmid pPICZalphaA/GBD-1, transferring the plasmid into the pichia pastoris, and obtaining an optimized goat defensin after inducing. The method is simple, feasible and suitable for mass production, the obtained goat defensin gene has an activity superior to a natural defensin and is low in cost, affordable in price and high in cost performance. The modified goat defensin gene can be used for replacing conventional antibiotics and some chemical preservatives and has great significances on food safety and clinic treatment.

Description

A kind of goat phylaxin gene and preparation method and application of modification

Technical field

The invention belongs to the genetically engineered field, be specifically related to a kind of goat phylaxin gene of modification, the goat alexin that also relates to a kind of modification also relates to a kind of alexinic preparation method of goat of modification, also relates to a kind of application of goat alexin on bacteria growing inhibiting of modification.

Background technology

Alexin is the little peptide that extensively is present in the organisms such as animal, plant and insect, and the defensin of present isolation identification is over 100 kinds.Alexin is the little cationic antibacterial peptide of a class, approximately is comprised of 21～45 amino-acid residues, and molecular weight is 3～6kD.Most of alexin molecules contain 6～8 conservative cysteine residues, form three pairs or four pairs of intramolecular disulfide bonds, and form a beta sheet sheet structure by intramolecular disulfide bond.Be rich in arginine, molecule is positively charged in neutral solution, have efficient, broad spectrum antibiotic activity, gram-positive microorganism, Gram-negative bacteria, fungi (Candida, genera cryptococcus, aspergillus), tunicle virus (hiv virus) etc. had certain killing effect, and can not make the microorganisms resistance, the cell of intact animal is shown nonspecific deleterious cellular effects.

Goat Reproductive road systemic disease is produced goat has larger harm, generally adopts at present microbiotic to treat.Due to a large amount of microbiotic that use, may produce Resistant strain and make and treat unsuccessfully in the goat body; Simultaneously, a large amount of microbiotic also may pollute and affect food safety sheep products such as mutton, goat milk.Alexin is small-molecule peptide, has broad spectrum antibiotic activity, and due to its special antibacterial mechanisms, body does not produce resistance to it, can solve the bacterial drug resistance problem, is antibiotic of new generation.

Content is seldom in animal and plant body for natural alexin, extract the cost of separating also very high, this has just restricted alexin suitability for industrialized production and the application in livestock and poultry, therefore by a large amount of production alexins of engineered method, obtain enough, activated alexin and become study hotspot.

Present many experiments are by engineered method, successfully phylaxin gene imported in various organisms and obtain good representation, such as mankind's alexin, porcine defensin, ox alexin etc. are all import to phylaxin gene in carrier for expression of eukaryon and expressed and apply for a patent, the alexin that gives expression to has biologic activity preferably.Not yet there is at present pair goat alexin to carry out the open report of a large amount of preparations of gene engineering method.

Summary of the invention

An object of the present invention is to be to provide a kind of goat phylaxin gene of modification, according to alexin sequence (GenBank:DQ532360.1), for the pichia spp codon preference, it is modified, obtained a kind of goat phylaxin gene of having optimized, its sequence is shown in SEQ ID NO.1.

A further object of the invention is the goat alexin that has been to provide a kind of modification, and its aminoacid sequence is that shown in SEQ ID NO.2, its activity is better than natural alexin, and is with low cost, the price material benefit, and cost performance is high.Alternative traditional microbiotic and the sanitas of some chemical have great importance to food safety and clinical treatment.

A further object of the invention is the alexinic preparation method of goat who has been to provide a kind of modification, and method is simple, and easily row, be suitable for scale operation.

Last purpose of the present invention has been to provide a kind of application of goat alexin on bacteria growing inhibiting of modification, by the processing of fibroin liquid that fresh meat is on the defensive, has improved greatly the fresh keeping time of meat.The lower fresh-keeping time of temperature is longer.

In order to achieve the above object, the present invention takes following technical measures:

1. the acquisition of the goat phylaxin gene of modifying:

According to goat phylaxin gene (GenBank:DQ532360.1), for the pichia spp codon preference, it is modified, obtained a kind of goat phylaxin gene of having optimized, its sequence is shown in SEQ ID NO.1.Design contains the primer of part complementary sequence, at primer two ends design EcoR I and two restricted interior restriction enzyme sites of Not I, obtains the GBD-1 gene of complete process modification by the method amplification of overlapping PCR.

The primer sequence of design is as follows:

①：ACT GAATTCATGAGTCGTCGAAGCTGCCATAGGAATAAAGGCGTCTGTGCT

②：CTGTCTCATGTTTCTAGGGCATCTGGTCAGAGCACAGACGCCTTT

③：AACTGGGGGACCGAAACAGGTGCCAATCTGTCTCATGTTTCT

④：CAG GCGGCCGCCTTCTTTCTGCAGCATTTAACTGGGGGACCGAA

2. the Construction and identification of recombinant expression plasmid:

Correct purpose fragment and the pPICZ α A expression vector of order-checking carried out double digestion with EcoR I and Not I respectively, use T after enzyme is cut ₄DNA ligase connects, and builds recombinant expression plasmid pPICZ α A/GBD-1.Recombinant expression plasmid is cultivated in containing the LB substratum of Zeocin, screened, extract plasmid with extracting in a small amount test kit, carry out double digestion, and recombinant expression plasmid pPICZ α A/GBD-1 is served the Hai Shenggong order-checking, check order correct, be recombinant expression plasmid pPICZ α A/GBD-1 of the present invention.

3. the conversion of recombinant plasmid:

With identifying that good recombinant expression plasmid pPICZ α A/GBD-1 with the linearizing of Sac I, in the transformed competence colibacillus pichia spp, utilizes electroporation to carry out electricity and turns, transform simultaneously pPICZ α A empty carrier in contrast.After turning, electricity coats in the YPD flat board that contains Zeocin, 30 ℃ have been cultured to single bacterium colony and have occurred, with single colony inoculation to containing Zeocin(100mg/mL) the YPD liquid nutrient medium in further cultivate, get the part bacterium colony, extract pastoris genomic dna, and utilize carrier special primer 5 ' AOX and 3 ' AOX to carry out PCR and identify, and order-checking.

5’AOX：GACTGGTTCCAATTGACAAGC

3’AOX：GCAAATGGCATTCTGACATCC

4. the abduction delivering of recombination yeast:

The positive recombinant bacterial strain that screening is good is inoculated into and activates 15h in the BMGY nutrient solution, centrifugal, remove supernatant, precipitation is induced after suspending with the BMMY nutrient solution, it is 1ml bacterium liquid two pipes after 1%, 84h that every 24h adds methyl alcohol to final concentration, the centrifugal supernatant that stays, obtained a kind of goat alexin of modification, its sequence is shown in SEQ ID NO.2.-20 ℃ of preservations.

5. sample is carried out preliminary activity identification:

Inject respectively the unloaded albumen of 20 μ L, recombinant secretor albumen, the 20 μ L100 μ g/mLAmp that 20 μ L induce 72h at the punch position of LB substratum, observe discovery after cultivating 10h, inhibition zone has all appearred in the hole of recombinant secretor albumen and Amp, can find out from the A culture plate, the strong resistance of the recombinant secretor albumen of Chinese People's Anti-Japanese Military and Political College's enterobacteria Performance Ratio equal volume of Amp (antibacterial circle diameter of recombinant secretor albumen is 1.9cm, and the antibacterial circle diameter that contains Amp is 2.7cm); Can find out the strong resistance of the recombinant secretor albumen of the anti-Staphylococcus aureus Performance Ratio equal volume of Amp (antibacterial circle diameter of recombinant secretor albumen is 2.1cm, and the antibacterial circle diameter that contains Amp is 5.0cm) from the B culture plate; A culture plate and B the culture plate just bacterium colony of growth are different, and other conditions are all identical, therefore can draw by recombinant secretor albumen inhibition zone in A and B culture plate, alexin to the restraining effect of streptococcus aureus greater than to colibacillary restraining effect.

Simultaneously inject respectively the unloaded albumen of 20 μ L, recombinant secretor albumen, the not modified goat alexin protein of 20 μ L that 20 μ L induce 72h at the punch position of LB substratum, observe discovery after cultivating 10h, inhibition zone has all appearred in recombinant secretor albumen and former alexinic hole, can find out the former alexin strong resistance of Chinese People's Anti-Japanese Military and Political College's enterobacteria Performance Ratio equal volume of recombinant secretor albumen from the C culture plate; Can find out from the D culture plate, the Performance Ratio of the anti-streptococcus pneumoniae of recombinant secretor albumen a little less than, but be eager to excel than the former defence fibroin of equal volume; Can find out from the E culture plate, recombinant secretor albumen is the activity of anti-pichia spp not substantially.(Fig. 1).

Result of study shows that alexin all has restraining effect to streptococcus aureus, intestinal bacteria and streptococcus pneumoniae.

The alexinic application on bacteria growing inhibiting of a kind of goat of modification, its application process is:

Adopt fresh pork, protein extract (concentration is 0.1mg/mL), use and adopt simple and easy to do spraying fresh-keeping method, protein extract is contained in the atomizer of sterilization, then be sprayed at equably on the pork surface, be contained in food bag after slightly dried, be placed in room temperature, 37 degree, 4 degree and minus 20 degrees, observe the variation of yellowish pink, smell and viscosity.Establish simultaneously non-processor control group and deionized water control group.37 degree control groups are rotten after 37 degree 2h, and experimental group is inferior bright; Control group is rotten when room temperature 6h, and experimental group is rotten after 8h; Control group went bad on the 8th day when 4 spend, and experimental group is normal; Went bad afterwards in 91 days at subzero 20 degree control group, experimental group is normal.

Compared with prior art, the present invention has the following advantages:

Goat alexin encoding sequence is optimized transformation, has obviously improved the expression level of alexin in pichia spp, be conducive to alexinic suitability for industrialized production and apply.Alexin is the immunity system that comes from animal body self, to the cell of animal own without toxic side effect, safe, therefore do not have the Biosafety problem.If be applied, have great economy and ecological benefits.

In the present invention, alexinic recombinant product activity is better than natural alexin; With low cost, the price material benefit, cost performance is high.Use present method to carry out bulk fermentation production to alexin, might substitute traditional microbiotic and the sanitas of some chemical, food safety and clinical treatment are had great importance.

Description of drawings

Fig. 1 is a kind of antibacterial effect schematic diagram of GBD-1 albumen

A: the restructuring alexin of modification is to colibacillary bacteriostatic action; B: the bacteriostatic action of the restructuring alexin of modification to streptococcus aureus; C: the alexin of modification and former alexin are to colibacillary antibacterial comparison; D: the alexin of modification and the former alexin antibacterial comparison to streptococcus pneumoniae; E: the alexin of modification and the former alexin antibacterial comparison to pichia spp.

1: unloaded albumen control group, 2: recombinant protein GBD-1,3:Amp control group, 4: former alexin control group

Fig. 2 determination of protein concentration typical curve

Typical curve R ²=0.994, comparatively ideal is described, X-axis represents standard substance concentration, Y-axis represents the OD value.

Fig. 3 Escherichia coli Growth graphic representation

X-axis represents Measuring Time, and Y-axis represents the OD value.Be followed successively by from top to bottom alexin, the contrast of LB liquid nutrient medium of former alexin control group, modification.

Embodiment

Embodiment 1:

The acquisition of the goat phylaxin gene of modifying:

According to goat phylaxin gene sequence (GenBank:DQ532360.1), for the pichia spp codon preference, it is modified, obtained a kind of goat phylaxin gene of having optimized, its sequence is shown in SEQ ID NO.1.Design contains the primer 1,2,3,4 of part complementary sequence, at primer two ends design EcoR I and two restricted interior restriction enzyme sites of Not I, obtains the GBD-1 gene of complete process modification by the method amplification of overlapping PCR.

The pcr amplification of GBD-1 gene: primer 1,2,3 template and primer each other carries out PCR, reaction system is: primer 1,2,3(concentration are all 10 μ mol/L) add respectively 2 μ L, 1 μ L, 2 μ L, 2.5mM dNTPs3.5 μ L, 10 * EasyTaq Buffer5 μ L, EasyTaq DNA Polymerase1 μ L mends aseptic double-distilled water to 50 μ L.

Amplification condition: 94 ℃ of denaturation 4min; 94 ℃ of 30s, 62 ℃ of 30s, 72 ℃ of 30s, 32 circulations; 72 ℃ are fully extended 10min.

The PCR product reclaims test kit with the DNA gel purifying and reclaims the purpose fragment after 2% (w/v) agarose gel electrophoresis, is numbered 1-2-3.

Template and primer carry out PCR each other again for primer 1,1-2-3,4, reaction system is: primer 1,1-2-3,4 add respectively 2 μ L, 1 μ L, 2 μ L, 2.5mM dNTPs3.5 μ L, 10 * EasyTaq Buffer5 μ L, EasyTaq DNA Polymerase1 μ L mends aseptic double-distilled water to 50 μ L.

The PCR product reclaims test kit with the DNA gel purifying and reclaims the purpose fragment after 2.0% (w/v) agarose gel electrophoresis, and this purpose fragment is the goat alexin aim sequence of modification.

The primer sequence of design is as follows:

1：ACT GAATTCATGAGTCGTCGAAGCTGCCATAGGAATAAAGGCGTCTGTGCT

2：CTGTCTCATGTTTCTAGGGCATCTGGTCAGAGCACAGACGCCTTT

3：AACTGGGGGACCGAAACAGGTGCCAATCTGTCTCATGTTTCT

4：CAG GCGGCCGCCTTCTTTCTGCAGCATTTAACTGGGGGACCGAA

Embodiment 2:

The Construction and identification of recombinant expression plasmid:

Embodiment 3:

The conversion of recombinant plasmid:

5’AOX：GACTGGTTCCAATTGACAAGC

3’AOX：GCAAATGGCATTCTGACATCC

Embodiment 4:

The abduction delivering of recombination yeast:

Embodiment 5:

The detection of expression product:

To a collection of bacterium liquid TCA(trichoroacetic acid(TCA) after inducing) 4 ℃ of concentrated spending the night, the centrifugal supernatant of abandoning, add 2 * SDS-PAGE sample-loading buffer, boil 10min after mixing up the pH value with NaOH, carry out Tricine-SDS-PAGE electrophoresis and Western Blot and detect, another batch bacterium liquid is measured protein concentration with the BCA method and is utilized Agarose cavity diffusion method to carry out the bacteriostatic activity detection to streptococcus aureus and intestinal bacteria.The pure alexin of preparation has good anti-microbial activity.

Get the 2 μ L protein standard substances protein standard curve of completing, R ²=0.994, the description standard curve is comparatively desirable, can be used for measuring protein sample concentration (Fig. 2), then get 2 μ L testing proteins, is determined at OD value and protein concentration under 562nm, the results are shown in Table 1.

Table 1 determination of protein concentration result

Embodiment 6:

Antibacterial result detects:

1, Agarose cavity diffusion method

2, minimal inhibitory concentration is measured:

50 μ L protein samples difference doubling dilutions in each experimental port of 96 orifice plates, are then added the test bacterium liquid of 100 μ L106CFU/mL, and control group is established two groups: one group is 100 μ L nutrient solutions; Another group is 100 μ L bacterium liquid, and 37 ℃, 220r/min shaking table were cultivated 12 hours, at λ=595nm detection optical density value OD, the results are shown in Table 2 with automatic microplate reader.

The MIC value of the alexin that table 2 is modified to five kinds of different strains

3, the impact of growth curve:

50 μ L protein samples difference doubling dilutions in each experimental port of 96 orifice plates, are added the test bacterium liquid of 100 μ L106CFU/mL, and control group is established two groups: one group is 100 μ L nutrient solutions; Another group is 100 μ L bacterium liquid, and 37 ℃, 220r/min shaking table were cultivated 12 hours, every 2h with automatic microplate reader at λ=595nm detection optical density value OD.Do three times and average, draw intestinal bacteria ATCC25922 growth curve charts (Fig. 3).Result shows that alexin has restraining effect to colibacillary growth, particularly acts on stationary phase, and the alexin protein liquid of modifying is stronger to colibacillary effect than former alexin.

Embodiment 7:

Adopt fresh pork, protein extract of the present invention (concentration is 0.1mg/mL), use and adopt simple and easy to do spraying fresh-keeping method, protein extract is contained in clean atomizer, then be sprayed at equably on the pork surface (0.5ml/g), be contained in food bag after slightly dried, be placed in room temperature, 37 degree, 4 degree and minus 20 degrees, observe the variation of yellowish pink, smell and viscosity.Establish simultaneously non-processor control group and deionized water control group.37 degree control groups are rotten after 37 degree 2h, and experimental group is inferior bright; Control group is rotten when room temperature 6h, and experimental group is rotten after 8h; Control group went bad on the 8th day when 4 spend, and experimental group is normal; Went bad afterwards in 91 days at subzero 20 degree control group, experimental group is normal.

SEQUENCE LISTING

＜110〉Hua Zhong Agriculture University

＜120〉a kind of goat phylaxin gene and preparation method and application of modification

＜130〉a kind of goat phylaxin gene and preparation method and application of modification

<160> 6

<170> PatentIn version 3.1

<210> 1

<211> 114

<212> DNA

＜213〉synthetic

<400> 1

agtcgtcgaa gctgccatag aaataaaggc gtctgtgctc tgaccagatg ccctagaaac 60

atgagacaga ttggcacctg tttcggtccc ccagttaaat gctgcagaaa gaag 114

<210> 2

<211> 38

<212> PRT

＜213〉synthetic

<400> 2

Ser Arg Arg Ser Cys His Arg Asn Lys Gly Val Cys Ala Leu Thr Arg

1 5 10 15

Cys Pro Arg Asn Met Arg Gln Ile Gly Thr Cys Phe Gly Pro Pro Val

20 25 30

Lys Cys Cys Arg Lys Lys

35

<210> 3

<211> 51

<212> DNA

＜213〉synthetic

<400> 3

actgaattca tgagtcgtcg aagctgccat aggaataaag gcgtctgtgc t 51

<210> 4

<211> 45

<212> DNA

＜213〉synthetic

<400> 4

ctgtctcatg tttctagggc atctggtcag agcacagacg ccttt 45

<210> 5

<211> 42

<212> DNA

＜213〉synthetic

<400> 5

aactggggga ccgaaacagg tgccaatctg tctcatgttt ct 42

<210> 6

<211> 44

<212> DNA

＜213〉synthetic

<400> 6

caggcggccg ccttctttct gcagcattta actgggggac cgaa 44

Claims

1. the goat phylaxin gene of the modification of a synthetic, its sequence is shown in SEQ ID NO.1.

2. the goat alexin of a modification, its sequence is the aminoacid sequence shown in SEQ ID NO.2.

3. the alexinic preparation method of the goat of a kind of modification claimed in claim 2, the steps include:

1) GBD-The pcr amplification of 1 gene: primer 1,2,3 template and primer each other carries out PCR, and reaction system is: primer 1,2,3 adds respectively 2 μ L, 1 μ L, 2 μ L, 2.5 mM dNTPs 3.5 μ L, 10 * EasyTaqBuffer 5 μ L, EasyTaqDNA Polymerase 1 μ L mends aseptic double-distilled water to 50 μ L;

Amplification condition: 94 ℃ of denaturation 4 min; 94 ℃ of 30 s, 62 ℃ of 30 s, 72 ℃ of 30 s, 32 circulations; 72 ℃ are fully extended 10 min;

The PCR product reclaims test kit with the DNA gel purifying and reclaims the purpose fragment after the agarose gel electrophoresis of 2 % mass volume ratios, is numbered 1-2-3;

Primer 1,1-2-3,4 more each other template and primer carry out PCR, reaction system is: primer 1,1-2-3,4 add respectively 2 μ L, 1 μ L, 2 μ L, 2.5 mM dNTPs 3.5 μ L, 10 * EasyTaqBuffer 5 μ L, EasyTaqDNA Polymerase 1 μ L mends aseptic double-distilled water to 50 μ L;

The PCR product reclaims test kit with the DNA gel purifying and reclaims the purpose fragment after the agarose gel electrophoresis of 2.0 % mass volume ratios, and this purpose fragment is the goat alexin aim sequence of modification;

Described primer is:

1：ACT GAATTCATGAGTCGTCGAAGCTGCCATAGGAATAAAGGCGTCTGTGCT

2：CTGTCTCATGTTTCTAGGGCATCTGGTCAGAGCACAGACGCCTTT

3：AACTGGGGGACCGAAACAGGTGCCAATCTGTCTCATGTTTCT

4：CAG GCGGCCGCCTTCTTTCTGCAGCATTTAACTGGGGGACCGAA；

2) Construction and identification of recombinant expression plasmid:

Correct purpose fragment and the pPICZ α A expression vector of order-checking carried out double digestion with EcoR I and Not I respectively, use T after enzyme is cut ₄DNA ligase connects, and builds recombinant expression plasmid pPICZ α A/GBD-1; Recombinant expression plasmid is cultivated in containing the LB substratum of Zeocin, screened, extract plasmid with extracting in a small amount test kit, carry out double digestion, and recombinant expression plasmid pPICZ α A/GBD-1 is checked order, check order correct, be recombinant expression plasmid pPICZ α A/GBD-1;

3) conversion of recombinant plasmid:

With identifying that good recombinant expression plasmid pPICZ α A/GBD-1 with the linearizing of Sac I, in the transformed competence colibacillus pichia spp, utilizes electroporation to carry out electricity and turns, transform simultaneously pPICZ α A empty carrier in contrast; After turning, electricity coats in the YPD flat board that contains Zeocin, 30 ℃ have been cultured to single bacterium colony and have occurred, single colony inoculation is further cultivated in the YPD liquid nutrient medium that contains Zeocin, get the part bacterium colony, extract pastoris genomic dna, and utilize carrier special primer 5 ' AOX and 3 ' AOX to carry out PCR and identify, and order-checking;

5’AOX：GACTGGTTCCAATTGACAAGC

3’AOX：GCAAATGGCATTCTGACATCC；

4) abduction delivering of recombination yeast:

The positive recombinant plasmid that obtains in step 3) is inoculated in the BMGY nutrient solution activates 15h, centrifugal, remove supernatant, precipitation is induced after suspending with the BMMY nutrient solution, and it is 1ml bacterium liquid two pipes after 1%, 84h that every 24h adds methyl alcohol to final concentration, the centrifugal supernatant that stays ,-20 ℃ of preservations.

4. goat alexin claimed in claim 2 is in the application that suppresses on Escherichia coli Growth.

5. goat alexin claimed in claim 2 is in the application that suppresses on staphylococcus aureus growth.

6. goat alexin claimed in claim 2 is in the application that suppresses on the pneumonia streptococcus bacteria growing.

7. the application of goat alexin claimed in claim 2 on pork is fresh-keeping.