CN112760253A

CN112760253A - Lactobacillus plantarum, antibacterial peptide and application thereof

Info

Publication number: CN112760253A
Application number: CN202110069093.3A
Authority: CN
Inventors: 索化夷
Original assignee: Southwest University
Current assignee: Southwest University
Priority date: 2021-01-19
Filing date: 2021-01-19
Publication date: 2021-05-07
Anticipated expiration: 2041-01-19
Also published as: CN112760253B

Abstract

The invention discloses a lactobacillus plantarum, wherein a strain SHY21-2 is preserved in China center for type culture Collection with the preservation number of CCTCC NO: m2020043. The antibacterial peptide is produced by fermenting the lactobacillus plantarum to obtain fermentation liquor, and the antibacterial peptide is obtained by concentrating and purifying. Also discloses a coding gene of the antibacterial peptide, application of the lactobacillus plantarum in preparing antibacterial drugs or food preservatives, and application of the antibacterial peptide in preparing antibacterial drugs or food preservatives. The antibacterial peptide has a wide antibacterial spectrum, but has no inhibition effect on common probiotics unlike other reported antibacterial peptides, and has stable activity and good heat resistance; the antibacterial peptide can be digested and absorbed by human body, can be used as natural food preservative, and is safe and harmless to human body; the molecular weight of the peptide is small, the peptide is synthesized artificially, and the peptide can be used in the fields of food, medicine and the like.

Description

Lactobacillus plantarum, antibacterial peptide and application thereof

Technical Field

The invention relates to the technical field of microorganisms, in particular to a novel lactobacillus plantarum strain, an antibacterial peptide produced by the novel lactobacillus plantarum strain and application of the novel lactobacillus plantarum strain.

Background

The problem of microbial safety during food production, processing and storage has been a long-standing focus of attention in the food industry. The addition of chemical preservatives is a common preservative means at present, such as benzoic acid and salts thereof, sorbic acid and salts thereof and the like. However, as consumer demand for high quality food products increases, the potential hazards of chemical preservative additives are of increasing concern. Therefore, the preservation by using the nontoxic and harmless biological preservative is an important development direction in the future.

Antimicrobial peptides (AMPs) are favored by people because of their small molecular weight, ease of synthesis, non-toxicity, no pollution, no side effects, no drug resistance, and ability to be digested by the human body. However, the conventional bacteriocin used in the food industry is only Nisin, but Nisin has a narrow antibacterial spectrum and cannot inhibit gram-negative bacteria and yeasts. Therefore, the search for a high-efficiency broad-spectrum bacteriocin is of great significance. Antibacterial peptides are produced in insects, amphibians, aquatic animals, mammals including humans, and even plants and bacteria. Wherein, the lactobacillus can generate antibacterial peptide with wide antibacterial spectrum and stable property; and the lactic acid bacteria are widely present in various fermented foods, so that the food preservation is more convenient.

Disclosure of Invention

The invention aims to solve the problems and provide a novel lactobacillus plantarum strain, an antibacterial peptide produced by the strain and application of the strain.

In order to achieve the purpose, the invention adopts the technical scheme that:

the Lactobacillus plantarum strain is preserved in China Center for Type Culture Collection (CCTCC) with the preservation number of CCTCC NO: m2020043.

An antibacterial peptide produced by the lactobacillus plantarum.

Preferably, the amino acid sequence of the antibacterial peptide is RPNEPRLLLPR.

The preparation method of the antibacterial peptide comprises the steps of fermenting the lactobacillus plantarum to obtain fermentation liquor, and concentrating and purifying to obtain the antibacterial peptide.

A coding gene of the antibacterial peptide.

Preferably, the nucleotide sequence of the coding gene is shown as SEQ ID NO. 2.

The lactobacillus plantarum is applied to preparation of antibacterial drugs or food preservatives.

The application of the antibacterial peptide in preparing antibacterial drugs or food preservatives.

The invention has the beneficial effects that: the antibacterial peptide has a wide antibacterial spectrum, but has no inhibitory effect on common probiotics such as lactobacillus casei, lactobacillus helveticus and the like, different from other reported antibacterial peptides. The minimum inhibitory concentration to staphylococcus aureus is 156ug/mL, the activity is stable, and the activity is not obviously changed even if the staphylococcus aureus is treated at 121 ℃ for 30min, which shows that the staphylococcus aureus has good heat resistance. The antibacterial peptide can be digested and absorbed by human body, can be used as natural food antiseptic, and is safe and harmless to human body. The molecular weight of the peptide is small, the peptide is synthesized artificially, and the peptide can be used in the fields of food, medicine and the like.

Drawings

FIG. 1 is a high performance liquid chromatography elution curve of antimicrobial peptide plantaricin LP 21-2.

FIG. 2 is a mass spectrum of antimicrobial peptide plantaricin LP 21-2.

FIG. 3 is a graph of the mode of action of antimicrobial peptides on plantaricin LP 21-2 S.aureus.

Detailed Description

The invention is further illustrated by the following examples, which are not intended to be limiting.

The experimental procedures in the following examples are conventional unless otherwise specified.

The main reagents are as follows:

MRS broth, purchased from czochralski microbiology ltd, cat #: 027312, respectively;

LB broth, available from beijing solibao technologies ltd, cat #: l8291.

Example 1: preparation, separation and purification of antibacterial peptide plantaricin LP 21-2

Sterilizing and cooling a 1LMRS liquid culture medium, inoculating 1% (v/v) of Lactobacillus plantarum SHY21-2 bacterial liquid cultured to logarithmic phase, culturing at 37 ℃ for 26h, centrifuging the obtained fermentation liquid at 4000rpm for 10min to obtain supernatant, adding 80% ammonium sulfate into the supernatant for salting out, centrifuging at 11000rpm for 15min to obtain precipitate, dissolving the precipitate obtained by centrifugation in 20mM citric acid-phosphate buffer solution with pH of 3.0, and conducting electric dilution on the solution to below 10mS/cm by using pure water after full dissolution. The diluted sample was separated by using an SP Sepharose Fsat Flow cation column (product of GE, USA); the buffer solution is as follows: solution a was 20mM citric acid-phosphate buffer solution having pH 3.0, and solution B was a solution in which NaCl was added. The eluate was collected and further separated by passing through a hydrophobic column Octyl Sepharose 4 Fast Flow (product of GE, USA); the buffers used for isolation were: the solution A contains 1.3mol/LNH₂SO₄Solution B was solution a without NH added thereto (20 mM citrate-phosphate buffer (pH 4))₂SO₄. The sample purified by the hydrophobic column was lyophilized and concentrated, and further purified by using Superdex-20010/300 GL gel column (product of GE, USA) as eluent, 20mM citrate-phosphate buffer solution with pH 4. Subjecting the peak with antibacterial activity after molecular sieve purification to final purification by reversed-phase high performance liquid chromatography (FIG. 1 is antibacterial peptide plantaricin LP 21-2 high performance liquid chromatography elution curve), to obtain antibacterial peptide plantaricin LP 21-2, wherein the purification conditions are as follows: agilent Shim-pack Arata C18(5 μm, 250L. times.4.6), liquid A: ultrapure water + 0.1% (v/v) trifluoroacetic acid, liquid B: acetonitrile + 0.1% trifluoroacetic acid; gradient elution procedure: 0-4min, 10% B; 4-33min 10% -100% B; 33-38min, 100% B; 38-43min, 100% -0% B; sample introduction amount: 100uL, detection wavelength: 220nm, flow rate: 0.6 mL/min. Detecting the bacteriostatic activity by an agar diffusion method, and selecting staphylococcus aureus as an indicator bacterium; the retention time for collecting the active peak is 4.835 min.

Lactobacillus plantarum SHY21-2 strain is delivered to China center for type culture Collection (CCTCC for short) for preservation in 1 month 2020, and the address is eight Lopa of the Wuchang region in Wuhan City in Hubei province. The preservation date is 1 month and 13 days 2020, and the preservation number is CCTCC NO: m2020043, classified under the name Lactobacillus plantarum SHY 21-2.

The antibacterial peptide plantaricin LP 21-2 is subjected to structure analysis and amino acid sequencing by an LC-MS/MS method, and FIG. 2 is a mass spectrum of the antibacterial peptide plantaricin LP 21-2. The amino acid sequence of the obtained antibacterial peptide plantaricin LP 21-2 is RPNEPRLLLPR (SEQ ID NO:1), and the molecular weight of the peptide is 1362.84 Da. The specific characteristics of the antibacterial peptide plantaricin LP 21-2 are as follows:

(a) sequence characteristics:

length: 11

Type (2): amino acid sequence

Chain type: single strand

Topological structure: linearity

(b) Molecular type: protein

(c) Suppose that: whether or not

(d) Antisense: whether or not

Example 2: antibacterial peptide plantarum LP 21-2 bacteriostasis experiment

(1) Bacterial inhibition spectrum

The antibacterial activity of the antibacterial peptide is measured by adopting an agar diffusion method, staphylococcus aureus is selected as an indicator bacterium, a thin layer of 1.5% sterile agar is poured into a sterile culture dish, and after the sterilization agar is solidified, an oxford cup is clamped by a pair of tweezers and is uniformly placed on the agar. Preparing an LB semisolid culture medium, sterilizing and cooling until hands are not scalded; then adding 1% (v/v) of indicator bacteria in logarithmic phase to LB semisolid culture medium (final concentration is 10)⁶CFU/mL) to prepare a culture medium containing the indicator bacteria, shaking uniformly, and pouring the culture medium onto an agar plate with an oxford cup, wherein the culture medium containing the indicator bacteria is one fourth of the culture medium in the oxford cup. And after the semisolid culture medium is solidified, taking out the oxford cup, opening the flat cover, and placing in an aseptic operating platform for 0.5h to volatilize water. The solution of antibacterial peptide plantarum LP 21-2 (concentration is 0.4mg/mL) purified in example 1 was pipetted 100. mu.L into the Oxford cup well of the plate, the plate was sealed with a sealing gel and placed in a refrigerator at 4 ℃ for 2h to allow the bacteriocin to diffuse sufficiently in the plate. Finally, the flat plate is placed in a constant temperature incubator at 37 ℃, the bacteriostasis effect is observed after overnight culture, and the bacteriostasis zone is measured by a vernier caliper. The results are shown in Table 1, and the plantaricin LP 21-2 has certain inhibitory effect on common food-borne pathogenic bacteria and food spoilage bacteria, which indicates that the plantaricin LP 21-2 is a broad-spectrum antibacterial peptide. However, the plantaricin LP 21-2 has no inhibition effect on common probiotics, which is obviously different from other reported antibacterial peptides, and the plantaricin LP 21-2 has the remarkable characteristics, and can be used as a natural food preservative in foods such as yoghourt and the like.

TABLE 1 bacteriostatic effect of plantaricin LP 21-2 on different bacteria

(2) Minimum inhibitory concentration against Staphylococcus aureus

The RP-HPLC purified plantaricin LP 21-2 and Staphylococcus aureus liquid were mixed in a 96-well plate, and double diluted with LB liquid medium, with no antimicrobial peptide added as a control. After incubation at 37 ℃ for 12h, OD was determined₆₀₀The value is obtained. As a result, the minimum inhibitory concentration of plantaricin LP 21-2 to staphylococcus aureus was found to be 156 ug/mL.

Example 3: sensitivity of antibacterial peptide plantaricin LP 21-2 to heat and protease

0.5mL of the antibacterial peptide plantaricin LP 21-2 (concentration 0.4mg/mL) solution purified in example 1 was dispensed into 1.5mL centrifuge tubes, heated at 60 ℃ and 80 ℃ for 10min and 30min, respectively, at 100 ℃ and 121 ℃ for 15min and 30min, respectively, and then treated at room temperature as a control. After the treatment, staphylococcus aureus is used as an indicator bacterium, the antibacterial activity is detected by an agar diffusion method, and 100uL of antibacterial peptide solution is added into each Oxford cup hole. Samples purified by gel column chromatography were weighed out using staphylococcus aureus as indicator bacteria and dissolved in 1mL of buffer solution at

pH

2, 3, 4, 5, 6, 7, 8, and 9, respectively, at a concentration of 0.4 mg/mL. After being soaked in water bath at 37 ℃ for 4 h; the antimicrobial activity was checked by agar diffusion using a blank buffer with

pH

2, 3, 4, 5, 6, 7, 8, 9, and 100uL bacteriocin solution was added to each well of oxford cup, 3 replicates each. Dissolving an antibacterial peptide sample in a buffer solution corresponding to protease, and respectively adding pepsin, proteinase K, papain and trypsin solution to mix uniformly, wherein the final concentration of the enzyme is 1mg/mL, and the final concentration of the antibacterial peptide is 0.4 mg/mL. After being soaked in water at 37 ℃ for 4 hours, the pH value of the solution is adjusted to 4 by using 3mol/L HCI and 3mol/L NaOH, the residual activity after each protease treatment is detected, a sample which is not treated by the protease is used as a reference, the antibacterial activity is detected by an agar diffusion method, and 100uL of antibacterial peptide solution is added into each Oxford cup hole. The results are shown in tables 2, 3 and 4.

TABLE 2 bacteriostatic effect of plantaricin LP 21-2 after different temperature treatment

TABLE 3 bacteriostatic activity of plantaricin LP 21-2 under different pH conditions

TABLE 4 bacteriostatic effect of plantaricin LP 21-2 after different enzyme treatments

As can be seen from Table 2, the plantaricin LP 21-2 is still active after high temperature treatment, indicating that it has good heat resistance. As can be seen from Table 3, plantaricin LP 21-2 has bacteriostatic activity in the pH range of 2-5, indicating that the antimicrobial peptide is suitable for use in acidic foods. As shown in Table 4, the plantaricin LP 21-2 can be inactivated by pepsin, trypsin and papain in the human digestive tract, which indicates that the plantaricin LP 21-2 is safe for food preservation.

Example 4: mode of action of antibacterial peptide plantaricin LP 21-2

Adding 1% (v/v) of staphylococcus aureus liquid into 5mL of LB liquid culture medium, and culturing at 37 ℃ to logarithmic phase; the antibacterial peptide purified by R-HPLC in example 1 was weighed and added to the bacterial solution to a final concentration of 0.4mg/mAnd L. After addition of the sample, the broth was further incubated at 37 ℃. After inoculating the bacterial liquid, measuring the OD of the bacterial liquid every 2h₆₀₀A value; after the antibacterial peptide is added, sampling at 0, 0.5, 1, 1.5, 2, 2.5, 3 and 4 hours to determine the total number of colonies; no bacteriocin was added as a control. As shown in FIG. 3, OD was obtained after adding the antimicrobial peptide to Staphylococcus aureus solution₆₀₀The value did not increase any more and the number of viable cells of Staphylococcus aureus decreased sharply starting from 1.5h, after 3h of treatment the number of viable cells was 0. The antibacterial peptide plantaricin LP 21-2 is shown to act on staphylococcus aureus in a bactericidal mode.

Example 5: gene sequence of basic structure of coded antibacterial peptide plantaricin LP 21-2

After the whole gene sequencing of the strain SHY21-2 was completed, the position of the gene encoding plantaricin LP 21-2 was predicted using BLASTP program based on the amino acid sequence of plantaricin LP 21-2. Finally, the sequence of the gene coding the antibacterial peptide plantaricin LP 21-2 is determined to be shown in SEQ ID NO. 2, and the open reading frame of the gene is underlined, namely the gene coding the plantaricin LP 21-2 precursor basic structure.

The SEQ ID NO 2 sequence is as follows:

TTAATGATTTATTTGAGCTGTGGAAGGTAAACGCGGTTCTGAATGTCTCTTAAAATCTGTCTCAAATATTGACTTCAATCCAATCCGCGCCTCGCGTTGGTATGCATATTGGTCTCGTTTTAGAAACAAAGTTTCCATGGATTTTTGTTTAAATTCTTTCAAAGAGATATTCTCTTCAATTTTATCAGAATAATAGTGAACATTTTTAAATTCCGCATGATATTTTGAAAAATTAGAATCCAATTTTTGCAGAAATTTTTGAGCATCAATCATAACTGGAATTCTCTTTTTGTTATCGCTCAGACGATTTAAATCATTAATGACTGACTTCTTTAACGTATATTGATTTCTTGAATCGTCATAGTCTATACAATCAAAATCTTCTATTAAATCTAAGTTAATCAGAGATAAAATCCCCTTTTCTCTGACCCATTGAGGTACAGAAACTATTCTTATTGTATCGCCTTCACAAAAGTCTATCTTTTTCCCATTAATAGAGACAAAGATATCCGAATTTGCTGCATCTAAATTAAGTATCCTAGATCCCTCAAAAGCATCTGCAATTACATCTCCATCATTTTCCAAATCGATGAAATATCC TAATTGTGAAAAATGTAACTCACCTTCATTAATAAATTTATCGACATACTTTTTTTCAAAAAACTTTATCACACAT CCTGGTTGAGTATCGTTAATCAT。

sequence listing

<110> university of southwest

<120> Lactobacillus plantarum, antibacterial peptide and application thereof

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 11

<212> PRT

<213> Artificial sequence (Artificial sequence)

<400> 1

Arg Pro Asn Glu Pro Arg Leu Leu Leu Pro Arg

1 5 10

<210> 2

<211> 699

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 2

ttaatgattt atttgagctg tggaaggtaa acgcggttct gaatgtctct taaaatctgt 60

ctcaaatatt gacttcaatc caatccgcgc ctcgcgttgg tatgcatatt ggtctcgttt 120

tagaaacaaa gtttccatgg atttttgttt aaattctttc aaagagatat tctcttcaat 180

tttatcagaa taatagtgaa catttttaaa ttccgcatga tattttgaaa aattagaatc 240

caatttttgc agaaattttt gagcatcaat cataactgga attctctttt tgttatcgct 300

cagacgattt aaatcattaa tgactgactt ctttaacgta tattgatttc ttgaatcgtc 360

atagtctata caatcaaaat cttctattaa atctaagtta atcagagata aaatcccctt 420

ttctctgacc cattgaggta cagaaactat tcttattgta tcgccttcac aaaagtctat 480

ctttttccca ttaatagaga caaagatatc cgaatttgct gcatctaaat taagtatcct 540

agatccctca aaagcatctg caattacatc tccatcattt tccaaatcga tgaaatatcc 600

taattgtgaa aaatgtaact caccttcatt aataaattta tcgacatact ttttttcaaa 660

aaactttatc acacatcctg gttgagtatc gttaatcat 699

Claims

1. The Lactobacillus plantarum strain is preserved in China Center for Type Culture Collection (CCTCC) with the preservation number of CCTCC NO: m2020043.

2. An antimicrobial peptide, characterized by: the antimicrobial peptide is produced by the lactobacillus plantarum of claim 1.

3. The antimicrobial peptide of claim 2, wherein: its amino acid sequence is RPNEPRLLLPR.

4. A process for the preparation of an antimicrobial peptide according to claim 2 or 3, characterized in that: is obtained by fermenting lactobacillus plantarum of claim 1 to obtain a fermentation broth, concentrating and purifying to obtain the antibacterial peptide.

5. A gene encoding the antibacterial peptide according to claim 3.

6. The coding gene of claim 5, wherein: the nucleotide sequence is shown in SEQ ID NO. 2.

7. Use of the lactobacillus plantarum of claim 1 in the preparation of an antibacterial drug or food preservative.

8. Use of the antimicrobial peptide of claim 2 or 3 for the preparation of an antimicrobial medicament or a food preservative.