CN111778267B

CN111778267B - Plutella xylostella Trypsin-9 gene and application thereof

Info

Publication number: CN111778267B
Application number: CN202010614484.4A
Authority: CN
Inventors: 金丰良; 许小霞; 花艳艳; 李树忠
Original assignee: South China Agricultural University
Current assignee: South China Agricultural University
Priority date: 2020-06-30
Filing date: 2020-06-30
Publication date: 2023-02-03
Anticipated expiration: 2040-06-30
Also published as: CN111778267A

Abstract

The invention discloses a diamondback moth Trypsin Trypsin-9 gene and application thereof, wherein the nucleotide sequence of the diamondback moth Trypsin Trypsin-9 gene is shown as SEQ ID NO. 1, and the amino acid sequence thereof is shown as SEQ ID NO. 2. The research of the invention shows that the Trypsin-9 plays an important role in the activation of Cry1Ac prototoxin in the diamond back moth midgut, the Trypsin-9 is added to obviously improve the activation of Bt Cry1Ac prototoxin in the diamond back moth midgut fluid, and the death rate of the diamond back moth is obviously improved; after the expression of the gene of the cryptophycin-9 of the plutella xylostella in the midgut is silenced, the digestion of the midgut of the plutella xylostella on food is reduced, and pupation deformity is caused, so that the cryptophysin-9 can be used as a novel molecular target for biological control, is used for controlling brassicaceous vegetable pests, and has good biological control potential and application prospect.

Description

Plutella xylostella Trypsin-9 gene and application thereof

Technical Field

The invention relates to the technical field of agricultural biology, in particular to a plutella xylostella Trypsin-9 gene and application thereof.

Background

Trypsin (Trypsin) belongs to the serine protease family, is produced in animal pancreas in the form of zymogen precursor (Pre-trypsinogen), is a main proteolytic enzyme in the digestive tract of vertebrates, removes a signal peptide to form trypsinogen, is activated by enterokinase through the intestinal cavity to generate active Trypsin, and has the function of mainly digesting protein in food; activating other zymogens such as (chymotrypsinogen, fusogenin, elastase).

Insect trypsin is produced by midgut gut wall cells and secreted into the human midgut, is detected primarily in the larval midgut during feeding, is a serine protease that is predominant in the alkaline midgut environment of insectsDigestion of proteins and toxicity regulation of Bt toxins play an important role. The mechanism of secretion and activation is not well defined, so it is often called Trypsin-Like enzyme (Trypsin-Like protease), but it has the same active site and specific action substrate as the spine pushing substance Trypsin. In general, insect trypsinogen is 256 amino acids in length, active trypsin is 232 amino acids in length, and insect trypsin is a family of serine proteases so it has the conserved sequence of serine proteases: a: the active site contains the His, asp and Ser catalytic triad regions conserved in all serine proteases to activate other zymogens (GDSGGP and TAAHC); b: substrate binding site Asp ¹⁸² Also conserved (slightly different in position among different insects) is the substrate cleavage site or residue, which is determined by the effect of charge. c: the amino acid sequence of the N terminal of the trypsin is Ile-Val-Gly-Gly. d: insect trypsin has 3 disulfide bonds. With the rapid development of gene cloning technology, the molecular biology research of trypsin enters a new stage. Many insects such as (Drosophila melanogaster, bombyx mori, aedes aegypti, tobacco budworm Manduca sexta and Lygus lineolaris, douglas) trypsin have been cloned and their sequences have been extensively studied. However, there are few reports on the trypsin-related gene of plutella xylostella.

Disclosure of Invention

The invention aims to overcome the defects in the prior art and provide a diamond back moth Trypsin Trypsin-9 gene.

The second purpose of the invention is to provide a diamond back moth Trypsin-9 protein.

The third purpose of the invention is to provide the application of the Trypsin-9 gene and the Trypsin-9.

The above purpose of the invention is realized by the following technical scheme:

the invention firstly clones a plutella xylostella Trypsin Trypsin-9 gene from the middle intestine of the plutella xylostella, the nucleotide sequence of the gene is shown as SEQ ID NO. 1, and the sequence size is 820bp. The coded diamondback moth Trypsin Trypsin-9 has the amino acid sequence shown in SEQ ID NO. 2 and the sequence length of 258aa.

The invention also provides a recombinant expression vector containing the Trypsin-9 gene.

Preferably, the recombinant expression vector contains a sequence with the Trypsin-9 gene signal peptide removed, and the nucleotide sequence of the recombinant expression vector is shown as SEQ ID NO. 3.

Preferably, the recombinant expression vector is pET-32a-Trypsin-9 and is used for expressing the recombinant protein Trypsin-9.

The invention also provides an RNAi vector for inhibiting the expression of the Trypsin-9.

Preferably, the RNAi vector is L4440-Trypsin-9.

The invention also provides a recombinant bacterium or cell line containing the recombinant expression vector or RNAi vector.

Preferably, the bacterium containing the recombinant expression vector is escherichia coli BL21, and the bacterium containing the RNAi vector is HT115 (DE 3) strain.

The research of the invention shows that after expressed recombinant proteins Trypsin-9 and BtCry1Ac prototoxins with different concentrations are fed to plutella xylostella, the activation of the BtCry1Ac prototoxin and the death rate of the plutella xylostella are measured, and the fact that the activation of the BtCry1Ac prototoxin is increased along with the increase of the concentration of the fed Trypsin-9 and the death rate of the plutella xylostella is increased is discovered. On the contrary, after the polyclonal antibody (anti-Trypsin-9) of the Trypsin-9 protein and the BtCry1Ac prototoxin are added to the plutella xylostella, the activation of the BtCry1Ac prototoxin is reduced, and the death rate of the plutella xylostella is reduced. The Trypsin-9 has the effects of activating and quickly killing the plutella xylostella on the BtCry1Ac prototoxin and enhancing the insecticidal activity of the Bt protein on the plutella xylostella.

Meanwhile, the invention also can efficiently silence the expression of the diamond back moth Trypsin-9 gene. The specific sequence of the silent Trypsin-9 gene is introduced into an L4440 expression vector to obtain L4440-Trypsin-9, the L4440-Trypsin-9 is transferred into a HT115 strain for expression, the HT115 for recombining and expressing the specific sequence of the silent Trypsin-9 gene is mixed with feed, and the plutella xylostella is fed. After the Trypsin-9 gene is successfully silenced and expressed in the midgut of the plutella xylostella, the BtCry1Ac prototoxin is fed, and the active Cry1Ac toxin is found to be reduced. Meanwhile, the digestion of the plutella xylostella on the feeding nutrition is reduced, the absorption of the food nutrition is reduced, and the plutella xylostella is deformed and can not pupate to die, so that the harm of pests is prevented. The Trypsin-9 protein is shown to play a role in activating Cry1Ac protoxin and releasing small peptide which is convenient to absorb from other nutritional proteins in the middle intestine of the plutella xylostella, can be used as a novel molecular target for biological control, is used for controlling cruciferous vegetable pests, and has good biological control potential and application prospect.

Therefore, the invention provides the application of the Trypsin-9 gene or the protease Trypsin-9 in improving the toxicity of Cry1Ac protoxin to cruciferous vegetable pests.

Also provides the application of the Trypsin-9 gene or the protease Trypsin-9 or the RNAi carrier thereof in reducing the digestion of the midgut of the brassicaceous vegetable pests on the nutrient protein and reducing the nutrient absorption of the pests.

Also provides application of the Trypsin-9 gene or the protease Trypsin-9 as a target for preventing and controlling the brassicaceous vegetable pests.

Also provides application of the Trypsin-9 gene or the protease Trypsin-9 in preventing and treating the pests of the cruciferous vegetables or preparing a medicament for preventing and treating the pests of the cruciferous vegetables.

Specifically, the control method feeds protease Trypsin-9 and Cry1Ac prototoxin to the cruciferous vegetable pests together, so that the activation and the activity of the BtCry1Ac prototoxin can be increased, the insecticidal activity is improved, and the mortality of the Cry1Ac toxin to the pests is increased. Or the RNAi recombinant bacteria of the diamond back moth Trypsin-9 are fed to the brassicaceous vegetable pests, when the pests eat the recombinant bacteria with the dsRNA for silencing the expression of the diamond back moth-9 gene, the translation of the diamond back moth Trypsin-9 is degraded or blocked, so that the protein of the diamond back moth-9 in the body of the pests is obviously reduced, the absorption of food nutrition is reduced, the malformation is caused, the pupation and the death cannot be realized, and the harm of the pests is prevented.

The invention also provides a medicament for preventing and controlling the pests of the cruciferous vegetables, which comprises diamond back moth Trypsin Trypsin-9 and BtCry1Ac prototoxin.

Preferably, the Trypsin-9 is recombinant Trypsin-9 protein, a Trypsin-9 gene coding sequence with signal peptides removed is connected to an expression vector to obtain a recombinant expression plasmid, an escherichia coli prokaryotic expression system is utilized to induce and express the Trypsin-9 of the plutella xylostella, the recombinant protein expressed by the supernatant is further purified by a His-tag chromatographic column, and then an ultrafiltration tube is used for deionization and concentration to obtain the recombinant protein.

The invention also provides another medicament for preventing and controlling the brassicaceous vegetable pests, which comprises a preparation for inhibiting the expression of the Trypsin-9 gene.

Preferably, the preparation is RNAi recombinant bacteria of diamondback moth Trypsin-9, the gene or functional region code of the Trypsin-9 is introduced into a corresponding RNAi carrier, such as L4440, dsRNA for silencing expression of the Trypsin-9 gene is expressed, when pests eat HT115 bacteria with the dsRNA for silencing expression of the Trypsin-9 gene, the translation of the diamondback moth Trypsin-9 is degraded or blocked, so that the Trypsin-9 protein in the pests is remarkably reduced, the diamondback moth degrades and digests the feeding protein, the pests lack nutrition and are malformed, and the pests cannot pupate to die, and therefore the harm of the pests is prevented.

Preferably, the cruciferous vegetable pest is a diamondback moth.

Compared with the prior art, the invention has the following beneficial effects:

the invention provides a diamond back moth Trypsin Trypsin-9 gene, the nucleotide sequence of which is shown in SEQ ID NO. 1, and the amino acid sequence of the coded protease Trypsin-9 is shown in SEQ ID NO. 2. The research of the invention shows that the Trypsin-9 plays an important role in the activation of Cry1Ac prototoxin in the middle intestine of the plutella xylostella, the Trypsin-9 is added to obviously improve the activation of Bt Cry1Ac prototoxin in the middle intestine of the plutella xylostella, and the death rate of the plutella xylostella is obviously improved; after the expression of the gene of the cryptophycin-9 of the plutella xylostella in the midgut is silenced, the digestion of the midgut of the plutella xylostella on food is reduced, and pupation deformity is caused, so that the cryptophysin-9 can be used as a novel molecular target for biological control, is used for controlling brassicaceous vegetable pests, and has good biological control potential and application prospect.

Drawings

FIG. 1 shows the SDS-PAGE and western blot detection of Trypsin-9 expression in the examples of the present invention. Note: a, M: a protein Marker;1. pET-32a-Pxtrypsin-9 recombinant protein without IPTG induction; 2 IPTG induced recombinant protein of pET-32 a-Pxtrypsin-9; 3. IPTG induced protein precipitation of pET-32 a-Pxtrypsin-9; 4. protein supernatant of pET-32a-Pxtrypsin-9 induced by IPTG; 5-6: purified protein eluted with 500mM imidazole. B: western blot analysis, M: a protein Marker;1-5: western blot of different concentrations of protein.

FIG. 2 is a hydrolysis analysis of the hydrolysis of Cry1Ac prototoxin by intestinal juice in plutella xylostella according to the present invention. M: a 180kDa protein Marker;1: diamondback moth midgut fluid (0.3 mg/mL); 2-7 incubation of middle intestinal juice of diamondback moth (the concentration of which respectively accounts for 0.01%, 0.1%, 1%, 10%, 100% and 200% of the protoxin concentration) and Cry1Ac prototoxin (0.3 mg/mL) in equal volume; 8: cry1Ac protoxin (0.3 mg/mL).

FIG. 3 is the hydrolysis of Cry1Ac prototoxin by diamondback moth midgut enzyme fluid after Cry1Ac induction. Note: m: marker;1: cry1Ac protoxin (0.3 mg/mL); 2-4: performing equal-volume incubation on the intestinal juice (the concentrations of which respectively account for 0.01%, 0.1% and 200% of Cry1Ac protoxin) of the plutella xylostella in the CK group and Cry1Ac protoxin (0.3 mg/mL); 5: control group mid-gut fluid (0.3 mg/mL); 6-8: after the Cry1Ac is induced for 24 hours, the intestinal juice (the concentration of which accounts for 0.01 percent, 0.1 percent and 200 percent of the concentration of the Cry1Ac protoxin) of the plutella xylostella is incubated with the Cry1Ac protoxin (0.3 mg/mL) in the same volume; 9: after the Cry1Ac protoxin is infected for 24 hours, the intestinal juice (0.3 mg/mL) of the plutella xylostella is obtained.

FIG. 4 is a hydrolysis analysis of the intestinal juice hydrolysis Cry1Ac prototoxin in plutella xylostella after RNAi. Note: m: marker; 1-3: after feeding dsGFP for 24 hours, respectively incubating the intestinal juice (the concentration of which accounts for 0.01 percent, 0.1 percent and 200 percent of the concentration of the Cry1Ac prototoxin) of the plutella xylostella and the Cry1Ac prototoxin (0.3 mg/mL) in equal volume; 4: feeding dsGFP24h midgut fluid; 5-7: respectively incubating the middle intestinal juice (the concentration accounts for 0.1%, 1% and 200% of the concentration of the Cry1Ac prototoxin) and Cry1Ac prototoxin (0.3 mg/mL) in equal volume after feeding dsRNA-PxTrypsin-9; 8: feeding ds RNA-PxTrypsin-9 24h midgut fluid; 9: cry1Ac protoxin (0.3 mg/mL).

FIG. 5 shows the statistics of the survival rate of diamondback moth.

Detailed Description

The invention is further described with reference to the drawings and the following detailed description, which are not intended to limit the invention in any way. Reagents, methods and apparatus used in the present invention are conventional in the art unless otherwise indicated.

Example 1 cloning of CDS fragment of Trypsin-9 Gene of Plutella xylostella

Extracting total RNA of the middle intestine of the plutella xylostella by using a Trizol method, performing reverse transcription to synthesize one strand of cDNA, and performing PCR cloning by using the strand as a template, wherein a primer sequence of a target gene containing all CDS regions is F:5 'AGCATAATTCAAATTCAGTTACC-3', R:5 'AACATTTTCCTACGCGTTT GTG-3'; the PCR product was separated by 1% agarose gel electrophoresis and recovered and purified, and the sequence size was analyzed to be 820bp. The recovered PCR product is connected to pMD18-T vector, the connected product is transformed into competent cell DH5 alpha, and the positive clone strain is sent to sequencing identification. The strains identified by sequencing as correct were stored in glycerol at-80 ℃.

Example 2 prokaryotic expression of Trypsin-9 Gene of Plutella xylostella and purification of recombinant protein

Carrying out PCR cloning by taking the obtained cDNA as a template, designing a pair of specific amplification primers according to the ORF sequence of the diamond back moth Trypsin-9 gene, and introducing enzyme cutting sites EcoRI (GAATTC) and HindIII (AAGCTT), wherein the primer sequence of the Trypsin-9 gene is F:5' -CGGAATTCAGGATTGTGGGTGGATCCGC-3' (the designed EcoRI cleavage site is underlined); r:5' -CCAAGCTTCGCGTTTGCGAATCCAGT-3' (underlined indicates designed HindIII cleavage site). And carrying out PCR amplification by taking the recombinant plasmid with the Trypsin-9CDS fragment as a template to obtain the Trypsin-9 gene expression fragment. Separating the PCR product by using 1% agarose gel electrophoresis, recovering and purifying, carrying out double enzyme digestion on the recovered PCR product and pET-32a empty carrier by using EcoRI and HindIII, constructing an expression plasmid and building pET-32a-Trypsin-9, extracting the plasmid EcoRI and HindIII in a competent cell DH5 alpha for double enzyme digestion identification, and storing the strain with correct sequencing in the form of glycerol.

The expression plasmid pET-32a-Trypsin-9 is transferred into an expression host bacterium BL21, protein expression is induced by using 0.6mM IPTG, and protein expression is detected by SDS-PAGE electrophoresis, and the result is shown in figure 1. As can be seen from FIG. 1, the protein was expressed at high efficiency. The fusion protein was purified in one step using Ni-NTA Sefiniose Resin. SDS-PAGE and WB test showed the results shown in FIG. 1. The size of the obtained recombinant protein Trypsin-9 is 45kDa (about 12kDa of Trx. Tag, about 1.6kDa of 2 His. Tag, about 1.7kDa of S. Tag, about 29kDa of the target fragment) which is consistent with the result. After being purified by Ni-NTASefinosine Resin, the Trypsin-9 recombinant protein with higher purity is obtained, and the concentration is about 1mg/mL.

Example 3 degradation of Cry1Ac protoxin by Coleus mediterranean enzyme solutions at different concentrations

1. Extraction of Cry1Ac protoxin

In the experiment, bt HD-73 bacterial strains are used as materials to extract Cry1Ac protoxin proteins, and the specific steps are as follows:

(1) Single colonies were picked from the colony plates of HD-73 strain and activated overnight (30 ℃ C., 200 rpm) on LB liquid medium.

(2) And transferring the mixture to a 1/2LB liquid medium (half of yeast powder in the LB medium) according to the proportion of 1.

(3) Washed twice with PBS, lysed with lysate and centrifuged at 3000rpm for 30min at 4 ℃.

(4) The supernatant was precipitated at the isoelectric point of NaNc-HAc, and centrifuged (4 ℃,3000rpm, 30min)

(5) The resulting precipitate was crystalline protein, dissolved in the dissolution solution. The concentration of the extracted protoxin is measured by subpackaging and storing at-80 ℃ for later use.

2. Protoxin protein concentration was determined using BCA method:

(1) According to the number of samples, 200mL of BCA working solution is prepared for each sample according to the preparation proportion of A: B = 50.

(2) The standard was added to a 96-well plate at 0, 1, 2, 4 \8230, 20. Mu.L, and the standard was supplemented to 20. Mu.L with PBS. 20 mu L of Cry1Ac protoxin protein liquid is added into a 96-well plate for three times.

(3) Add 200. Mu.L BCA working solution to each well and incubate 37 for 30min.

(4) And (4) measuring the value A595 by using a microplate reader, drawing a standard curve according to the value of the standard substance, and calculating the concentration of the protoxin protein.

3. The concentration of the extracted protoxin was set to (0.3 mg/mL), and the concentration of the mesenteric fluid was diluted to 200%, 100%, 10%, 1%, 0.1%, 0.01% of the concentration of the toxin Cry1Ac, which was mixed with the protoxin in equal volume, and 0.15M NaCl ₂ Mixing with Cry1Ac prototoxin in equal volume, and incubating with midgut fluid of diamondback moth (0.3 mg/mL) at 37 deg.C for 1h. In order to observe the hydrolysis process of the plutella xylostella midgut protease on the Cry1Ac prototoxin more intuitively, the plutella xylostella midgut fluid and the Cry prototoxin with different concentrations are incubated in equal volume, SDS-PAGE electrophoresis is used for detection, and as shown in figure 2, after incubation for 1h at 37 ℃, the Cry1Ac prototoxin (-130 KDa) incubated with the plutella xylostella midgut protease is gradually digested into activated toxin of 50KDa along with the increase of the concentration of the plutella xylostella midgut protease. When the protease enzyme concentration to toxin concentration ratio is 1 and 2, the activated toxin band is significantly weaker, indicating that degradation of the activated toxin has occurred.

Example 4 analysis of Cry1Ac prototoxin degradation by Coleus mediterranean moth midgut enzyme fluid following Cry1Ac Induction

The concentration of the extracted protoxin is diluted to be (0.3 mg/mL), the concentration of the Cry1Ac treated for 24h and the concentration of the CK treated midgut fluid are diluted to be 200%, 100%, 0.1% and 0.01% of the concentration of the toxin Cry1Ac, the midgut fluid with different concentrations is respectively mixed with the protoxin in equal volume, 0.15M NaCl2 is mixed with the Cry1Ac prototoxin in equal volume, and the midgut fluid (0.3 mg/mL) of the Cry1Ac treated group and the diamond back moth of the CK group is subjected to water bath at 37 ℃ for 1h. The results are shown in FIG. 3.

As can be seen from fig. 3, the activation and toxin-digesting ability of the midgut fluid after Cry1Ac treatment at the same concentration was significantly reduced compared to the control. The intestinal juice of the diamondback moth can activate Cry1Ac prototoxin into active toxin protein, and after the Cry1Ac is infected with the diamondback moth, the expression level of trypsin shows a descending trend, which shows that the trypsin plays an important role in activation of the Cry1Ac prototoxin.

Example 5 construction of RNA interference vector of Trypsin-9 from Plutella xylostella

A cDNA containing a Trypsin-9 gene fragment is taken as a template, and a pair of specific primers (L4440-Trypsin-9F GGCAGATCTGGAGGATTGTGGGT GGAT and L4440-Trypsin-9R CGACTCGAGGtctgatttctggtagcg) on the functional region of the Trypsin-9 protein (amino acid sequence as shown in SEQ ID NO:2, and the corresponding nucleotide sequence is shown as SEQ ID NO: 1) amplifying and designing a pair of primers GFP-F according to a GFP gene: GGCAGATCTAAGGGCGAGGAGCTGTTCACCG，GFP-R:CGACTCGAGCCGT CGCCGATGGGTGTTC was amplified in a 25. Mu.L system using the high fidelity enzyme KOD PLU. Detecting the PCR amplification result by 1.0% agarose gel electrophoresis, recovering the PCR product, performing double digestion by Xho I and Bgl II, recovering the digestion product, and standing at-20 ℃ for later use.

The preserved L4440 empty plasmid glycerol strain was inoculated into 5mL of LB liquid medium and placed in a shaker at 37 ℃ and 240rpm/min for overnight seed culture. The seed bacteria cultured overnight were inoculated into 4mL of the culture containing Amp at a ratio of 1 ⁺ (100 mg/L) and Tet ⁺ In a (100 mg/mL) double-resistant fresh LB culture solution, shaking culture is carried out at 37 ℃ until the OD600 value is about 0.6, plasmids are extracted, and the plasmids are purified and recovered by double-enzyme cutting gel through Xho I and Bgl II.

Connecting the product recovered by the Trypsin-9 gene enzyme digestion with the product recovered by the L4440 enzyme digestion, wherein the reaction system is as follows: after enzyme digestion, 3L of L4440 plasmid; trypsin-9 expression fragment, 14L; t4 DNA Ligase,1L; t4 DNA Ligase Buffer,2L; the ligation was performed overnight in a biochemical incubator at 16 ℃.

The ligation product L4440-Trypsin-9 is transformed into an escherichia coli competent cell DH5 alpha, shaken for bacteria extraction and plasmid extraction. Xho I and Bgl II are used for double enzyme digestion identification, the thalli are sent to Guangzhou Egyi biotechnology limited company for sequencing, the thalli with correct sequencing are stored in glycerol bacteria at the temperature of minus 80 ℃ for standby.

The recombinant strain HT115 (DE 3) with the L4440-Trypsin-9 expression plasmid is inoculated into LB liquid medium containing Amp + (100 mg/L) and Tet + (100 mg/mL) dual resistance, shaken at 37 ℃ and 240rpm/min for 6h, added with IPTG to the final concentration of 1mM and induced to express for 4h. Centrifuging thallus at 12000rpm/min for 1min, collecting thallus, introducing liquid nitrogen, grinding, adding 1000 μ L RNAioso Plus, taking L4440 empty carrier as control, extracting RNA, and detecting by DNA gel electrophoresis.

And (3) feeding Trypsin-9 RNA. Transferring the plasmid carrying the L4440-Trypsin-9 into HT115 for culture, and collecting thalli after IPTG induction, wherein the original shake bacteria volume and the heavy suspension volume are 1:250. healthy 4-instar larvae plutella xylostella with consistent instar are selected to be fed for experiments, 100 heads of each treatment is carried out, and the three treatments are repeated. The preparation method of the feed comprises the following steps: and mixing the prepared thalli with feed according to the proportion of adding 1mL of thalli into 4g of feed, feeding L4440-GFP as a negative control, and feeding the diamondback moth larvae with artificial feed for 24 hours. And dissecting a part of intestinal juice of the diamondback moth, and detecting the activation of the Cry1 Ac. Some were examined for RNA effects.

RNAi results. RNAi experiments are carried out on plutella xylostella by using a feeding method, and in the experiments, most of plutella xylostella larvae fed with Trypsin-9 gene dsRNA can not be successfully pupated, and even if a few of the plutella xylostella larvae are pupated, the larvae are malformed, the individuals are thin and small, and the vegetative dysplasia is caused. And the plutella xylostella 4 th instar larvae fed with L4440 empty carrier dsRNA can normally develop without blackening and successfully eclosion, which shows that the plutella xylostella Trypsin-9 can be silenced to interfere the ontogeny and reduce the survival rate.

Example 6 ability of Coleoptera xylostella midgut enzyme solution to degrade Cry1Ac protoxin after Trypsin-9RNAi

To further examine the role of Trypsin-9 in the activation process of protoxin, the extracted protoxin concentration was diluted to (0.3 mg/mL). Diluting the intestinal juice of diamondback moth fed with L4440-Trypsin-9 and L4440-dsGFP to 200%, 100%, 0.1%, 0.01% of the toxin Cry1Ac, mixing the intestinal juice with the toxin in the same volume, and adding 0.15M NaCl ₂ Mixing with Cry1Ac prototoxin in equal volume, and the intestinal juice (0.3 mg/mL) of Plutella xylostella with L4440-Trypsin-9 and L4440-dsGFP in water bath at 37 deg.C for 1h. As shown in FIG. 4, we found that after incubation of Cry1Ac protoxin with respectively the diamondback moth midgut fluid treated by RNAi for 24h (fed with L4440-Trypsin-9 and L4440-dsGFP) and the Cry1Ac protoxin, the activation and toxin-digesting abilities of the midgut fluid fed with L4440-Trypsin-9 at the same concentration were significantly reduced compared with the L4440-GFP. The Trypsin-9 plays an important role in the activation of the Cry1Ac prototoxin and participates in the immunity of the midgut of the plutella xylostella to the BtCry1 Ac.

Example 7 synergistic Effect of Plutella xylostella Trypsin-9 protein on microbial insecticides

Culturing bacillus thuringiensis in a logarithmic growth phase, collecting thalli, washing 3 times by PBS, suspending the thalli by PBS, wherein the original shake volume and the heavy suspension volume are 1:10, storing the prepared thalli for later use.

And picking healthy 3-year-old plutella xylostella larvae with consistent growth vigor, uniformly mixing the artificial feed (1 g) and the fusion protein Trypsin-9 (10 mu g), feeding the plutella xylostella larvae, and replacing the feed once after 12 hours. The anti-Trypsin-9 polyclonal antibody (10 μ g) was also fed, and PBS was used as a control. And feeding the plutella xylostella for 24 hours, further feeding the bacillus thuringiensis, observing the plutella xylostella once every 12 hours after feeding, and counting the cumulative mortality when the feeding time is 84 hours.

Transferring the plasmid carrying the L4440-Trypsin-9 into HT115 for culture, and collecting thalli after IPTG induction, wherein the original shake bacteria volume and the heavy suspension volume are 1:250. and mixing the feed according to the proportion of adding 1mL of bacteria into 4g of feed, treating 100 plutella xylostella in each group, feeding L4440-GFP as a control of non-interfering RNA, taking healthy plutella xylostella as a blank control, feeding the plutella xylostella for 24h after dsRNA feeding to further feed bacillus thuringiensis, observing the mixture once every 12h after feeding, and counting the cumulative mortality when the total amount reaches 84 h.

The mortality statistics are shown in figure 5. As can be seen from the figure 5, the mortality of the plutella xylostella can be improved by adding the recombinant protein Trypsin-9, and the Cry1Ac activation is inhibited after the Trypsin-9 expression is reduced by adding the RNAi of L4440-Trypsin-9, so that the survival rate of the plutella xylostella is improved, and the insecticidal efficiency of the Cry1Ac insecticidal protein can be enhanced by adding the recombinant protein Trypsin-9.

Sequence listing

<120> diamondback moth Trypsin-9 gene and application thereof

<141> 2020-06-30

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 820

<212> DNA

<213> Plutella xylostella (Plutella xylostella)

<400> 1

agcataattc aaattcagtt accagtagtc acaatgcgtt ctcttttcct gttagttttg 60

ggagcaattg cagtgtcggg ggcggctgtc cctcgcactt cgcagaggat tgtgggtgga 120

tccgccacca ccatcgaccg gtatccgttc ggtgcagtcg ttctgttcct ctcgaatgga 180

ggattcttcc gccagcattg cggagggagc atcatcaatg acaatgcagt cttgactgct 240

gcgcactgtc tgcaccgcag gagaaacgac cagttccgca tccgtgtcgg ttcaacccaa 300

gccagcagcg gcggcagcgt gcacgccgtc aaccggctaa tctcacatgc gagcttcaac 360

cacaacaccc aggacaatga cctcgccatc atgaggacca ccacccagat caacttcctc 420

cctggattgg tcgcggctgg caccttcgct gggtctaact acaacgtgcc cgacggcgcc 480

tccgtctggg ctatcggctg gggagctgga cgacccaacg gccccggatc cgagcagctg 540

cgtcacgtgg agatctggac cgtgaaccag gcggtctgca gggctcgcta ccagaacatc 600

agaatgactg ttactgacaa catgctgtgc tcgggctggc tggacgtggg cggccgcgac 660

cagtgcacgg gagactctgg tggccccctc cttcatgata atgtggtcat tggagtctca 720

tcgtggggcc agggctgtgc gtcggccgag taccctggag tcaacgtgcg cgtgtctcgc 780

tacattgact ggattcgcac aaacgcgtag gagaaatgtt 820

<210> 2

<211> 258

<212> PRT

<213> Plutella xylostella (Plutella xylostella)

<400> 2

Met Arg Ser Leu Phe Leu Leu Val Leu Gly Ala Ile Ala Val Ser Gly

1 5 10 15

Ala Ala Val Pro Arg Thr Ser Gln Arg Ile Val Gly Gly Ser Ala Thr

20 25 30

Thr Ile Asp Arg Tyr Pro Phe Gly Ala Val Val Leu Phe Leu Ser Asn

35 40 45

Gly Gly Phe Phe Arg Gln His Cys Gly Gly Ser Ile Ile Asn Asp Asn

50 55 60

Ala Val Leu Thr Ala Ala His Cys Leu His Arg Arg Arg Asn Asp Gln

65 70 75 80

Phe Arg Ile Arg Val Gly Ser Thr Gln Ala Ser Ser Gly Gly Ser Val

85 90 95

His Ala Val Asn Arg Leu Ile Ser His Ala Ser Phe Asn His Asn Thr

100 105 110

Gln Asp Asn Asp Leu Ala Ile Met Arg Thr Thr Thr Gln Ile Asn Phe

115 120 125

Leu Pro Gly Leu Val Ala Ala Gly Thr Phe Ala Gly Ser Asn Tyr Asn

130 135 140

Val Pro Asp Gly Ala Ser Val Trp Ala Ile Gly Trp Gly Ala Gly Arg

145 150 155 160

Pro Asn Gly Pro Gly Ser Glu Gln Leu Arg His Val Glu Ile Trp Thr

165 170 175

Val Asn Gln Ala Val Cys Arg Ala Arg Tyr Gln Asn Ile Arg Met Thr

180 185 190

Val Thr Asp Asn Met Leu Cys Ser Gly Trp Leu Asp Val Gly Gly Arg

195 200 205

Asp Gln Cys Thr Gly Asp Ser Gly Gly Pro Leu Leu His Asp Asn Val

210 215 220

Val Ile Gly Val Ser Ser Trp Gly Gln Gly Cys Ala Ser Ala Glu Tyr

225 230 235 240

Pro Gly Val Asn Val Arg Val Ser Arg Tyr Ile Asp Trp Ile Arg Thr

245 250 255

Asn Ala

<210> 3

<211> 702

<212> DNA

<213> Plutella xylostella (Plutella xylostella)

<400> 3

aggattgtgg gtggatccgc caccaccatc gaccggtatc cgttcggtgc agtcgttctg 60

ttcctctcga atggaggatt cttccgccag cattgcggag ggagcatcat caatgacaat 120

gcagtcttga ctgctgcgca ctgtctgcac cgcaggagaa acgaccagtt ccgcatccgt 180

gtcggttcaa cccaagccag cagcggcggc agcgtgcacg ccgtcaaccg gctaatctca 240

catgcgagct tcaaccacaa cacccaggac aatgacctcg ccatcatgag gaccaccacc 300

cagatcaact tcctccctgg attggtcgcg gctggcacct tcgctgggtc taactacaac 360

gtgcccgacg gcgcctccgt ctgggctatc ggctggggag ctggacgacc caacggcccc 420

ggatccgagc agctgcgtca cgtggagatc tggaccgtga accaggcggt ctgcagggct 480

cgctaccaga acatcagaat gactgttact gacaacatgc tgtgctcggg ctggctggac 540

gtgggcggcc gcgaccagtg cacgggagac tctggtggcc ccctccttca tgataatgtg 600

gtcattggag tctcatcgtg gggccagggc tgtgcgtcgg ccgagtaccc tggagtcaac 660

gtgcgcgtgt ctcgctacat tgactggatt cgcacaaacg cg 702

Claims

1. The application of the diamondback moth Trypsin Trypsin-9 gene or the diamondback moth Trypsin Trypsin-9 gene in improving the toxicity of Cry1Ac prototoxin to cruciferous vegetable pests is characterized in that the nucleotide sequence of the gene is shown as SEQ ID NO. 1; the amino acid sequence of the protease is shown as SEQ ID NO. 2; the cruciferous vegetable pests are diamondback moths.

2. An agent for controlling cruciferous vegetable pests, which is diamondback moth, comprising the Trypsin-9 and BtCry1Ac protoxin of diamondback moth Trypsin of claim 1.