CN104628845B - A kind of Cyanea capillata serpin and its encoding gene and application - Google Patents

A kind of Cyanea capillata serpin and its encoding gene and application Download PDF

Info

Publication number
CN104628845B
CN104628845B CN201510030152.0A CN201510030152A CN104628845B CN 104628845 B CN104628845 B CN 104628845B CN 201510030152 A CN201510030152 A CN 201510030152A CN 104628845 B CN104628845 B CN 104628845B
Authority
CN
China
Prior art keywords
serpin
cyanea capillata
cyanea
capillata
encoding gene
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201510030152.0A
Other languages
Chinese (zh)
Other versions
CN104628845A (en
Inventor
张黎明
柳国艳
周永红
贺茜
王倩倩
王蓓蕾
刘丹
张慧
成熙
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Second Military Medical University SMMU
Original Assignee
Second Military Medical University SMMU
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Second Military Medical University SMMU filed Critical Second Military Medical University SMMU
Priority to CN201510030152.0A priority Critical patent/CN104628845B/en
Publication of CN104628845A publication Critical patent/CN104628845A/en
Application granted granted Critical
Publication of CN104628845B publication Critical patent/CN104628845B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/81—Protease inhibitors
    • C07K14/8107—Endopeptidase (E.C. 3.4.21-99) inhibitors
    • C07K14/811—Serine protease (E.C. 3.4.21) inhibitors
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/55—Protease inhibitors
    • A61K38/57—Protease inhibitors from animals; from humans

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Enzymes And Modification Thereof (AREA)

Abstract

The invention belongs to biomedicine technical field, has not yet to see the relevant research report to jellyfish Kazal type serpins.The invention provides a kind of Cyanea capillata Kazal type serpins and preparation method thereof, described Cyanea capillata serpin, there is such as SEQ ID NO:The protein of amino acid sequence composition shown in 2.Present invention also offers the encoding gene of Cyanea capillata serpin, has such as SEQ ID NO:Nucleotide sequence shown in 1.Meanwhile the application present invention also offers Cyanea capillata serpin and its encoding gene in antibacterials, anti-inflammation drugs, shielding medicine for skin etc. is prepared.

Description

A kind of Cyanea capillata serpin and its encoding gene and application
Technical field
The invention belongs to biomedicine technical field, and in particular to a kind of Cyanea capillata serpin and Its encoding gene and application.
Background technology
Ocean is the treasure-house of living resources, and the species in the whole world more than 80% are contained in Yu Haiyang.Because long term survival is in height In the ocean special ecological environment of salt, high pressure and anoxic, the physiological structure and metabolite of marine organisms are different from terrestrial life, Produce and have accumulated a large amount of materials with special chemical structure, special physiological activity and function, be exploitation novel sea medicine Valuable source.Living marine resources mainly include marine biotoxins, physiological activator, biological information material and biological work( Energy material etc..Marine biomaterial is the important component of living marine resources, is found in marine organisms so far More than 3000 plant novel active, wherein many marine biomaterials have been shown to have antitumor, antiviral, antibacterial, Resisting cardiovascular disease, antifatigue and enhancing are immune and other effects.The utilization of marine biomaterial turn into modern medicine Thing and the focus of health food research.At present, the activity research of living marine resources primarily focuses on antitumor square with antibacterial etc. Face, and the living marine resources with notable biological activity mainly include marine microorganism and oceanic invertebrate (such as ascidian, Sponge, jellyfish, sea anemone, sea hare etc.).
Marine Microbial Kinds are various, there is 2,000,000~200,000,000 kinds according to statistics.Oceanic invertebrate lacks acquired immunity system The diversified antibody of system, it is only capable of resisting an invasion bacterium or pathogen by innate immune system.In very long natural selection pressure Under the marine environment effect of complexity, the innate immune system of oceanic invertebrate is highly effective and very powerful.Research finds, The endogenous antibacterial substance of oceanic invertebrate is very abundant, it has also become the valuable source of exploitation novel antibacterial medicine. Medusa Cnidaria, it is the very huge halomereid of a kind of widely distributed, biological total amount.Rich in more in medusoma Kind bioactive substance, including medusocongestin albumen and some the New function albumen of activity strongly, with good DEVELOPMENT PROSPECT. Studies have found that also containing more antibacterial peptide and Pleurotus Ostreatus etc. in medusoma, this is for surviving in complicated seawater surface ring It is significant that jellyfish in border resists extraneous bacterium, poisoning intrusion.Prompting be likely to obtain out of medusoma with it is antiviral, The active material of bacteriostasis.
Serpin (serine protease inhibitor) is a kind of polypeptide with common denominator The general name (more than 500 family members) of class serpin, it is distributed widely in eucaryote and virus, passes through The activity of serine protease is adjusted, participates in many such as fibrinolytic, inflammatory reaction, cell migration, cell differentiation and Apoptosis Important vital movement.In addition, the protease to be played a role in blood coagulation system and complement system also can be by serine protease The regulation and control of inhibitor are to avoid its proteinase activity from damaging surrounding tissue.Recent study discovery, serine protease Inhibitor also plays an important role during congenital immune defense.The pathogenic microorganism of known most of animals and plants can be to place Main body endocrine protease, the physics for destroying host are defendd to strengthen infecting with further.Serine protease suppression in host The proteinase activity that preparation is then secreted by suppressing pathogenic microorganism, participate in the innate immune defence process of host.
Serpin mainly includes:The types such as α-macroglobulin, serpin, Kunitz and Kazal.
Some the research discoveries carried out at present around aquatic animal Kazal types inhibitor, the suppression of Kazal types serine protease Preparation has obvious bacteriostatic activity.What is such as found in Penaeus monodon (Penaeus monodon) haemocyte contains 5 The inhibitor SPIPm2 of Kazal domains has remarkable inhibiting activity to subtilopeptidase A, thus it is speculated that it may be in pathogenetic bacteria Course of infection in play immunization (referring to document：Somprasong N,Rimphanitehay A, Kittassanakajon A.A five-domain Kazal-type Serine proteinase inhibitor from black tiger shrimp Penaeus monodon and its inhibitory activities[J] .Developmental and Comparative Immunology,2006,30(11):998-1008.)；In Crustin The inhibitor FcSPI-1 containing 9 Kazal domains is found that in the hepatopancrease of (Fenneropenaeus chinensis), is ground Study carefully and show that it not only plays a role when pathogenic microorganism infects, and also assist in the regulation of oneself protein enzyme activity (referring to text Offer：Wang Z H,Zhao X F,Wang J X.Characterization,kinetics,and possible function of Kazal-type proteinase inhibitors of Chinese white shrimp,Fenneropenaeus chinensis[J].Fish&Shellfish Immunology,2009,26(6):885-897.)；The tool found in hydra The inhibitor Kazal2 for having 3 Kazal domains has the ability of very strong killing staphylococcus aureus (referring to document： Augustin R,Siebert S,Boscht C.Identification of a Kazal-type serine protease inhibitor with potent anti-staphylococcal activity as part of Hydra’s innate immune system[J].Developmental and Comparative Immunology,2009,33(7):830- 837.)；The rFc-Kazal found in Crustin (Fenneropenaeus chinensis) is to Vibrio anguillarum, golden yellow Staphylococcus, aeromonas salmonicida, bacillus thuringiensis have certain bacteriostasis (referring to document：Huang Ming, Liu Yichen, Zhang Yichen, wait the recombination expression and activity point of Crustin Kazal type serpin genes (Fc-Kaza1) Analyse [J] aquatic product journals, 2011,35 (9):1310-1318.).
At present, both at home and abroad there is not yet the relevant research report of jellyfish Kazal type serpins.
Seminar where the present inventor is directed to the extraction and research of active component in medusoma always, has obtained China Patent of invention：Patent No. ZL201310189933.5, entitled " a kind of Cyanea capillata thioredoxin and its coding base Because with applying ", Authorization Notice No. CN103232979B；Patent No. ZL201310188702.2, entitled " one kind hair shape rosy clouds Jellyfish peroxiredoxin and its encoding gene and application ", Authorization Notice No. CN103255113B；Chinese patent is applied for： Application number 201310258184.7, entitled " a kind of Cyanea capillata astacin sample metalloproteinases CALP1 and its coding Gene and expression ", application publication number CN 104195124A；Application number 201310629343.X, entitled " one kind The preparation method of jellyfish cardiovascular toxin crude extract ", application publication number：CN103613653A；Application number 201310628068.X, Entitled " a kind of preparation method of jellyfish hematoxin crude extract ", application publication number CN103626861A etc..
The content of the invention
It is an object of the invention to provide a kind of Cyanea capillata serpin and its encoding gene, this hair Bright another object is the preparation method for providing the Cyanea capillata serpin, and the 3rd purpose of the invention exists In the offer Cyanea capillata serpin in antibacterials, anti-inflammation drugs, shielding medicine for skin etc. is prepared Using.
The present invention is carried out by building Cyanea capillata tentacle tissue cDNA library, and to the sequence of the library recombinant clone Measure and annotation analysis, obtain the encoding gene of Cyanea capillata serpin.The Cyanea capillata silk ammonia Pepsin inhibitor is the jellyfish class serpin with obvious antibacterial activity found first, is medusoma The important activity component of interior innate immune system, the albumen have a good application prospect in antibacterial, anti-inflammation drugs research.
The main technical schemes of the present invention are, by building Cyanea capillata tentacle tissue cDNA library, it to be surveyed Sequence and screening, obtain the encoding gene of Cyanea capillata serpin and recombinantly expressed, then it is pressed down Throwing serine protease class activity and antibacterial activity are studied.
The first aspect of the present invention, there is provided a kind of Cyanea capillata serpin, a kind of described hair Shape rosy clouds jellyfish serpin, there is the protein of following (I) or (II)：
(ⅰ)SEQ ID NO:The protein of amino acid sequence composition shown in 2；
(ⅱ)SEQ ID NO:Amino acid sequence shown in 2 is substituted, lacks and/or added one or several amino acid and same Etc. function as derived from (I) protein.
Described a kind of Cyanea capillata serpin, such as SEQ ID NO:Amino acid sequence shown in 2, The albumen contains signal peptide, is secretory protein, is positioned at extracellular, molecular weight 19.02kDa, isoelectric point 8.75.
Present invention also offers a kind of encoding gene of Cyanea capillata serpin, for following (I) or The DNA molecular of (II)：
(ⅰ)SEQ ID NO:Nucleotide sequence shown in 1；
(II) and SEQ ID NO:Nucleotide sequence of the nucleotide sequence homology more than 80% shown in 1.
A kind of described Cyanea capillata serpin gene, nucleotide sequence total length 773bp, such as SEQ ID NO:Shown in 1.
Product of the present invention is Kazal type serpins, contains 3 typical Kazal domains, Mei Gejie Structure domain includes 50-60 amino acid residue and 6 cysteines form 3 pairs of disulfide bond.The suppression specificity of Kazal inhibitor Determined by second amino acid Pl after second cysteine of Kazal domains, so containing different Pl amino The domain of sour residue has different suppression specificity.The P1 of serpin in the present invention be alanine and Arginine, thus it is speculated that it, which has, suppresses elastoser and tryptic activity.
The second aspect of the present invention, there is provided a kind of preparation method of Cyanea capillata serpin, should Method comprises the following steps：
(A) Cyanea capillata tentacle tissue cDNA library is built；
(B) sequence of above-mentioned Cyanea capillata tentacle tissue cDNA library recombinant clone is measured and analyzed, obtained The nucleotide sequence of coding serpin；
(C) expression plasmid of Cyanea capillata serpin, recombination engineering are built；
(D) expression of Cyanea capillata serpin；
(E) purifying of Cyanea capillata serpin is recombinated.
Cyanea capillata tentacle tissue cDNA library in the step (A) is built by the following method：
1) Cyanea capillata tentacle total tissue RNA is extracted；
2) mRNA is separated, synthesizes Cyanea capillata tentacle tissue cDNA；
3) above-mentioned cDNA is inserted into pUC19 plasmid vectors, then converted into bacillus coli DH 5 alpha, be coated on LB culture mediums and put down Plate carries out blue hickie screening, that is, is built into Cyanea capillata tentacle tissue cDNA library.
The expression plasmid of structure Cyanea capillata serpin in the step (C), recombination engineering, Concretely comprise the following steps：
1) according to Cyanea capillata serpin gene order and prokaryotic expression carrier pGEX-6P-1 Restriction enzyme site, a pair of PCR primers for carrying specific cleavage site EcoR I and Xho I of design are as follows：
Sense primer：5’CGGAATTCATGACCAAGCCATT 3’(SEQ ID NO:3)
Anti-sense primer：5’CCGCTCGAGTTTTCTGCATTG 3’(SEQ ID NO:4)
PCR reaction conditions are：95 DEG C of insulation 30sec；95 DEG C of insulation 30sec, 55.5 DEG C of insulation 30sec, 68 DEG C are incubated 1min, 38 circulations；68 DEG C of insulation 5min；
2) PCR primer and pGEX-6P-1 prokaryotic expression plasmids after digestion recovery；
3) coded sequence is connected on pGEX-6P-1 carriers using two restriction enzyme sites, builds recombinant expression plasmid, so After be transformed into Escherichia coli Rosetta (DE3) .pLysS obtain recombination engineering.
The expression condition of Cyanea capillata serpin in the step (D) is：12℃、1mM Induced 7 hours under IPTG, 150rpm, recombinant protein can be expressed with soluble form under this inductive condition.
Purifying in the step (E) is produced to be purified using the step of GSTrap HP 4B FF affinity columns one, elutes bar Part is the combination buffer and 10% elution buffer for accounting for cumulative volume 90% respectively；Wherein, combination buffer 1.8mM KH2PO4,140mM NaCl, 2.7mM KCl, 10mM Na2HPO4, pH 7.3, elution buffer are 50mM Tris-HCl, 10mM reduced glutathiones, pH 8.0.
The preparation method of the present invention is simple, and cost is cheap.
The third aspect of the present invention, there is provided prepared by Cyanea capillata serpin and its encoding gene Application in antibacterials, anti-inflammation drugs, shielding medicine for skin.
Invention further provides described Cyanea capillata serpin and its encoding gene to make Application in standby subtilisin A inhibitor, cathepsin K inhibitor, elastatinal etc..
The invention provides Cyanea capillata serpin and its encoding gene in antibacterials are prepared Application, described bacterium is staphylococcus aureus, bacillus subtilis, Candida albicans, Escherichia coli and Vibrio vulnificus Deng.
The invention provides Cyanea capillata serpin and its encoding gene in anti-inflammation drugs are prepared Application, Cyanea capillata kazal types serpin can substantially suppress staphylococcus aureus, bacillus subtilis Bacterium, Candida albicans, Escherichia coli and Vibrio vulnificus etc. grow, therefore Cyanea capillata serpin can be used for Anti-inflammation drugs are prepared, described inflammation is that pathogenic bacteria staphylococcus aureus, Vibrio vulnificus and conditioned pathogen Escherichia coli are drawn Infection risen etc..
The invention provides Cyanea capillata serpin and its encoding gene to prepare shielding medicine for skin In application, described shielding medicine for skin is anti-marine organisms sting postoperative infection etc..The Cyanea capillata serine egg of the present invention On the one hand white enzyme inhibitor can weaken pathogenic microorganism to human body using protease inhibitors to the inhibitory action of protease Injury；Meanwhile because serine protease protein enzyme inhibitor also has bacteriostasis, microorganism infection can be prevented.Skin Skin protective agent type can be the component or prevention injuries from marine creature and open wound of jellyfish sting shielding medicine for skin The shielding medicine for skin component of marine microorganism infection after seawater immersion.
The restructuring Cyanea capillata Kazal types serpin that the present invention obtains has significant suppression silk ammonia Acid albumin enzymes activity and bacteriostatic activity.In experiment of the detection recombinant protein to serine stretch protein enzyme rejection ability, with The increase of Cyanea capillata serpin concentration is recombinated, the suppression of serine stretch protein enzyme in reaction system Rate is significantly raised.In the experiment that detection restructuring Cyanea capillata serpin is combined with microorganism, find Kazal types serpin and staphylococcus aureus, hay bacillus, Candida albicans, Escherichia coli and pair are molten Blood vibrios has weak binding active, has strong binding activity with Candida albicans and Vibrio vulnificus.In detection recombinant protein to microorganism In the experiment of rejection ability, with the rise of restructuring Cyanea capillata serpin concentration, it is to golden yellow The growth inhibitory effect of the microorganisms such as color staphylococcus, hay bacillus, Candida albicans, Escherichia coli, Vibrio vulnificus substantially increases By force.This experiment demonstrates suppression of the restructuring Cyanea capillata Kazal types serpin to serine stretch protein enzyme Ability and antibacterial activity.
Therefore, the present invention has recombinated Cyanea capillata Kazal types serpin and has found that it has first Significant antibacterial activity, the Kazal type serpins in Cyanea capillata source possess and significantly opened in the present invention Make an offer value, there is certain application potential in antibacterial and anti-inflammation drugs, cosmetics, food and agricultural industry.It is related in the present invention Cyanea capillata serpin exploitation antibacterials, anti-inflammation drugs, will have in terms of shielding medicine for skin it is very big Application value.
Brief description of the drawings
Fig. 1 is Cyanea capillata (Cyanea capillata) Kazal types serpin and other species The multiple sequence of Kazal type serpins compares.Wherein, black represents completely homologous region.
Fig. 2 is the grads PCR of Cyanea capillata serpin ORFs coded sequence in the present invention The electrophoresis result of product.Wherein, M：Nucleic acid molecular weight Marker；1-12：PCR primer.
Fig. 3 is the SDS-PAGE electrophoresis knots that Cyanea capillata serpin induced expression is recombinated in the present invention Fruit.Wherein, M：Molecular weight of albumen Marker；1：The recombination bacillus coli not induced；2：Surpass after 16 DEG C of induction 7h of 1mMIPTG Sound lysate；3：The ultrasonic supernatant after 16 DEG C of induction 7h of 1mM IPTG；4：The ultrasound precipitation after 16 DEG C of induction 7h of 1mM IPTG； 5：The ultrasonic degradation liquid after 20 DEG C of induction 7h of 1mM IPTG；6：The ultrasonic supernatant after 20 DEG C of induction 7h of 1mM IPTG；7：Through 1mM Ultrasound precipitation after 20 DEG C of induction 7h of IPTG；Red boxes indicate the position of recombinant protein.
Fig. 4 is the SDS-PAGE electrophoresis knots that restructuring Cyanea capillata serpin isolates and purifies in the present invention Fruit.Wherein, 1：Recombination bacillus coli before induction；2:Recombination bacillus coli ultrasonic degradation liquid 3 after induction：Restructuring after induction Escherichia coli ultrasonic degradation supernatant；4：Peak is penetrated during purification of recombinant proteins；5：Eluting peak during purification of recombinant proteins；Red boxes refer to Show the position of recombinant protein.
Fig. 5 is knot of the detection restructuring Cyanea capillata serpin to serine stretch protein enzyme rejection ability Fruit.Wherein A is the rejection ability to subtilisin A, and B is the rejection ability to Proteinase K, and C is the suppression to elastoser Ability processed.As a result show, Cyanea capillata serpin reaches maximum suppression activity to 3 kinds of serine proteases When and the mol ratio of enzyme be respectively:2000:1 (subtilisin A), 2000:1 (Proteinase K) and 80:1 (elastoser).Hair The inhibitory action of shape rosy clouds jellyfish serpin strengthens as its concentration raises, and it suppresses after reaching finite concentration Effect is not further added by, and trypsase and chymotrypsin are then not detected by inhibitory activity (result is not shown).
Fig. 6 is the Binding experiment testing result of restructuring Cyanea capillata serpin and bacterium.Upper row shows What is shown is the albumen of SDS elutions, and lower row is the mycoprotein after TBS elutions.No. 1-9 is not induce group (negative control respectively Group), Cyanea capillata serpin (positive controls) after purification, staphylococcus aureus, withered grass gemma Bacillus, Candida albicans, Escherichia coli, vibrio parahaemolytious, vibrio alginnolyficus and Vibrio vulnificus.As a result Kazal type silk ammonia is shown Pepsin inhibitor has strong binding activity with Candida albicans and Vibrio vulnificus, with staphylococcus aureus, bacillus subtilis Bacterium, Escherichia coli and vibrio parahaemolytious have weak binding active, and binding activity is not detected by with vibrio alginnolyficus.
Fig. 7 is the knot for the rejection ability that detection restructuring Cyanea capillata serpin grows to microorganism Fruit.It can be seen that Cyanea capillata serpin is read staphylococcus aureus (A), bacillus subtilis (B), white Pearl bacterium (C), Escherichia coli (D) and Vibrio vulnificus (E) have obvious growth inhibitory activity.
Embodiment
With reference to embodiment and accompanying drawing, the present invention will be described in detail.But the following example should not be regarded as to the present invention The limitation of scope.
Experimental method in following embodiments, it is conventional method unless otherwise specified.
The Cyanea capillata (Cyanea capillata) that the present invention selects is gathered from Zhejiang Province's nutrients, and through collection Marine products institute of university of U.S. professor Hong Huixin identifies (L.Xiao et al, Toxicon, 2009,53:146–152).
Embodiment 1：The screening and sequence analysis of Cyanea capillata serpin
1) extracting of Cyanea capillata tentacle total tissue RNA according to the Trizol kits of Invitrogen companies illustrate into OK, chloroform removes isolating protein, obtains about 7 μ g total serum IgEs；
2) mRNA separation illustrates to carry out according to the Oligotex mRNA Spin-column Kit of QIANGEN companies, CDNA synthesis is then carried out with reference to the SMART cDNA Library Construction Kit explanations of Clontech companies；
3) cDNA is inserted into pUC19 plasmid vectors (being purchased from Takara companies), then converted to bacillus coli DH 5 alpha (purchased from north Jing Bomaide companies) in, it is coated on 15cm culture dishes and carries out blue hickie screening, that is, forms Cyanea capillata tentacle tissue cDNA text Storehouse.
The library shares bacterium colony 1923, wherein locus coeruleus 35, recombination fraction 98.18%, storage capacity 1.92*106, insertion length Degree >=400bp ordered sequence 1035, unigene merger is carried out to these sequences using 100bp, 90% principle, obtained Unigene numbers are 528.Total length analysis is carried out to sequence simultaneously, there are 12 sequences to have associated homologous information in 20 sequences, As a result it is wherein 12 total lengths, complete sex rate：12/12 × 100%=100%, show that the cDNA library has preferable matter Amount.Random sequencing is carried out to the cDNA library, gained sequence carries out BLASTx analyses (http after removing carrier:// blast.ncbi.nlm.nig.gov)。
4) Cyanea capillata serpin gene numbers the clone for being 1E09 in above-mentioned cDNA library. Sequence 773bp, include 531bp ORFs, protein of the coding containing 176 amino acid residues, molecular weight 19.02kDa isoelectric point 8.75.Blastx search results show that the Kazal types serine protease of the albumen and multiple species presses down Preparation very high homology (such as Fig. 1), it is the recruit of jellyfish source Kazal type serpins family.One is entered to it The bioinformatic analysis of step shows that the albumen contains signal peptide, is secretory protein, is positioned at extracellular.
Embodiment 2：Structure and the engineering bacteria restructuring of Cyanea capillata serpin recombinant expression plasmid
1) according to Cyanea capillata serpin gene order and prokaryotic expression carrier pGEX-6P-1 The restriction enzyme site of (being purchased from Novagen companies), pair of primers is designed and synthesized, wherein sense primer includes restriction enzyme site EcoR I (GAATTC), anti-sense primer includes restriction enzyme site Xho I (CTCGAG), and the sequence of two primers is specific as follows：
Sense primer：5’CGGAATTCATGACCAAGCCATT 3’(SEQ ID NO:3)
Anti-sense primer：5’CCGCTCGAGTTTTCTGCATTG 3’(SEQ ID NO:4)
After grads PCR is tested, it is optimum annealing temperature to select 55.5 DEG C, and entering performing PCR to target gene largely expands, PCR reaction conditions are：95 DEG C of insulation 5min；95 DEG C of insulation 30sec, 55.5 DEG C of insulation 30sec, 68 DEG C of insulation 1min, 38 are followed Ring；68 DEG C of insulation 5min.5 ' the ends PCR primer comprising Nde I and the restriction enzyme sites of Xho I respectively, nucleic acid electrophoresis are obtained after PCR reactions Show PCR primer band in correct position (such as Fig. 2), about 528bp, recovery PCR primer；
2) according to PCR primer of the description of product after Nde I and Xho I endonuclease the difference digestion recovery of NEB companies And pGEX-6P-1 prokaryotic expression plasmids；
3) the T4DNA ligases explanation after recovery digestion products further according to NEB companies is attached reaction, by coupled reaction Product is coated on the mycin of benzyl containing ammonia after converting to Escherichia coli Rosetta (DE3) .pLysS (being purchased from Beijing Bo Maide companies) Cultivated 16 hours on the culture dish of (100 μ g/ml) and chloramphenicol (34 μ g/ml).Picking single bacterium drops down onto has ammonia benzyl mycin containing 5ml The LB culture mediums of (100 μ g/ml) and chloramphenicol (34 μ g/ml) shake bacterium and cultivated 12 hours, verified through bacterium solution PCR, plasmid enzyme restriction etc. After method identification recombinates successfully, two-way sequencing is carried out to recombinant plasmid using pGEX F/R as sequencing primer, verifies the gene of clone For purpose gene, illustrate that Cyanea capillata serpin recombinant expression plasmid is correctly built.
Embodiment 3：The expression of Cyanea capillata serpin
Correct recombination bacillus coli Rosetta (DE3) .pLysS bacterium solutions will be sequenced and add the mycin of benzyl containing ammonia (100 μ g/ Ml) and in the LB liquid medium of chloramphenicol (34 μ g/ml), 37 DEG C, 250rpm shaking table cultures to OD600To start during 0.6-0.8 Derivant IPTG is added to be induced.
The optimum condition of the expression for determining recombinant protein is：12 DEG C, 1mM IPTG, induce 7 hours under 150rpm.After induction from The heart collects thalline, can be expressed through the visible recombinant protein under this inductive condition of SDS-PAGE electrophoresis with soluble form, molecular weight It is consistent with predicted value (plus about 45kDa after GST labels), as shown in Figure 3.
Embodiment 4：Recombinate the purifying of Cyanea capillata serpin
Thalline is collected into bacterium solution centrifugation (10000 × g*10min) after induction, then using combination buffer (1.8mM KH2PO4,140mM NaCl, 2.7mM KCl, 10mM Na2HPO4, pH 7.3) thalline is fully resuspended, carry out ultrasound and split bacterium, surpass Supernatant is taken to be purified after sound lysate centrifugation (10000 × g*10min).Finally according to the GST of GE Healthcare companies Trap HP 4B FF chromatographic columns andThe operating instruction for isolating and purifying system carries out affinity chromatography, produces To purer Cyanea capillata serpin.
The visible purpose band of SDS-PAGE electrophoresis (such as Fig. 4) is consistent with predicted position, and more than 90%, what is used washes purity De- condition is：90% combination buffer with 10% elution buffer (50mM Tris-HCl, 10mM reduced glutathiones, pH 8.0)。
Embodiment 5：Recombinate the detection that Cyanea capillata serpin suppresses serine protease
After more single destination protein being obtained by the affinity chromatography method of embodiment 4, proteinase activity Inhibition test The protease used is respectively：Subtilisin A, Proteinase K, chymotrypsin, trypsase and elastoser.This experiment institute There are reagent and substrate all to be prepared by combination buffer.Experimental procedure:
The first step：Add 50 μ l inhibitor and 150 μ l protease (100mM Tris-HClpH8.0) in 96 orifice plates, 25 DEG C 10min is incubated, 405nm surveys absorbance OD1；
Second step：10 μ l chromogenic substrates are added, are incubated 5min；
3rd step：50 μ l 50% (v/v) acetic acid terminating reactions, 405nm survey absorbance OD2；
Actual absorbance=OD2-OD1；
As a result：It is the average value of result three times
Ri=1- (OD405 has inhibitor-OD405 controls)/(OD405 no inhibitors-OD405 controls) reaction system is shown in Table 1：
The data of gained do dose-effect curve, and ordinate is the remaining reactivity of protease, and abscissa is reactant The mol ratio of serpin and protease in system.
Experimental result is remaining in reaction system as shown in figure 5, with the rise of recombinant serine protease inhibitors concentration Enzymatic activity is reduced, and inhibitor significantly increases to the inhibiting rate of subtilopeptidase A, Proteinase K and elastoser.
Embodiment 6：Recombinate the detection of Cyanea capillata serpin combination microorganism ability
After obtaining more single destination protein by the affinity chromatography method of embodiment 4, the albumen and microorganism are detected Binding ability.Testing the microorganism used is respectively：Staphylococcus aureus, hay bacillus, Candida albicans, large intestine bar Bacterium, vibrio parahaemolytious, vibrio alginnolyficus and Vibrio vulnificus.All reagents of this experiment and substrate are all prepared by combination buffer.Training It is LB fluid nutrient mediums to support base.Experimental procedure：
The first step：After the microorganism recovery that this laboratory is preserved, (note white is read 37 DEG C in 5ml LB fluid nutrient mediums Pearl bacterium is 28 DEG C) 150rpm is incubated overnight.
Second step：Bacterium solution is centrifuged into (5000 × g*5min) and collects thalline, then using TBS buffer solutions (24.8mM Tris, 50mM NaCl, 2.7mM KCl, pH 7.4) washing thalline 3 times, add 1ml recombinant proteins (concentration 1mg/ml), room Temperature is incubated 1h.
3rd step：Bacterium solution is centrifuged into (5000 × g*5min) and collects thalline, then using TBS buffer solutions washing thalline 3 times, TBS buffer solutions of the 200 μ l containing 12%SDS is added, gently shakes 15min.
4th step：Take the preparation of samples electrophoresis after 40 μ l concussions, the protein sample of as SDS elutions.Remaining sample is used TBS buffer solutions wash 3 times, rear 100 μ l TBS buffer solutions, the mycoprotein sample after being eluted as TBS.
5th step：Western blot analysis is carried out, each sample being collected into carries out 10%SDS-PAGE electrophoresis and carried out follow-up Transferring film is operated, and destination protein is transferred on pvdf membrane.The pvdf membrane to take a turn for the better is placed in the TBST confining liquids containing 5% skimmed milk Middle incubation at room temperature 3 hours, is washed three times with TBST.With 1：The dilution ratio of 2000 volumes dilutes mouse anti-GST antibody with TBST (primary antibody), washed pvdf membrane is immersed, 4 DEG C of overnight incubations.After relaundering pvdf membrane, 1 is used：4000 volume dilution ratios Horseradish peroxidase (HRP) goat anti-mouse igg be incubated at room temperature 3 hours, finally using the G of Syngene companies of Britain：BOX System is developed.
Experimental result is as shown in fig. 6, can be observed recombinant serine protease inhibitors and staphylococcus aureus, withered grass Bacillus, Escherichia coli and vibrio parahaemolytious have weak binding active, have strong binding activity with Candida albicans and Vibrio vulnificus, Binding activity is not detected by with vibrio alginnolyficus.
Embodiment 7：Restructuring Cyanea capillata serpin suppresses growth of microorganism the detection of ability
After obtaining more single destination protein by the affinity chromatography method of embodiment 4, it is to microorganism growth inhibition Testing the microorganism used is respectively：Staphylococcus aureus, hay bacillus, Candida albicans, Escherichia coli and Vibrio vulnificus. All reagents of this experiment and substrate are all prepared by combination buffer.Culture medium is LB fluid nutrient mediums.Experimental procedure：
The first step：After the microorganism recovery that this laboratory is preserved, (note white is read 37 DEG C in 5ml LB fluid nutrient mediums Pearl bacterium is 28 DEG C) 150rpm is incubated overnight.
Second step：After the microorganism being incubated overnight is diluted into 100 times with LB culture mediums, serine stretch protein enzyme level is added Agent sample (concentration is respectively 0,0.25,0.5,1mg/ml), with 96 orifice plate culture 48 hours.Every 1 hour extinction was surveyed in 595nm Angle value.Every group parallel to do three multiple holes.
3rd step：Data processing, according to ELIASA Cleaning Principle, cell concentration is higher, and absorbance is higher.By inhibitor Concentration be 0mg/ml as negative control group, other compare microorganism growth change trend as treatment group.
Experimental result is as shown in fig. 7, with the rise of recombinant serine protease inhibitors concentration, and it is to golden yellow grape Coccus, hay bacillus, Candida albicans, the growth inhibition of Escherichia coli and Vibrio vulnificus have different degrees of increase.
These results suggest that the restructuring Cyanea capillata serpin of the present invention has significant suppression silk Serine protease class activity and antibacterial activity, available for exploitation antibacterials, anti-inflammation drugs, shielding medicine for skin etc..
General principle, principal character and the advantages of the present invention of the present invention has been shown and described above.The technology of the industry Personnel are it should be appreciated that the present invention is not limited to the above embodiments, and the simply explanation described in above-described embodiment and specification is originally The principle of invention, various changes and modifications of the present invention are possible without departing from the spirit and scope of the present invention, these changes Change and improvement all fall within the protetion scope of the claimed invention.The claimed scope of the invention by appended claims and its Equivalent defines.

Claims (11)

  1. A kind of 1. Cyanea capillata serpin, it is characterised in that described Cyanea capillata serine stretch protein Enzyme inhibitor is such as SEQ ID NO:The protein of amino acid sequence composition shown in 2.
  2. A kind of 2. Cyanea capillata serpin according to claim 1, it is characterised in that：Described hair Shape rosy clouds jellyfish serpin contains signal peptide, is secretory protein, is positioned at extracellular, molecular weight 19.02kDa, Isoelectric point is 8.75.
  3. A kind of 3. encoding gene of Cyanea capillata serpin as claimed in claim 1, it is characterised in that The nucleotide sequence of the encoding gene such as SEQ ID NO:Shown in 1.
  4. 4. a kind of encoding gene of Cyanea capillata serpin according to claim 3, its feature exist In：The encoding gene of described Cyanea capillata serpin includes 531 bp ORFs.
  5. A kind of 5. preparation method of Cyanea capillata serpin as claimed in claim 2, it is characterised in that This method comprises the following steps：
    (A) Cyanea capillata tentacle tissue cDNA library is built；
    (B) sequence of above-mentioned Cyanea capillata tentacle tissue cDNA library recombinant clone is measured and analyzed, obtain right It is required that the nucleotide sequence of the coding Cyanea capillata serpin described in 3；Using PCR method from hair shape Xia Shui The sequence is expanded in female tentacle tissue cDNA library；
    (C) expression plasmid of Cyanea capillata serpin, recombination engineering are built；
    (D) expression of Cyanea capillata serpin；
    (E) purifying of Cyanea capillata serpin is recombinated.
  6. 6. the preparation method of Cyanea capillata serpin according to claim 5, it is characterised in that：Institute The Cyanea capillata tentacle tissue cDNA library stated in step (A) is built by the following method：
    A) Cyanea capillata tentacle total tissue RNA is extracted；
    B) mRNA is separated, synthesizes Cyanea capillata tentacle tissue cDNA；
    C) above-mentioned cDNA is inserted into pUC19 plasmid vectors, then converted into bacillus coli DH 5 alpha, be coated on LB culture medium flat plates and enter The blue hickie screening of row, that is, be built into Cyanea capillata tentacle tissue cDNA library.
  7. 7. the preparation method of Cyanea capillata serpin according to claim 5, it is characterised in that：Institute State the expression plasmid of the structure Cyanea capillata serpin in step (C), recombination engineering, specific steps For：
    A) it is as follows to design and synthesize PCR primer：
    Sense primer such as SEQ ID NO:Shown in 3,
    Anti-sense primer such as SEQ ID NO:Shown in 4,
    PCR reaction conditions are：95 DEG C of insulation 30sec；95 DEG C insulation 30sec, 55.5 DEG C insulation 30sec, 68 DEG C insulation 1min, 38 Individual circulation；68 DEG C of insulation 5min；
    B) PCR primer and pGEX-6P-1 prokaryotic expression plasmids after digestion recovery；
    C) coded sequence is connected on pGEX-6P-1 carriers using two restriction enzyme sites, builds recombinant expression plasmid, Ran Houzhuan Change to Escherichia coli Rosetta (DE3) pLysS and obtain recombination engineering.
  8. 8. the preparation method of Cyanea capillata serpin according to claim 5, it is characterised in that：Institute The expression condition for stating the Cyanea capillata serpin in step (D) is：12 DEG C, 1mM IPTG, 150rpm rings Induced 7 hours in border.
  9. 9. the preparation method of Cyanea capillata serpin according to claim 5, it is characterised in that：Institute State the purifying in step (E) to produce to purify using the step of GSTrap HP 4B FF affinity columns one, elution requirement is to account for respectively The combination buffer of cumulative volume 90% and 10% elution buffer；Wherein, combination buffer is 1.8mM KH2PO4,140mM NaCl, 2.7mM KCl, 10mM Na2HPO4, pH 7.3, elution buffer are 50mM Tris-HCl, 10mM reduced form gluathiones Peptide, pH 8.0.
  10. 10. a kind of Cyanea capillata serpin as claimed in claim 1 or 2 is preparing antibacterials, disappeared Application in scorching medicine or shielding medicine for skin.
  11. 11. a kind of encoding gene of Cyanea capillata serpin as claimed in claim 3 is preparing antibacterial Application in medicine, anti-inflammation drugs or shielding medicine for skin.
CN201510030152.0A 2015-01-21 2015-01-21 A kind of Cyanea capillata serpin and its encoding gene and application Active CN104628845B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201510030152.0A CN104628845B (en) 2015-01-21 2015-01-21 A kind of Cyanea capillata serpin and its encoding gene and application

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201510030152.0A CN104628845B (en) 2015-01-21 2015-01-21 A kind of Cyanea capillata serpin and its encoding gene and application

Publications (2)

Publication Number Publication Date
CN104628845A CN104628845A (en) 2015-05-20
CN104628845B true CN104628845B (en) 2017-12-08

Family

ID=53208128

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201510030152.0A Active CN104628845B (en) 2015-01-21 2015-01-21 A kind of Cyanea capillata serpin and its encoding gene and application

Country Status (1)

Country Link
CN (1) CN104628845B (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106749637B (en) * 2016-12-27 2020-07-10 河南省华隆生物技术有限公司 Serine protease inhibitor recombinant molecule, preparation method and application thereof

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5612194A (en) * 1989-06-23 1997-03-18 Trustees Of The University Of Pennsylvania Methods of producing effective recombinant serine protease inhibitors and uses of these inhibitors
CN104195124B (en) * 2013-06-26 2016-12-28 中国人民解放军第二军医大学 A kind of Cyanea capillata 3,4,3',4'-tetraketo-.beta.-carotene sample metalloproteases CALP1 and encoding gene thereof and expression

Also Published As

Publication number Publication date
CN104628845A (en) 2015-05-20

Similar Documents

Publication Publication Date Title
Kamoun A catalogue of the effector secretome of plant pathogenic oomycetes
CN1871351B (en) Novel fungal proteins and nucleic acids encoding same
Eichenlaub et al. The Clavibacter michiganensis subspecies: molecular investigation of gram-positive bacterial plant pathogens
CN111690054B (en) Pinctada martensii Kunitz type serine protease inhibitor gene, encoded protein and application
CN110922457B (en) Plant immune induced resistance protein FgPII1 secreted by fusarium graminearum and application thereof
Grell et al. Secretome of fungus-infected aphids documents high pathogen activity and weak host response
CN110194790A (en) The plant immune activator protein FoPII1 of Fusarium oxysporum secretion and its application
Khezri et al. Characterization of some biofilm-forming Bacillus subtilis strains and evaluation of their biocontrol potential against Fusarium culmorum
Narváez-Barragán et al. Expansin-related proteins: biology, microbe–plant interactions and associated plant-defense responses
CN111778267B (en) Plutella xylostella Trypsin-9 gene and application thereof
Wang et al. Novel antimicrobial peptides isolated from the skin secretions of Hainan odorous frog, Odorrana hainanensis
Hu et al. Biocontrol efficacy of Bacillus velezensis strain YS-AT-DS1 against the root-knot nematode Meloidogyne incognita in tomato plants
Song et al. Purification and identification of a novel peptide derived from by-products fermentation of spiny head croaker (Collichthys lucidus) with antifungal effects on phytopathogens
El-Bebany et al. Induction of putative pathogenicity-related genes in Verticillium dahliae in response to elicitation with potato root extracts
Hu et al. Temporal transcription profiling of sweet orange in response to PthA4-mediated Xanthomonas citri subsp. citri infection
CN109134625B (en) Pantoea ananatis protein exciton HCP and function thereof
Suthianthong et al. A double WAP domain-containing protein PmDWD from the black tiger shrimp Penaeus monodon is involved in the controlling of proteinase activities in lymphoid organ
Chen et al. Kassorins: novel innate immune system peptides from skin secretions of the African hyperoliid frogs, Kassina maculata and Kassina senegalensis
CN104628845B (en) A kind of Cyanea capillata serpin and its encoding gene and application
Abidi et al. MS analysis and molecular characterization of Botrytis cinerea protease Prot-2. Use in bioactive peptides production
CN106998697A (en) Composition and method for controlling plant-pest
Hwang et al. Isolation and characterization of psacotheasin, a novel knottin-type antimicrobial peptide, from Psacothea hilaris
Chen et al. Genome-wide discovery of Pichia galeiformis-secreted proteins and their induction of green mold resistance in citrus fruit
Jones et al. Novel cellulose-binding-domain protein in Phytophthora is cell wall localized
Li et al. The transcriptome analysis of the whole-body of the gastropod mollusk Limax flavus and screening of putative antimicrobial peptide and protein genes

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant