CN110386971A - A kind of channel catfish beta-alexin recombinant protein and its preparation method and application - Google Patents
A kind of channel catfish beta-alexin recombinant protein and its preparation method and application Download PDFInfo
- Publication number
- CN110386971A CN110386971A CN201810344147.0A CN201810344147A CN110386971A CN 110386971 A CN110386971 A CN 110386971A CN 201810344147 A CN201810344147 A CN 201810344147A CN 110386971 A CN110386971 A CN 110386971A
- Authority
- CN
- China
- Prior art keywords
- recombinant
- alexin
- recombinant protein
- beta
- bacterium
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/04—Antibacterial agents
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/461—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from fish
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Zoology (AREA)
- Medicinal Chemistry (AREA)
- Oncology (AREA)
- Toxicology (AREA)
- Pharmacology & Pharmacy (AREA)
- General Chemical & Material Sciences (AREA)
- Animal Behavior & Ethology (AREA)
- Communicable Diseases (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Gastroenterology & Hepatology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Genetics & Genomics (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The present invention provides a kind of channel catfish beta-alexin recombinant proteins, and amino acid sequence is as shown in SEQ ID No.1.The present invention also provides the preparation method of the recombinant protein and purposes.The present invention passes through yeast expression system, success construct channel catfish beta-alexin recombinant protein expression vector and by its great expression, purifying, the beta-alexin recombinant protein expression quantity of acquisition, purity are high, and have extensive bacteriostatic activity to Gram-negative bacteria, and application prospect is good.
Description
Technical field
The invention belongs to technical field of molecular biology, and in particular to a kind of channel catfish beta-alexin recombinant protein and
Preparation method and use.
Background technique
Antibacterial peptide (Antimicrobial peptides, AMPs) is a kind of polypeptide, is had in the defence of host's inherent immunity
There is very important effect, the infection of external microbe can be resisted.Due to traditional antibiotic abuse and antibody-resistant bacterium not
Stopping pregnancy is raw, has seriously affected the clinical therapeutic efficacy of infectious diseases.And antibacterial peptide has sterilization is strong, is not easy to cause drug resistance etc.
Advantage becomes the new research hotspot of antibacterials.
Beta-alexin (β-defnsin) has antibacterial activity, is immunized as a kind of antibacterial peptide more ancient in vertebrate
The various biologicals such as adjusting, chemotactic activity, is a kind of candidate new antibacterials for having much attraction at present.
Channel catfish is also referred to as spot Channel-catfish and ditch Nian, belongs to siluriformes, and Channel-catfish section fish are a kind of important economic fishes
Class, while being also the Typical Representative of alepidote.Because this fish has the speed of growth than very fast, meat spray is delicate, selling price ratio
Higher feature receives the welcome of the majority of consumers and aquaculture dealer.But various diseases of channel catfish in recent years
Disease occurs increasingly to increase with prevalence, the threat of Dui Ban Channel-catfish breeding production.Channel catfish can secrete a variety of antibacterial materials, if
The antibacterial material that its own can be utilized, improves its disease resistance, will generate significance to the sound development of culture fishery.
But it has not yet to see document report and separates beta-alexin antibacterial peptide from channel catfish, also have no through gene work
Cheng Fangfa obtains the report of high yield, high activity beta-alexin antibacterial peptide from channel catfish.
Summary of the invention
To solve the above-mentioned problems, the purpose of the present invention is to provide a kind of channel catfish beta-alexin recombinant protein and
Preparation method and use.
The present invention provides a kind of channel catfish beta-alexin recombinant protein, amino acid sequence such as SEQ ID No.1 institutes
Show.
The present invention also provides the nucleotide sequences for encoding above-mentioned recombinant protein.
Wherein, sequence is as shown in SEQ ID No.2.
The present invention also provides the recombinant vectors for containing above-mentioned nucleotide sequence；
Further, the recombinant vector is the pPICZ α A carrier of recombination.
The present invention also provides the recombinant bacteriums for containing above-mentioned nucleotide sequence；
Further, the recombinant bacterium is recombinant yeast, is recombinant yeast pichia pastoris X33 bacterial strain further.
The present invention also provides the preparation methods of above-mentioned recombinant protein, it includes the following steps:
A, above-mentioned recombinant bacterium is taken, is inoculated into BMGY/BMMY culture medium, 30 DEG C, when culture to OD600 is 0.6, centrifugation,
Take precipitating；
B, BMGY/BMMY culture medium is added in the precipitating of step a, is resuspended, methanol induction culture is added；
C, it is centrifuged, collects supernatant, purifying.
Wherein, it in step b, is resuspended to OD600It is 1.0；
The method of methanol induction culture are as follows: final concentration of 1% methanol is added, cultivates 48 hours；
Wherein, in step c, purifying nickel ion metal chelating affinity chromatography.
The present invention also provides above-mentioned recombinant protein, above-mentioned encoding gene, above-mentioned recombinant vector, recombinant bacteriums anti-in preparation
Purposes in bacterium drug.
Wherein, the bacterium is Escherichia coli, Aeromonas hydrophila and/or Aeromonas veronii.
The present invention is successfully constructed channel catfish beta-alexin recombinant protein expression vector and is incited somebody to action by yeast expression system
Its great expression, purifying, the beta-alexin recombinant protein expression quantity of acquisition, purity are higher, wherein purity is up to 80%, dense
Degree is up to 14-20mg/L, and beta-alexin recombinant protein of the present invention has extensive bacteriostatic activity to Gram-negative bacteria, answers
With having good prospects.
Obviously, above content according to the present invention is not being departed from according to the ordinary technical knowledge and customary means of this field
Under the premise of the above-mentioned basic fundamental thought of the present invention, the modification, replacement or change of other diversified forms can also be made.
The specific embodiment of form by the following examples remakes further specifically above content of the invention
It is bright.But the range that this should not be interpreted as to the above-mentioned theme of the present invention is only limitted to example below.It is all to be based on above content of the present invention
The technology realized all belongs to the scope of the present invention.
Detailed description of the invention
Fig. 1 ccBD Yeast expression gene order: RED sector is restriction enzyme site EcoRI/KpnI；Underscore, which shows, to be drawn
Object sequence.
Fig. 2 ccBD Yeast expression amino acid sequence: RED sector is 6 × His sequence label.
Fig. 3 linearization plasmid segment, M:marker 1000；1: the empty plasmid of linearisation；2: the pPICZ α A-of linearisation
CcBD segment.
Fig. 4 bacterium colony PCR detects the Pichia pastoris bacterium colony of the pPICZ α A-ccBD segment positive, 1-30: Pichia pastoris bacterium colony；M:
marker 2000；: negative control；+: positive control.
Detection of expression of Fig. 5 recombinant vector pPICZ α A-ccBD in Pichia pastoris,Yeast cells is not induced；
Unconverted recombinant vector yeast cells；1-20: positive clone molecule；+: positive control；MW: protein marker.
Fig. 6 Wstern-blot analysis,Yeast cells is not induced；Unconverted recombinant vector yeast cells；1-20:
Positive clone molecule；+: positive control；MW: protein marker.
SDS PAGE is analyzed after Fig. 7 protein purification, and MW: protein marker；IN: sample solution；FT；Percolation liquid is collected；W1-
3: cleaning solution is collected；E1-8: eluent is collected.
Sample detection after Fig. 8 albumen large-scale purification, MW: protein marker；12#:12 clone protein purification result；
16#:16 clone protein purification result.
Fig. 9 flat band method detection bacterium number, 1: Escherichia coli；2: Aeromonas hydrophila；3: Aeromonas veronii.
Figure 10 flat band method detection bacterium number, 1: Escherichia coli；2: Aeromonas hydrophila；3: Aeromonas veronii.
Figure 11 control group Escherichia coli scanning electron microscopic observation 40000 ×.
Figure 12 test group Escherichia coli scanning electron microscopic observation 40000 ×.
Specific embodiment
It is described further below with embodiment, but the present invention is not limited to these embodiments.
Raw material, equipment used in the specific embodiment of the invention are known product, are obtained by purchase commercial product.
The preparation of the channel catfish beta-alexin recombinant protein of the present invention of embodiment 1
One, experimental method
1, Express Sequence Tags and design of primers
Using 5.0 software of DNAstar and Preimer, with channel catfish beta-alexin (Channel catfish β-
Defensin, ccBD) region CDS design primer progress Pichia anomala expression.
Before expression, by online expression analysis tool EMBOSS (http: //
Genopole.toulouse.inra.fr/bioinfo/emboss codon preference analysis) is carried out to sequence, is then directed to ferment
Female expression system carries out codon optimization.Using SignalP 4.1Server (http://www.cbs.dtu.dk/
Services/SignalP signal peptide analysis) is carried out.
2, Pichia pastoris eukaryotic expression system constructs
It is cloned according to the primer pair ccBD gene order of design, uses restriction enzyme enzymatic treatment ccBD after clone respectively
CcBD and pPICZ α A after digestion, is then attached by cloned sequence and methanol evoked Yeast expression carrier pPICZ α A,
Construct Yeast expression carrier pPICZ α A-ccBD.Using restriction enzyme BstX I by the carrier pPICZ α A-ccBD line of building
Property, and the pPICZ α A-ccBD of linearisation is transferred to by Pichiapastoris expression strain X33 by electric converter.Then by electrotransformation
Pichia pastoris afterwards is cultivated, and the bacterium colony grown is identified using PCR, identifies that primer is 5'AOX:5'
Gactggttccaattgacaagc 3' and 3'AOX:5'gcaaatggcattctgacatcc 3'.
3, protein expression and western-blot detection
It selects 20 PCR and is accredited as positive Pichia pastoris clone progress protein expression screening.Positive clone molecule is existed
It cultivates under the conditions of 30 DEG C to OD6000.6 or so, thalline were collected by centrifugation, and is resuspended in BMGY/BMMY culture medium, makes its concentration
OD6001.0,1% methanol induction 48h is then added, collects culture medium supernatant and carries out SDS-PAGE analysis.
Albumen in order to further determine expression is 6 × His tag fusion protein, and the result that SDS PAGE is analyzed carries out
Western-blot is examined.The albumen in the PAGE glue of analysis is gone into pvdf membrane first, after closing 1h using 3%BSA, then is used
Mouse resists 6 × His tag antibody to be incubated for 2h, and HRP label sheep anti mouse secondary antibody is then added and is incubated for, is finally developed the color with ECL
Reaction.A large amount of induction tables are carried out according to two high clones of SDS-PAGE result and western-blot result selection expression quantity
It reaches.
4, albumen great expression and purifying
Two high clones of the expression quantity that previous step is identified carry out 100ml inducing expression respectively.According to the side in 3
Method, after clone is cultivated respectively, adjustment concentration reaches OD6001.0,1% methanol induction 48h is then added, collects culture medium
Then supernatant is dialysed 3 days under the conditions of 4 DEG C with the TBS of pH8.0.Albumen after dialysis passes through 0.22 μm of filtering with microporous membrane
Afterwards, Ni is then used2+- NTAresin is purified.Operating procedure is as follows: by filtered albumen with the flow velocity of 0.5ml/min
Loading is carried out, percolation liquid is collected；Foreign protein is carried out with low concentration imidazoles (30mM) after balance to wash, and collects cleaning solution；Finally use
The imidazole wash destination protein of 200mM collects eluent.Then purifying protein situation is detected with SDS-PAGE, with protein point
Analyzer measures protein concentration, and collects the albumen of high-purity for subsequent experimental.
Two, result and analysis
1, Express Sequence Tags and design of primers
It is analyzed by signal peptide analysis and codon preference, the gene order after channel catfish ccBD to be gone to signal peptide
It is expressed, expressing gene sequence fragment such as Fig. 1, wherein gene order piece segment length 159bp, RED sector are restriction enzyme site
EcoRI/KpnI, underscore show primer sequence.Gene order is translated as by amino acid sequence, amino acid using DNAstar software
Sequence fragment length is 51AAs, and albumen size is 5.42kDa, and the end C- has 6 × His sequence label (red expression, figure
2)。
CcBD Yeast expression gene order: dash area is restriction enzyme site EcoRI/KpnI；Underscore shows primer
Sequence
CcBD Yeast expression amino acid sequence: dash area is 6 × His sequence label
2, Pichia pastoris eukaryotic expression system constructs
Clip size about 4.0kb after the yeast expression vector pPICZ α A-ccBD linearisation of building, and empty plasmid
Clip size is less than the segment (Fig. 3) after pPICZ α A-ccBD linearisation.Then linearized vector segment electrotransformation is entered to finish red
In Yeast expression strain X 33, capable identification is dropped into 30 positive bacterias grown by PCR, is only there are two bacterium colony as the result is shown
Feminine gender, remaining is positive (Fig. 4), and then selecting 20, there is the bacterium colony compared with Strong positive signals to carry out inducing expression.
3, protein expression and western-blot analysis
After PCR to be accredited as to positive 20 clones progress methanol induction expression, collects supernatant and carry out SDS-PAGE points
Analysis.The results show that 20 clones, which have, expresses (destination protein as shown by arrows, about 6KDa or so) in various degree, but table
Up to amount lower (such as Fig. 5).In order to further determine protein expression situation, expression product is subjected to western-blot analysis.
The results show that 20 clones have expression (as shown by arrows) in various degree, wherein 12 and No. 16 clone expression quantity highests,
Therefore it is used as next step great expression clone.
4, albumen great expression and purifying
After Ni2+-NTA resin affinity chromatography purification, collects different component refined solution and carry out SDS-PAGE analysis.
The results show that destination protein is primarily present in the eluent of 200mM imidazole wash (shown in Fig. 7 arrow).Then more than
As a result, selection destination protein concentration is high respectively, the few elution fraction E6 of foreign protein is largely collected, and destination protein about 6KDa is left
Right (Fig. 8).After protein analyzer measures, the protein content of No. 12 bacterial strain 100ml expression is 2mg, and purity 80%, yield is
20mg/L；The protein content of No. 16 bacterial strain 100ml expression is 1.4mg, purity 80%, yield 14mg/L.Further using poly-
To 1.8mg/ml, -80 DEG C save for subsequent detection experiment ethylene glycol concentration.
As it can be seen that present invention obtains the channel catfish beta-alexin recombinant proteins of high-purity.
The Activity determination of the channel catfish beta-alexin recombinant protein of the present invention of embodiment 2
One, bacteriostatic activity detection method
1, flat band method detection bacterium growing state
By Escherichia coli (ATCC 25922), Aeromonas hydrophila (16S rRNAGenBank:GQ331029.1), Vickers
Aeromonas (ATCC 51106) recovers from guarantor's tube, uses LB meat soup overnight incubation.1mL thallus is drawn respectively in centrifuge tube
In be centrifuged off supernatant, then using sterile PBS wash 2 times；Using Maxwell opacity tube method, bacterium solution is diluted to 1 × 107CFU/
mL.Bacterium solution is then subjected to 100 times of dilutions, takes 25 μ L bacterium solutions to mix in sterile centrifugation tube with 25 μ L ccBD to be measured respectively dense eventually
Degree is that (0.9mg/ml) is test group, using Amp final concentration 100mg/mL as positive control, using water as negative control, and every group of 3 weights
It is multiple, it is placed in 37 DEG C of incubators and is incubated for 2h.After incubation, 1 μ L liquid is taken to spread bacterium in LB plate, cultivates 16h, bacterium meter
Number.
2, spectrophotometry bacterial growth situation
Escherichia coli, Aeromonas hydrophila and Aeromonas veronii bacterium solution are diluted to 1 using Maxwell opacity tube method ×
107CFU/m L.Bacterium solution is then subjected to 100 times of dilutions, takes 100 μ L bacterium solutions to be measured with 100 μ L in sterile centrifugation tube respectively
It is test group that ccBD, which mixes final concentration of (0.5mg/ml), is negative right with water using Amp final concentration 100mg/mL as positive control
According to every group of 3 repetitions are placed in 37 DEG C of incubators and are incubated for 8h.The calibration group for containing only culture medium and drug is set up simultaneously.To thin
After bacterium is incubated for, slight concussion is mixed, and reads each group OD using microplate reader600Absorbance value, ODSample=ODTest group- OD correction
Group.
3, pattern changes after scanning electron microscopic observation expression polypeptide and Escherichia coli act on
Take 500 μ l of Escherichia coli in sterile centrifugation tube, processing polypeptide makes its final concentration of 25 μ g/ml (1 × MIC), locates
PBS is managed as control, 37 DEG C are cultivated, and processing group samples after 2h, and control group samples when 0.5h.4000 × g of sample is centrifuged
5min collects precipitating, and 2.5% glutaraldehyde solution of 1ml is added into precipitating and mixes, 4 DEG C of fixed 2h.After set time reaches 2h
4000 × g of sample is centrifuged 5min, is dehydrated immediately: successively carrying out ladder with 30%, 50%, 70%, 85%, 95%, 100% ethyl alcohol
Degree dehydration, each serial dehydration 10min.Sample is placed in 100% ethyl alcohol and saves, and then carries out CO2Dry, metal spraying, upper machine shines
Phase.
Two, experimental result
1, it is mixed respectively using flat band method detection Escherichia coli, Aeromonas hydrophila and Aeromonas veronii after being incubated for 2h
Bacterial number (Fig. 9).
The bacterial population of negative control group is respectively 108 ± 4.18CFU/uL, and 284 ± 9.85CFU/uL and 229.33 ±
5.18CFU/uL；
And the positive controls of Amp are respectively 53.33 ± 6.03CFU/uL, 60.00 ± 15.72CFU/uL and 88.33 ±
15.01CFU/uL is significantly lower than negative control group；
The test group of channel catfish beta-alexin antibacterial peptide of the present invention is slightly above Amp positive controls, but is significantly lower than
Negative control group, respectively 73.67 ± 5.03CFU/uL, 152.33 ± 7.23CFU/uL and 146.00 ± 11.53CFU/uL.
Inhibit to include Escherichia coli, Aeromonas hydrophila as it can be seen that channel catfish beta-alexin antibacterial peptide of the present invention has
With the activity of the Gram-negative bacteria growth including Aeromonas veronii.
2, using spectrophotometry:
Negative control group OD600Respectively 0.41,0.36 and 0.96；
Amp positive controls OD600Respectively -0.39, -0.22 and 0.26 it is significantly lower than negative control group；Spot of the present invention
Cha Wei Channel-catfish beta-alexin antibacterial peptide acts on OD after three kinds of bacteriums600Though respectively 0.20,0.16 and 0.59 are not as good as positive controls
It is low, but it is significantly lower than negative control group (Figure 10).
As it can be seen that it includes Escherichia coli, Aeromonas hydrophila and dimension that channel catfish beta-alexin antibacterial peptide of the present invention, which has,
The activity of Gram-negative bacteria growth including family name Aeromonas.
3, in order to understand effect of the expression polypeptide to bacterial cell membrane, large intestine is handled using scanning electron microscopic observation expression polypeptide
The case where thallus pattern damages after bacillus.
The results show that control group phage surface is smooth, edge is completely in short and small rod-shaped (Figure 11)；2h is acted on through expression polypeptide
There is vesicular protrusion, surface ruffle in phage surface afterwards, and form changes (Figure 12).As it can be seen that expression polypeptide can cause cell
Film surface distorts, and endochylema content is excessive, accumulates, and forms vesicular, tentacle shape protrusion.As a result further confirm that expression is more
Peptide has destruction to Escherichia coli.
To sum up, successful expression of the present invention has purified channel catfish beta-alexin recombinant protein, and verifies the recombinant protein
With stronger bacteriostatic activity, application prospect is good.
Sequence table
<110>Sichuan Agricultural University
<120>a kind of channel catfish beta-alexin recombinant protein and its preparation method and application
<130> GY151-18P1164
<160> 2
<170> SIPOSequenceListing 1.0
<210> 1
<211> 43
<212> PRT
<213>channel catfish (Ietalurus Punetaus, beta-alexin recombinant protein)
<400> 1
Val Ser Phe Pro Trp Ser Cys Ala Ala Leu Ser Gly Val Cys Arg Gln
1 5 10 15
Gly Ala Cys Leu Pro Ser Glu Leu Tyr Phe Gly Pro Leu Gly Cys Gly
20 25 30
Lys Gly Ser Leu Cys Cys Val Ser Tyr Phe Leu
35 40
<210> 2
<211> 159
<212> DNA
<213>channel catfish (Ietalurus Punetaus, beta-alexin)
<400> 2
atggtctcct tcccctggtc ctgcgccgcc ctctccggcg tctgccgcca gggcgcctgc 60
ctcccctccg agctctactt cggccccctc ggctgcggca agggctccct ctgctgcgtc 120
tcctacttcc tcggctccca ccaccaccac caccactag 159
Claims (10)
1. a kind of channel catfish beta-alexin recombinant protein, it is characterised in that: amino acid sequence is as shown in SEQ ID No.1.
2. encoding the nucleotide sequence of recombinant protein described in claim 1.
3. according to right want 2 described in nucleotide sequence, it is characterised in that: sequence is as shown in SEQ ID No.2.
4. the recombinant vector containing nucleotide sequence described in Claims 2 or 3；
Further, the recombinant vector is the pPICZ α A carrier of recombination.
5. the recombinant bacterium containing nucleotide sequence described in Claims 2 or 3；
Further, the recombinant bacterium is recombinant yeast, is recombinant yeast pichia pastoris X33 bacterial strain further.
6. the preparation method of recombinant protein described in claim 1, it is characterised in that: it includes the following steps:
A, recombinant bacterium as claimed in claim 6 is taken, is inoculated into BMGY/BMMY culture medium, 30 DEG C, culture to OD600 is 0.6
When, centrifugation takes precipitating；
B, BMGY/BMMY culture medium is added in the precipitating of step a, is resuspended, methanol induction culture is added；
C, it is centrifuged, collects supernatant, purifying.
7. preparation method according to claim 6, it is characterised in that:
In step b, it is resuspended to OD600It is 1.0；
The method of methanol induction culture are as follows: final concentration of 1% methanol is added, cultivates 48 hours.
8. preparation method according to claim 6, it is characterised in that:
In step c, purifying nickel ion metal chelating affinity chromatography.
9. encoding gene described in recombinant protein, Claims 2 or 3 described in claim 1, recombinant vector described in claim 4, again
Group bacterium is in the purposes in preparation antibacterials.
10. purposes according to claim 9, it is characterised in that: the bacterium be Escherichia coli, Aeromonas hydrophila and/or
Aeromonas veronii.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810344147.0A CN110386971A (en) | 2018-04-17 | 2018-04-17 | A kind of channel catfish beta-alexin recombinant protein and its preparation method and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810344147.0A CN110386971A (en) | 2018-04-17 | 2018-04-17 | A kind of channel catfish beta-alexin recombinant protein and its preparation method and application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN110386971A true CN110386971A (en) | 2019-10-29 |
Family
ID=68283006
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810344147.0A Pending CN110386971A (en) | 2018-04-17 | 2018-04-17 | A kind of channel catfish beta-alexin recombinant protein and its preparation method and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110386971A (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103103196A (en) * | 2013-02-04 | 2013-05-15 | 华中农业大学 | Modified goat defensin gene and preparation method and application thereof |
| US20150141499A1 (en) * | 2011-09-12 | 2015-05-21 | Moderna Therapeutics, Inc. | Engineered nucleic acids and methods of use thereof |
| CN105400791A (en) * | 2015-12-04 | 2016-03-16 | 上海海洋大学 | Optimized gene of zebrafish defensin defbl3 and preparation method of recombinant protein thereof |
| CN107312094A (en) * | 2017-07-06 | 2017-11-03 | 上海海洋大学 | A kind of heterozygous antibacterial peptide and its preparation method and application |
-
2018
- 2018-04-17 CN CN201810344147.0A patent/CN110386971A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20150141499A1 (en) * | 2011-09-12 | 2015-05-21 | Moderna Therapeutics, Inc. | Engineered nucleic acids and methods of use thereof |
| CN103103196A (en) * | 2013-02-04 | 2013-05-15 | 华中农业大学 | Modified goat defensin gene and preparation method and application thereof |
| CN105400791A (en) * | 2015-12-04 | 2016-03-16 | 上海海洋大学 | Optimized gene of zebrafish defensin defbl3 and preparation method of recombinant protein thereof |
| CN107312094A (en) * | 2017-07-06 | 2017-11-03 | 上海海洋大学 | A kind of heterozygous antibacterial peptide and its preparation method and application |
Non-Patent Citations (3)
| Title |
|---|
| JIEYAOZHU 等: ""Identification and characterization of a β-defensin gene involved in the immune defense response of channel catfish, Ictalurus punctatus"", 《MOLECULAR IMMUNOLOGY》 * |
| ZHU,J.: ""beta-defensin [Ictalurus punctatus]"", 《GENBANK》 * |
| 李雯: ""鱼类来源的抗菌肽在毕赤酵母中的表达"", 《中国优秀硕士学位论文全文数据库(电子期刊) 基础科学辑》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109593126A (en) | Polypeptide, its production method and purposes | |
| US20120009625A1 (en) | Secretion expression of antibiotic peptide cad in bacillus subtilis and expression system of recombination bacillus subtilis | |
| CN106676086B (en) | A kind of the zytase xyn-LVK and its gene of thermal stability improvement | |
| CN101063145B (en) | Expression carrier for black porgy antibiotic peptide Hepcidin and expression product and constructing preparation method | |
| CN106800595A (en) | A kind of method that Pichia pastoris high efficient expression recombinates PaDef antibacterial peptides | |
| CN107312094A (en) | A kind of heterozygous antibacterial peptide and its preparation method and application | |
| WO2024087784A1 (en) | Recombinant type xvii humanized collagen expressed in yeast and preparation method therefor | |
| CN112760253A (en) | Lactobacillus plantarum, antibacterial peptide and application thereof | |
| CN105219779B (en) | Red claw crayfish coagulogen and preparation method and application | |
| CN108314718B (en) | Housefly antibacterial peptide MAF-1A peptide polymer, encoding gene thereof, expression and application thereof | |
| CN111394333B (en) | Ochratoxin detoxification enzyme, and coding gene, recombinant vector and application thereof | |
| CN104962566A (en) | Recombinant bacteriocin and preparation method and application thereof | |
| CN112457413B (en) | Method for fusion expression of antibacterial peptide by using SUMO | |
| CN105622763A (en) | Antimicrobial peptide fusion protein and preparation method and application thereof | |
| CN110256570A (en) | A kind of recombination fusion antibacterial peptide and application | |
| CN110386971A (en) | A kind of channel catfish beta-alexin recombinant protein and its preparation method and application | |
| CN110755605A (en) | Flavobacterium columnare transgenic engineering oral vaccine, use method and application | |
| CN116196393A (en) | Application of antibacterial peptide AP138 in preparation of antibacterial drugs | |
| US10563210B2 (en) | Method for producing interleukin-2 protein using methylotrophic yeast | |
| CN108752431B (en) | Heterozygous antibacterial peptide Mel-MytB and its application | |
| CN108265068B (en) | Recombinant arginine deiminase and industrial preparation method and application thereof | |
| CN113234137B (en) | Application of CXCL20a protein isolated from grass carp as antibacterial peptide | |
| CN116262782B (en) | Antibacterial peptide coleoptericin and prokaryotic expression method and application thereof | |
| CN116143899B (en) | Recombinant antimicrobial peptide pANG4 and preparation method and application thereof | |
| CN104628845B (en) | A kind of Cyanea capillata serpin and its encoding gene and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20191029 |
|
| RJ01 | Rejection of invention patent application after publication |