CN102304536A - Eukaryotic fused expression product of two marine animal antibacterial peptide genes, and preparation method thereof - Google Patents
Eukaryotic fused expression product of two marine animal antibacterial peptide genes, and preparation method thereof Download PDFInfo
- Publication number
- CN102304536A CN102304536A CN 201110250681 CN201110250681A CN102304536A CN 102304536 A CN102304536 A CN 102304536A CN 201110250681 CN201110250681 CN 201110250681 CN 201110250681 A CN201110250681 A CN 201110250681A CN 102304536 A CN102304536 A CN 102304536A
- Authority
- CN
- China
- Prior art keywords
- antibacterial peptide
- gly
- hepc
- scy
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Peptides Or Proteins (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention discloses a eukaryotic fused expression product of two marine animal antibacterial peptide genes, and a preparation method thereof, and relates to genetic engineering expressions of antibacterial peptides of marine fishes and crabs. The two marine animal antibacterial peptide genes comprise mud crab antibacterial peptide scygonadin gene, a connecting peptide, large yellow croaker antibacterial peptide hepcidin gene. The preparation method comprises the following steps that: the mud crab antibacterial peptide scygonadin gene and the large yellow croaker antibacterial peptide hepcidin gene are amplified through PCR reactions; a overlap PCR reaction is adopted for preparing the target gene fragment of a combined polypeptide Scy-hepc; the resulting fusion gene Scy-hepc is inserted into an expression vector to construct a fusion gene Scy-hepc-carried recombinant expression vector; the resulting recombinant expression vector is transferred into the host cell, and then the induction expression is adopted for the host cell to obtain the expression product; the expression product is isolated and purified to obtain the recombinant protein, which is the combined polypeptide Scy-hepc.
Description
Technical field
The present invention relates to the gene engineering expression of marine fishes and crab class antibacterial peptide, be specifically related to have the Scylla paramamosain antibacterial peptide Scygonadin and eucaryon fusion expressed product and the preparation method of large yellow croaker antibacterial peptide Hepcidin in pichia spp GS115 of anti-microbial activity.
Background technology
Antibacterial peptide (antimicrobial peptide) is the important component of innate immunity, extensively is present in each class of organic sphere, and is conservative relatively in the evolution, has the effect such as antibiotic, antiviral and antitumor of wide spectrum.Problems such as fishery products drug residue that abuse of antibiotics causes in bacterial drug resistance that research, exploitation and application antibacterial peptide face during the solution sea farming is produced and the feed and water environment pollution have important scientific meaning and actual application value.Following Application and Development angle from antibacterial peptide; The important antibiotic structural domain of optimizing multiple antibacterial peptide is also recombinant expressed; Can obtain novel fusion antimicrobial polypeptide, widen the antimicrobial spectrum of antibacterial peptide, maybe be than utilizing a certain antibacterial peptide to have prior actual application value merely.
Scylla paramamosain antibacterial peptide Scygonadin and large yellow croaker antibacterial peptide Hepcidin all derive from marine animal, and Scygonadin comes from invertebrates, in innate immunity, play a role.And Hepcidin comes from low grade for vertebrates, is the important effector of fish congenital immunity.So far, also do not report relevant for the research of these two types of antibacterial peptide tandem expression.
Hepcidin is a kind of amphipathic molecule that is rich in halfcystine; Can form stable βZhe Die structure and Loop structure through disulfide linkage; The anti-microbial activity of this structure and Hepcidin closely related ([1] Hunter H N, Fulton D B, Ganz T; Vogel H J.The solution structure of human hepcidin; A peptide hormone with antimicrobial activity that is involved in iron uptake and hereditary hemochromatosis [J] .J Biol Chem., 2002,277 (40): 37597-37603).Hepcidin recombinant expressed in the escherichia coli prokaryotic expression system has influenced the anti-microbial activity of Hepcidin probably because disulfide linkage can't correctly fold processing, and then has influenced the antibacterial of associating polypeptide Scy-hepc.Thereby this experiment uses the pichia spp eukaryotic expression system to express the tandem polypeptide Scy-hepc of Scygonadin and Hepcidin.
Made up the Scygonadin gene through genetic engineering technique and reached the eucaryon stably express bacterial strain of uniting with large yellow croaker antibacterial peptide Hepcidin gene; Optimize its expression and purification technology; Study the anti-microbial activity and the antimicrobial spectrum of its gene expression product; To lay the foundation for the application of uniting polypeptide products future, and technical support is provided for the industrialization of antibacterial peptide.
Summary of the invention
The object of the present invention is to provide the eucaryon fusion expressed product and the preparation method of two kinds of marine animal antibacterial peptide genes.
Said two kinds of marine animal antibacterial peptide genes comprise Scylla paramamosain antibacterial peptide scygonadin gene, connection peptides and large yellow croaker antibacterial peptide hepcidin gene; But the eucaryon fusion expressed product called after Scy-hepc of said two kinds of marine animal antibacterial peptide genes, said Scylla paramamosain negatively charged ion antibacterial peptide scygonadin gene order is:
ggccaggcac tcaacaaact tatgcctaaa atcgtcagcg ccataattta tatggtcggg 60
caacccaatg caggtgtcac ttttctgggc caccaatgtc tggtggagtc aacgaggcaa 120
ccagacgggt tttacaccgc aaagatgtcg tgtgcttcct ggactcatga taatcctatt 180
gttggggaag gaagaagccg ggttgaactt gaggcgctta aaggttccat cacaaacttt 240
gtccagacag catccaatta caagaagttc accatagatg aggtcgagga ctggattgct 300
tcttac 306
Said large yellow croaker antibacterial peptide hepcidin gene order is:
gtcccagcca atgaagagca agagctggag cagcaaattt attttgctga tccagagatg 60
ccagtggaat catgcaagat gccgtattac atgcgtgaga atcgtcaggg cagccctgct 120
agatgcaggt tttgctgccg ttgctgtcct agaatgaggg gatgtggtat ctgctgcagg 180
ttc 183
The aminoacid sequence of said connection peptides can be:
Gly Gly Pro Gly Ser Gly
1 5
The aminoacid sequence of the eucaryon fusion expressed product of said antibacterial peptide scygonadin and hepcidin gene:
Gly Gln Ala Leu Asn Lys Leu Met Pro Lys Ile Val Ser Ala Ile Ile
1 5 10 15
Tyr Met Val Gly Gln Pro Asn Ala Gly Val Thr Phe Leu Gly His Gln
20 25 30
Cys Leu Val Glu Ser Thr Arg Gln Pro Asp Gly Phe Tyr Thr Ala Lys
35 40 45
Met Ser Cys Ala Ser Trp Thr His Asp Asn Pro Ile Val Gly Glu Gly
50 55 60
Arg Ser Arg Val Glu Leu Glu Ala Leu Lys Gly Ser Ile Thr Asn Phe
65 70 75 80
Val Gln Thr Ala Ser Asn Tyr Lys Lys Phe Thr Ile Asp Glu Val Glu
85 90 95
Asp Trp Ile Ala Ser Tyr Gly Gly Pro Gly Ser Gly Val Pro Ala Asn
100 105 110
Glu Glu Gln Glu Leu Glu Gln Gln Ile Tyr Phe Ala Asp Pro Glu Met
115 120 125
Pro Val Glu Ser Cys Lys Met Pro Tyr Tyr Met Arg Glu Asn Arg Gln
130 135 140
Gly Ser Pro Ala Arg Cys Arg Phe Cys Cys Arg Cys Cys Pro Arg Met
145 150 155 160
Arg Gly Cys Gly Ile Cys Cys Arg Phe
165
The preparation method of the eucaryon fusion expressed product of said two kinds of marine animal antibacterial peptide genes may further comprise the steps:
1) difference pcr amplification Scylla paramamosain antibacterial peptide scygonadin gene and large yellow croaker antibacterial peptide hepcidin gene, overlapping PCR method obtains the target gene fragment of associating polypeptide Scy-hepc;
2) the fusion gene Scy-hepc with the step 1) gained imports expression vector, makes up the recombinant expression vector that carries fusion gene Scy-hepc;
3) with step 2) recombinant expression vector of gained changes host cell over to, and host cell is carried out abduction delivering, obtain expression product;
4) purification procedures 3) expression product of gained, obtain recombinant protein, promptly unite polypeptide Scy-hepc.
In step 2) in, said expression vector can be selected pPIC9K etc. for use.
In step 3), said host cell can be pichia spp GS115 bacterial strain etc.
In step 4), the method for said separation and purification can be: elder generation carries out recombination expression product centrifugal, collects fermented supernatant fluid, after the dialysis, carries out affinity chromatography again.
The present invention is by genetic engineering technique; Utilize the pPIC9K yeast expression vector; Efficiently express out Scylla paramamosain antibacterial peptide Scygonadin with anti-microbial activity and the fusion expressed product Scy-hepc of large yellow croaker antibacterial peptide Hepcidin; This recombinant protein has broad-spectrum antibacterial activity, and the advantage of these two kinds of marine animal antibacterial peptide genes of tandem expression is following in pichia spp:
1. Scylla paramamosain antibacterial peptide Scygonadin and large yellow croaker antibacterial peptide Hepcidin come from marine animal, and Scygonadin mainly plays a role in innate immunity as antibacterial peptide in the invertebrates body.And Hepcidin is the important effector of fish congenital immunity as the vertebrates antibacterial peptide.The medicinal exploitation of its series connection product has research to culture fishery and is worth.
2. the associating polypeptide of said eukaryotic expression has broad spectrum antibiotic activity; To gram-positive microorganism such as micrococcus luteus, Corynebacterium glutamicum and streptococcus aureus; Gram-negative bacteria such as Aeromonas hydrophila and Pseudomonas fluorescens are all had obvious suppression growth and killing action, in the exploitation of resisting pathogenic microbes new drug and animal feedstuff additive, have potential using value.
3. the Scy-hepc of eukaryotic expression is significantly higher than anti-microbial activity (MIC7.5～60 μ M) ([2] Peng H of antibacterial peptide Scygonadin to the anti-microbial activity (MIC1.6～6.25 μ M) of identical tested bacterial strain such as Aeromonas hydrophila, micrococcus luteus, Corynebacterium glutamicum; Yang M; Huang W S; Ding J, Qu H D, Cai J J; Zhang N; Wang K J.Soluble expression and purification of a crab antimicrobial peptide scygonadin in different expression plasmids and analysis of its antimicrobial activity.Protein Expres Purif, 2010,70:109-115); Anti-microbial activity close (1.5～12 μ M) ([3] Wang Kejian, a kind of large yellow croaker hepcidin of Cai Lingcai Jingjing antibacterial peptide and preparation method thereof application number: 201010505548.3) with the large yellow croaker Hepcidin of expression and purification.Yet the proteic external sex change renaturation technology of the large yellow croaker Hepcidin of escherichia coli expression is comparatively complicated, is unfavorable for industrialization.Therefore eukaryotic expression Scy-hepc associating polypeptide expression purifying process can be brought into play bigger effect in antibacterial peptide industrialization and commercialization process.
Description of drawings
Fig. 1 is pcr amplification associating polypeptide Scy-hepc target gene fragment.In Fig. 1, M is DNA Marker DL2000, and 1 is the PCR product of associating polypeptide Scy-hepc, and 2 is scygonadin gene PCR product, and 3 is the PCR product of hepcidin gene, and bp is a base.
Fig. 2 is an electrophoretogram before and after the pPIC9K carrier double digestion.In Fig. 2,1 for enzyme cut before the pPIC9K carrier, 2 cut pPIC9K carrier afterwards for enzyme, M is DNA Marker DL2000.
Fig. 3 is the variation (the pH value is 6.0, and methanol concentration is 0.5%) of the target protein Scy-hepc expressing quantity of different induction times behind the SDS-PAGE electrophoretic analysis pPIC9K-scy/hepc recombinant vectors conversion pichia spp GS115 bacterial strain.
Fig. 4 is the variation (the pH value is 6.0, and methanol concentration is 0.75%) of the target protein Scy-hepc expressing quantity of different induction times behind the SDS-PAGE electrophoretic analysis pPIC9K-scy/hepc recombinant vectors conversion pichia spp GS115 bacterial strain.
Fig. 5 is the variation (the pH value is 6.0, and methanol concentration is 1%) of the target protein Scy-hepc expressing quantity of different induction times behind the SDS-PAGE electrophoretic analysis pPIC9K-scy/hepc recombinant vectors conversion pichia spp GS115 bacterial strain.
Fig. 6 is the variation (the pH value is 5.0, and methanol concentration is 0.5%) of the target protein Scy-hepc expressing quantity of different induction times behind the SDS-PAGE electrophoretic analysis pPIC9K-scy/hepc recombinant vectors conversion pichia spp GS115 bacterial strain.
Fig. 7 is the variation (the pH value is 7.0, and methanol concentration is 0.5%) of the target protein Scy-hepc expressing quantity of different induction times behind the SDS-PAGE electrophoretic analysis pPIC9K-scy/hepc recombinant vectors conversion pichia spp GS115 bacterial strain.
Fig. 8 is the purifying of SDS-PAGE electrophoretic analysis target protein Scy-hepc expression product.In Fig. 8, M is for dye albumen Marker SM0441 (Fermentas company) in advance, and 1 is protein sample before the last column purification, and 2 for flowing out component, and 3-5 is the target protein Scy-hepc of purifying.
In Fig. 3～7, M is for dye albumen Marker SM0441 (Fermentas company) in advance; Induction time is respectively 0h, 12h, 24h, 36h, 48h.
Embodiment
Below be described with reference to the accompanying drawings technical scheme of the present invention through embodiment.
The structure of embodiment 1 pichia spp recombinant expression plasmid pPIC9K-scy/hepc
1) acquisition of Scylla paramamosain scygonadin and large yellow croaker hepcidin gene
According to MCS on the pPIC9K carrier, according to the cDNA sequence of Scylla paramamosain scygonadin (the Genbank accession number:
AY864802) and the cDNA sequence of large yellow croaker hepcidin (the Genbank accession number:
EF156401) design scygonadin and hepcdin unite the specificity upstream and downstream primer of polypeptide.Wherein the connection peptides of two tandem expression genes (linker) is that 6 aminoacid sequences are: GGPGSG, corresponding codon sequence is (according to the pichia spp codon-bias
[4,5]Carried out codon optimized): 5 ' GGTGGCCCAGGTTCCGGT3 '.
F1:5 ' GGG
GGCCAGGCACTCAACAA3 ', black italic is represented the EcoR I restriction enzyme site introduced.
Contain 6 amino acid whose connection peptides gene orders in 5 of Scylla paramamosain scygonadin gene downstream primer ' end adding:
R1:5 '
GTAAGAAGCAATCCAGT3 ', black italic is represented connection peptides.
Add the connection peptides gene order at large yellow croaker hepcidin antibacterial peptide gene upstream primer 5 ' end:
F2:5 '
CAAGGTTCTCCAGCTCG3 ', black italic is represented connection peptides.
Add Not I restriction enzyme site at large yellow croaker hepcidin antibacterial peptide gene downstream primer 5 ' end, terminator codon and 6 * His are histidine-tagged, and the codon of 6 * His is that CAC and CAT replace repetition:
R2:5 ' CAT
TCA
GAACCTGCAGCAGATACCAC3 '; Black italic is represented the Not I restriction enzyme site introduced, is 6 * His sequence in the square frame.
Above primer is synthetic by the handsome Bioisystech Co., Ltd in Shanghai.
2) be amplification template with Scylla paramamosain scygonadin cDNA and large yellow croaker hepcidin cDNA reorganization pPMD18-T positive plasmid; Be the upstream and downstream primer with F1 and R1, F2 and R2 respectively; Ex Taq enzyme (available from TaKaRa company) carries out PCR; This two kinds of target gene fragment that increase, reaction system is:
Mix, on thermal cycler, carry out the PCR reaction according to following program:
Scylla paramamosain scygonadin gene PCR program is: 94 ℃ of preparatory sex change 5min; 94 ℃ of sex change 30sec, 60 ℃ of annealing 30sec, 72 ℃ are extended 30sec; After carrying out 30 circulations, 72 ℃ are extended 7min;
Large yellow croaker hepcidin gene PCR program is: 94 ℃ of preparatory sex change 5min; 94 ℃ of sex change 30sec, 62 ℃ of annealing 30sec, 72 ℃ are extended 30sec; After carrying out 30 circulations, 72 ℃ are extended 7min;
Reaction is carried out 2% (W/V) sepharose-TAE electrophoresis with all reaction solutions after finishing, and reclaims test kit with the Qiagen gel and reclaims specific fragment, obtains Scylla paramamosain scygonadin gene PCR product length and is about 320bp (referring to Fig. 1); Large yellow croaker hepcidin gene PCR product length is about 200bp (referring to Fig. 1).
3) the segmental acquisition of scygonadin and hepcidin associating polypeptide purpose:
With step 2) in two kinds of PCR products reclaiming be template, be the upstream and downstream primer with Scylla paramamosain scygonadin upstream region of gene primers F 1 with large yellow croaker hepcidin gene downstream primer R2, with Ex Taq enzymatic amplification purpose fragment, reaction system is:
Mix, on thermal cycler, carry out the PCR reaction: 94 ℃ of preparatory sex change 5min according to following program; 94 ℃ of sex change 30sec, 60 ℃ of annealing 30sec, 72 ℃ are extended 30sec; After carrying out 30 circulations, 72 ℃ are extended 7min.
After reaction finishes; All reaction solutions are carried out 1.5% (W/V) sepharose-TAE electrophoresis; Reclaim test kit with the Qiagen gel and reclaim specific fragment; Two sections PCR products with above-mentioned amplification are template, and the primer amplification associating polypeptide Scy-hepc target gene fragment with special obtains the PCR product and is about 520bp (referring to Fig. 1).
Get the Scy-hepc target gene fragment of the above-mentioned recovery of 2 μ g, with EcoR I and Not I Restriction Enzyme double digestion, hatch 5h for 37 ℃, reaction is cut efficient with 1.5% (W/V) sepharose-TAE electrophoresis detection enzyme after finishing; The Scy-hepc target gene fragment after enzyme is cut is reclaimed in the heavy altogether agent of TaKaRa nucleic acid.Scy-hepc target gene fragment after the processing has the sticky end of EcoR I and Not I.
4) processing of pPIC9K carrier
The DH5 α bacterial strain that has pPIC9K of-80 ℃ of preservations is lined on the LB flat board of the ammonia benzyl mycin that contains 50 μ g/mL 37 ℃ of overnight cultures.Picking mono-clonal bacterium colony was inoculated in 5mL and contained in the LB liquid nutrient medium of ammonia benzyl mycin of 50 μ g/mL next day, and 37 ℃, 180rpm/min cultivates 8h to logarithmic phase, and centrifugal collection thalline extracts the pPIC9K plasmid in a small amount.
Get the pPIC9K carrier of the above-mentioned purifying of 1-2 μ g, with EcoR I and Not I Restriction Enzyme double digestion, hatch 5h for 37 ℃, it is following that enzyme is cut system; Reaction is cut efficient (referring to Fig. 2) with 0.8% (W/V) sepharose-TAE electrophoresis detection enzyme after finishing; The carrier enzyme cuts entirely, reclaims the carrier after enzyme is cut with the heavy altogether agent of nucleic acid of TaKaRa.
PPIC9K carrier after the processing has the sticky end of EcoR I and Not I.
3) structure of pPIC9K-scy/hepc carrier, conversion and evaluation
To pass through the pPIC9K carrier that has EcoR I and the sticky end of Not I after a series of processing and be connected with the gene fragment with identical sticky end Scy-hepc, reaction system is following:
16 ℃ of incubated overnight; Next day, get 5 μ L ligation liquid and be converted in the 50 μ L E.coli DH5 α competent cells, coat overnight cultures on the LB agar plate that contains ammonia benzyl mycin (50 μ g/mL).Next day, picking list bacterium colony was the upstream and downstream primer with F1 and R2, and bacterium colony PCR method is identified the positive colony bacterium, transferred to Invitrogen company and carried out dna nucleotide sequence mensuration.The result shows and connects correctly, the ORFs of Nucleotide (ORF) continuous programming code, and the aminoacid sequence that will express with expection conforms to.The characteristics of recombinant eukaryotic expression plasmid pPIC9K-scy/hepc are to adopt the AOX1 promotor, the secreting, expressing of signal peptide of yeast α-factor factor guiding target protein Scy-hepc, and have 6 * His-Tag at the C end and be convenient to the affinitive layer purification target protein.
The abduction delivering of embodiment 2pPIC9K-scy/hepc recombinant plasmid in pichia spp GS115
1) linearizing of pPIC9K-scy/hepc
The correct bacterial strain that contains expression vector that checks order is streak culture, and the picking mono-clonal shakes bacterium and cultivates, and behind the extraction plasmid, 10～20 μ g plasmids are by the linearizing of Sac I restriction enzyme, and reaction system is following:
With the pPIC9K-scy/hepc after the heavy altogether agent recovery of the nucleic acid linearizing.Again it is converted in the pichia spp GS115 competent cell with electric shocking method, and abduction delivering.
2) abduction delivering of associating polypeptide Scy-hepc
(1) abduction delivering of Scy-hepc (variations of different induction time expression amounts):
1. select the positive colony of growing on several MD flat boards and be inoculated in 6ml BMGY (pH6.0) substratum, 29 ℃, the about 18h of 230rpm shaking culture is to OD
600Reach 2.0～6.0, room temperature 1500～2000g centrifugal collecting cell.
2. equal-volume (6ml) BMMY (pH6.0) re-suspended cell, 28 ℃, 230rpm shaking culture, abduction delivering; In inducing process, every 24h replenishes methyl alcohol a to final concentration 0.5%, replenishes BMMY simultaneously the fermented liquid TV is remained unchanged.
3. respectively get the 1ml fermented liquid at cultivation 0h, 12h, 24h, 36h, 48h, 96h equi-time point, the centrifuging and taking supernatant, after albumen concentrated, polyacrylamide gel electrophoresis (SDS-PAGE) detected proteic expression.
(2) confirming of the righttest methanol induction concentration of Pichia anomala expression Scy-hepc:
The methanol induction of different concns has very big influence to proteic expression amount; When pH value 6.0; Concentration to the methyl alcohol final concentration of adjustment inductor methyl alcohol is 0.5%, 0.75% and 1%, abduction delivering 96h, and polyacrylamide gel electrophoresis (SDS-PAGE) detects proteic expression.
(3) confirming of Pichia anomala expression Scy-hepc optimal ph:
In the process of fermentation expression foreign protein, the pH value of fermented liquid has influence to the expression of foreign protein, and is particularly evident when large scale fermentation; Therefore before carrying out large scale fermentation, on the shaking table level, carry out the pH value of fermentation expression Scy-hepc and optimize, will express for the large scale fermentation of Scy-hepc call parameter is provided.Adjustment BMGY is different pH values (pH5.0,6.0 and 7.0) with the BMMY substratum, and final concentration is 0.5% methanol induction expression 48h, and polyacrylamide gel electrophoresis (SDS-PAGE) detects proteic expression.
The result shows: behind the pichia spp GS115 with the pPIC9K-scy/hepc recombinant plasmid transformed, compares behind the methanol induction with before inducing, occurs 1 protein band in about 24kDa position, and suitable with the theoretical molecular of the target protein Scy-hepc that expresses.Abduction delivering 96h under different methanol concentrations finds target protein Scy-hepc under the condition of pH6.0, and 0.75% methanol induction can obtain higher expression amount when expressing 36h, and proteic expression amount slightly reduces behind the 36h.And target protein Scy-hepc is under pH5.0,6.0 and 7.0 condition, and proteic expression amount does not have considerable change (referring to Fig. 3～7).
1) preparation of sample before the upper prop
Behind the pichia spp GS115 of pPIC9K-scy/hepc recombinant plasmid transformed, under the condition of pH6.0, after 0.75% methanol induction was expressed 36h, the centrifugal deposition of going was collected fermented supernatant fluid.4 ℃, (50mM phosphoric acid buffer+50mMNaCl, pH9.0) dialysis pichia spp abduction delivering supernatant is 2～3 times, and is centrifugal, collects supernatant, through 0.45 μ m membrane filtration, treats column purification for the PBS dialyzate.
2) affinitive layer purification target protein Scy-hepc
With nickel ion chelating affinity column affinity purification, chromatography reagent is:
Solution A: 20mM phosphoric acid buffer+50mM NaCl+10mM imidazoles, pH8.5;
Solution B: 20mM phosphoric acid buffer+500mM NaCl+1M imidazoles, pH8.5;
Clean prepacked column (HisTrap with 5～10 column volume MilliQ water
TMFF Crude 5ml), 5～10 column volume solution A balance HisTrap chromatography columns with the whole upper props of 2mL/min, are collected the supernatant after filtering simultaneously and are flowed out component; The phosphate buffered saline buffer wash-out foreign protein that contains the 20mM imidazoles; Collect elution peak with 30% solution B (containing the 300mM imidazoles) wash-out target protein Scy-hepc, take a morsel and carry out SDS-PAGE electrophoresis evaluation (referring to Fig. 8).The target protein elutriant is packed in the dialysis band of handling well, in phosphate buffered saline buffer, dialyse, dialysis is at last gone in the ultrapure water.
The result shows; The Scy-hepc albumen of the about 24kDa of molecular weight size can specificly combine with nickel ion chelating affinity column; After imidazoles solution (300mM) the competition washing of higher concentration; Fusion expressed product is by wash-out, and purity is higher, and the output of calculating pure article with the Bradford method is about 14mg/L.
3) Scy-hepc recombinant protein anti-microbial activity is identified
Protein sample through 0.22 μ m filtering membrane filtration sterilization after, Application of B radford method is measured the BSA standard substance and is obtained the protein concentration typical curve, can calculate the concentration of Scygonadin recombinant protein according to formula.With protein solution doubling dilution to 1.6～50 μ M.
The mensuration of MIC (Minimum Inhibitory Concentration, minimal inhibitory concentration) is with reference to method ([6] Bulet P, the Dimarcq J L of Bulet etc.; Hetru C, Lagueux M, Charlet M; Hegy G, Van Dorsselaer A, Hoffmann J A.A novel inducible antibacterial peptide of Drosophila carries an O-glycosylated substitution [J] .JBiol Chem.; 1993,268:14893-14897; [7] Wang K J, Cai J J, Cai L; Qu H D; Yang M, Zhang M.Cloning and expression of a hepcidin gene from a marine fish (Pseudosciaena crocea) and the antimicrobial activity of its synthetic peptide [J] .Peptides., 2009; 30 (4): 638-646), on 96 porocyte culture plates, carry out.
(1) preparation of bacteria suspension: get tested bacterium, line the nutrient broth flat board, cultivate 12～16h; 2～3 clones of picking are inoculated in the MH inclined-plane, continue to cultivate 12～16h, reach the logarithmic phase of bacterium; The MH bacterium slant culture of 10mM sodium phosphate salt damping fluid (pH7.2) flushing prepared fresh, the bacteria suspension adjustment is diluted to OD
600=0.1, get 18 μ l OD
600=0.1 bacteria suspension add the MH diluted medium that final volume is 1ml (PBS: MH=3: 2, V/V) in, this bacteria suspension is the MIC working concentration.
(2) every kind of tested bacterium is according to following operation setting blank group, negative control group and testing sample experimental group, and every group is provided with 2 parallel appearance, and every kind of bacterium is repeated 3 times:
1. positive controls: add 50 μ L sodium phosphate salt damping fluids and 50 μ L bacteria suspensions;
2. blank group: add 50 μ L testing protein samples and 50 μ L sodium phosphate salt damping fluids;
3. sample experimental group: add 50 μ L testing protein samples and 50 μ L bacteria suspensions;
(3) behind the righttest cultivation 24～48h of bacterium, observe MIC result.Get the nutrient solution of not growing bacterium more than the MIC terminal point, be inoculated on the nutrient broth flat board, the tested albumen minimum concentration of cultivating basic asepsis growth on the rear plate is this proteic MBC (Minimum Bactericidal Concentration; MBC) ([7] Wang K J; Cai J J, Cai L, Qu H D; Yang M; Zhang M.Cloning and expression of a hepcidin gene from a marine fish (Pseudosciaena crocea) and the antimicrobial activity of its synthetic peptide [J] .Peptides., 2009,30 (4): 638-646).The definition of MBC: make the lethal medicine minimum concentration of 99.9% mikrobe.
Antibacterial experiment result to 8 kinds of bacteriums shows that the antibacterial peptide Scy-hepc of eukaryotic expression has broad-spectrum antibacterial activity, and but Gram-positive and negative bacterium are all had preferably fungicidal activity (referring to table 1).
The anti-microbial activity of table 1 Scy-hepc eucaryon recombination expression product
In table 1, CGMCC No.: China Committee for Culture Collection of Microorganisms's common micro-organisms center bacterium numbering; MIC: minimal inhibitory concentration, with (a)-(b) expression, (a) maximum concentration of the visible thalli growth of expression naked eyes, (b) expression loses the Cmin of thalli growth; MBC: MBC, with (c)-(d) expression, (c) represent the maximum concentration that thalline can be grown, (d) can kill the Cmin of 99.9% thalline.
It is worth noting that the Scy-hepc of eukaryotic expression has significant anti-microbial activity (MIC1.6～3.2 μ M) to aquatic products pathogenic bacterium such as Aeromonas hydrophila, Pseudomonas fluorescens etc.The Scy-hepc of eukaryotic expression is significantly higher than anti-microbial activity (MIC7.5～60 μ M) ([2] Peng H of antibacterial peptide Scygonadin to the anti-microbial activity (MIC1.6～6.25 μ M) of identical tested bacterial strain such as Aeromonas hydrophila, micrococcus luteus, Corynebacterium glutamicum; Yang M; Huang W S, Ding J, Qu H D; Cai J J; Zhang N, Wang K J.Soluble expression and purification of a crab antimicrobial peptide scygonadin in different expression plasmids and analysis of its antimicrobial activity.Protein Expres Purif, 2010; 70:109-115); And anti-microbial activity close (1.5～12 μ M) ([3] Wang Kejian, a kind of large yellow croaker hepcidin of Cai Lingcai Jingjing antibacterial peptide and preparation method thereof Chinese patent, application number: 201010505548.3) with the large yellow croaker Hepcidin of expression and purification.But the proteic external sex change renaturation technology of the large yellow croaker Hepcidin of escherichia coli expression is comparatively complicated, is unfavorable for industrialization.
Factors such as comprehensive protein expression purifying process, anti-microbial activity; And the high stable of host bacterium pichia spp, high secretion, be beneficial to the advantages such as purifying of target protein; Think that the pPIC9K-scy/hepc carrier for expression of eukaryon is suitable for carrying out the large-scale industrialization fermentation, can be considered as the candidate expression vector of resisting pathogenic microbes new drug and animal feedstuff additive etc.
The present invention is intended to obtain the gene engineering expression product of the associating polypeptide Scy-hepc of Scylla paramamosain antibacterial peptide Scygonadin and large yellow croaker antibacterial peptide Hepcidin; And its anti-microbial activity identified, use in the hope of the novel drugs of exploitation resisting pathogenic microbes or as animal feedstuff additive.The present invention has obtained the Pichia anomala expression recon pPIC9K-scy/hepc of associating polypeptide Scy-hepc; Through the abduction delivering condition optimizing; The gene engineering product of the recombinant expressed acquisition of success Scy-hepc in pichia spp; Confirmed the broad spectrum anti-microbial activity of Scy-hepc, for its exploitation as resisting pathogenic microbes novel drugs and animal feedstuff additive is laid a good foundation.
The present invention is according to the cDNA sequence of Scylla paramamosain antibacterial peptide scygonadin and the cDNA sequence signature of large yellow croaker antibacterial peptide hepcidin; Make up recombinant eukaryotic expression plasmid pPIC9K-scy/hepc; After the Sac I linearizing; Transform pichia spp GS115 bacterial strain, abduction delivering and purifying obtain the recombinant protein of Scy-hepc, identify the recombinant protein anti-microbial activity; Discover that Scy-hepc albumen has the high-efficiency antimicrobial activity: to tested gram-positive microorganism such as micrococcus luteus, Corynebacterium glutamicum and streptococcus aureus, Gram-negative bacteria such as Aeromonas hydrophila, Pseudomonas fluorescens and Pseudomonas stutzeri etc. have obvious inhibition growth effect and germicidal action.Wherein, aquatic products pathogenic bacterium Aeromonas hydrophila and Pseudomonas fluorescens had stronger anti-microbial activity (MIC1.6～3.2 μ M).
Claims (9)
1. two kinds of marine animal antibacterial peptide genes is characterized in that comprising Scylla paramamosain antibacterial peptide scygonadin gene, connection peptides and large yellow croaker antibacterial peptide hepcidin gene; The eucaryon fusion expressed product called after Scy-hepc of said two kinds of marine animal antibacterial peptide genes.
2. two kinds of marine animal antibacterial peptide genes as claimed in claim 1 is characterized in that Scylla paramamosain negatively charged ion antibacterial peptide scygonadin gene order is:
ggccaggcac tcaacaaact tatgcctaaa atcgtcagcg ccataattta tatggtcggg 60
caacccaatg caggtgtcac ttttctgggc caccaatgtc tggtggagtc aacgaggcaa 120
ccagacgggt tttacaccgc aaagatgtcg tgtgcttcct ggactcatga taatcctatt 180
gttggggaag gaagaagccg ggttgaactt gaggcgctta aaggttccat cacaaacttt 240
gtccagacag catccaatta caagaagttc accatagatg aggtcgagga ctggattgct 300
tcttac 306。
3. two kinds of marine animal antibacterial peptide genes as claimed in claim 1 is characterized in that said large yellow croaker antibacterial peptide hepcidin gene order is:
gtcccagcca atgaagagca agagctggag cagcaaattt attttgctga tccagagatg 60
ccagtggaat catgcaagat gccgtattac atgcgtgaga atcgtcaggg cagccctgct 120
agatgcaggt tttgctgccg ttgctgtcct agaatgaggg gatgtggtat ctgctgcagg 180
ttc 183。
4. two kinds of marine animal antibacterial peptide genes as claimed in claim 1 is characterized in that the aminoacid sequence of said connection peptides is:
Gly Gly Pro Gly Ser Gly
1 5。
5. two kinds of marine animal antibacterial peptide genes as claimed in claim 1 is characterized in that the aminoacid sequence of the eucaryon fusion expressed product of said antibacterial peptide scygonadin and hepcidin gene is:
Gly Gln Ala Leu Asn Lys Leu Met Pro Lys Ile Val Ser Ala Ile Ile
1 5 10 15
Tyr Met Val Gly Gln Pro Asn Ala Gly Val Thr Phe Leu Gly His Gln
20 25 30
Cys Leu Val Glu Ser Thr Arg Gln Pro Asp Gly Phe Tyr Thr Ala Lys
35 40 45
Met Ser Cys Ala Ser Trp Thr His Asp Asn Pro Ile Val Gly Glu Gly
50 55 60
Arg Ser Arg Val Glu Leu Glu Ala Leu Lys Gly Ser Ile Thr Asn Phe
65 70 75 80
Val Gln Thr Ala Ser Asn Tyr Lys Lys Phe Thr Ile Asp Glu Val Glu
85 90 95
Asp Trp Ile Ala Ser Tyr Gly Gly Pro Gly Ser Gly Val Pro Ala Asn
100 105 110
Glu Glu Gln Glu Leu Glu Gln Gln Ile Tyr Phe Ala Asp Pro Glu Met
115 120 125
Pro Val Glu Ser Cys Lys Met Pro Tyr Tyr Met Arg Glu Asn Arg Gln
130 135 140
Gly Ser Pro Ala Arg Cys Arg Phe Cys Cys Arg Cys Cys Pro Arg Met
145 150 155 160
Arg Gly Cys Gly Ile Cys Cys Arg Phe
165。
6. the preparation method of the eucaryon fusion expressed product of two kinds of marine animal antibacterial peptide genes as claimed in claim 1 is characterized in that may further comprise the steps:
1) difference pcr amplification Scylla paramamosain antibacterial peptide scygonadin gene and large yellow croaker antibacterial peptide hepcidin gene, overlapping PCR method obtains the target gene fragment of associating polypeptide Scy-hepc;
2) the fusion gene Scy-hepc with the step 1) gained imports expression vector, makes up the recombinant expression vector that carries fusion gene Scy-hepc;
3) with step 2) recombinant expression vector of gained changes host cell over to, and host cell is carried out abduction delivering, obtain expression product;
4) purification procedures 3) expression product of gained, obtain recombinant protein, promptly unite polypeptide Scy-hepc.
7. the preparation method of the eucaryon fusion expressed product of two kinds of marine animal antibacterial peptide genes as claimed in claim 6 is characterized in that in step 2) in, said expression vector is selected pPIC9K for use.
8. the preparation method of the eucaryon fusion expressed product of two kinds of marine animal antibacterial peptide genes as claimed in claim 6 is characterized in that in step 3), and said host cell is a pichia spp GS115 bacterial strain.
9. the preparation method of the eucaryon fusion expressed product of two kinds of marine animal antibacterial peptide genes as claimed in claim 6; It is characterized in that in step 4) the method for said separation and purification is: elder generation carries out recombination expression product centrifugal, collects fermented supernatant fluid; After the dialysis, carry out affinity chromatography again.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201110250681 CN102304536B (en) | 2011-08-29 | 2011-08-29 | Eukaryotic fused expression product of two marine animal antibacterial peptide genes, and preparation method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201110250681 CN102304536B (en) | 2011-08-29 | 2011-08-29 | Eukaryotic fused expression product of two marine animal antibacterial peptide genes, and preparation method thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102304536A true CN102304536A (en) | 2012-01-04 |
| CN102304536B CN102304536B (en) | 2013-04-17 |
Family
ID=45378452
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 201110250681 Active CN102304536B (en) | 2011-08-29 | 2011-08-29 | Eukaryotic fused expression product of two marine animal antibacterial peptide genes, and preparation method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102304536B (en) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103467580A (en) * | 2013-09-18 | 2013-12-25 | 刘诚 | Preparation method and application of artificial antimicrobial peptide MA-D4 |
| CN103773772A (en) * | 2013-12-17 | 2014-05-07 | 大连海洋大学 | Preparation method for recombinant fugu rubripes antimicrobial peptide Defb-1 protein |
| CN104151414A (en) * | 2014-08-20 | 2014-11-19 | 厦门大学 | Preparation method of green mud crab antibacterial peptide SpHyastatin and application thereof |
| CN111574610A (en) * | 2020-06-08 | 2020-08-25 | 宁德市富发水产有限公司 | Pseudosciaena crocea antibacterial peptide piscidin 5-like type4 and preparation method and application thereof |
| CN113813368A (en) * | 2021-10-21 | 2021-12-21 | 厦门海嘉成生物科技有限公司 | Application of antibacterial peptide in preparation of anti-grass carp reovirus medicine |
| CN114957430A (en) * | 2022-06-09 | 2022-08-30 | 厦门大学 | Scylla paramamosain antibacterial polypeptide Sparepcin 173-194 And uses thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101906165A (en) * | 2010-07-09 | 2010-12-08 | 厦门大学 | Expression product in series of two fish antibacterial peptide genes and expression method thereof |
| CN102061303A (en) * | 2010-11-26 | 2011-05-18 | 厦门大学 | Fusion expression product of antimicrobial peptide genes of two marine animals and preparation method of fusion expression product |
-
2011
- 2011-08-29 CN CN 201110250681 patent/CN102304536B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101906165A (en) * | 2010-07-09 | 2010-12-08 | 厦门大学 | Expression product in series of two fish antibacterial peptide genes and expression method thereof |
| CN102061303A (en) * | 2010-11-26 | 2011-05-18 | 厦门大学 | Fusion expression product of antimicrobial peptide genes of two marine animals and preparation method of fusion expression product |
Non-Patent Citations (5)
| Title |
|---|
| 《Genbank》 20061204 Wang,K.J.等 AY864802.1 第1页 1-9 , * |
| 《Protein Expression and Purification》 20090918 Hui Peng等 Soluble expression and purification of a crab antimicrobial peptide scygonadin in different expression plasmids and analysis of its antimicrobial activity 109-115 1-9 第70卷, * |
| 《厦门大学学报(自然科学版)》 20091231 蔡晶晶等 黑鲷抗茵肽hepcidin在毕赤酵母中的表达及其抗菌活性 738-743 6-9 第48卷, 第5期 * |
| 《厦门大学学报(自然科学版)》 20110331 王克坚 海洋鱼类和青蟹抗菌肽hepcidin和scygonadin的研究 418-424 1-9 第50卷, 第2期 * |
| 《饲料工业》 20091231 唐勇 抗菌肽基因表达系统研究进展 13-16 1-9 第30卷, 第7期 * |
Cited By (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103467580A (en) * | 2013-09-18 | 2013-12-25 | 刘诚 | Preparation method and application of artificial antimicrobial peptide MA-D4 |
| CN103467580B (en) * | 2013-09-18 | 2015-07-08 | 刘诚 | Preparation method and application of artificial antimicrobial peptide MA-D4 |
| CN103773772A (en) * | 2013-12-17 | 2014-05-07 | 大连海洋大学 | Preparation method for recombinant fugu rubripes antimicrobial peptide Defb-1 protein |
| CN104151414A (en) * | 2014-08-20 | 2014-11-19 | 厦门大学 | Preparation method of green mud crab antibacterial peptide SpHyastatin and application thereof |
| CN104151414B (en) * | 2014-08-20 | 2017-06-20 | 厦门大学 | The preparation method of Scylla paramamosain antibacterial peptide SpHyastatin and application |
| CN111574610A (en) * | 2020-06-08 | 2020-08-25 | 宁德市富发水产有限公司 | Pseudosciaena crocea antibacterial peptide piscidin 5-like type4 and preparation method and application thereof |
| CN111574610B (en) * | 2020-06-08 | 2023-05-02 | 宁德市富发水产有限公司 | Large yellow croaker antibacterial peptide piscidin 5-like type 4 and preparation method and application thereof |
| CN113813368A (en) * | 2021-10-21 | 2021-12-21 | 厦门海嘉成生物科技有限公司 | Application of antibacterial peptide in preparation of anti-grass carp reovirus medicine |
| CN113813368B (en) * | 2021-10-21 | 2023-11-21 | 厦门海嘉成生物科技有限公司 | Application of antibacterial peptide in preparation of grass carp reovirus resistant drugs |
| CN114957430A (en) * | 2022-06-09 | 2022-08-30 | 厦门大学 | Scylla paramamosain antibacterial polypeptide Sparepcin 173-194 And uses thereof |
| CN114957430B (en) * | 2022-06-09 | 2023-12-12 | 厦门大学 | Scylla paramamosain antibacterial polypeptide Sparepcin 173-194 And applications thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102304536B (en) | 2013-04-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102304536B (en) | Eukaryotic fused expression product of two marine animal antibacterial peptide genes, and preparation method thereof | |
| CN102304516B (en) | Pichia pastoris expression product of scygonadin and preparation method thereof | |
| CN111205359B (en) | Scyreproxcin as antibacterial peptide of scylla paramamosain and application thereof | |
| CN111019001B (en) | Recombinant lysozyme antibacterial peptide fusion protein and preparation method and application thereof | |
| CN101845454B (en) | Method for expressing pseudoplectania nigrella mature peptide in recombinant pichia pastoris | |
| CN104151414A (en) | Preparation method of green mud crab antibacterial peptide SpHyastatin and application thereof | |
| CN104341497B (en) | A kind of Novel pig derived antimicrobial peptide mutant and its preparation method and application | |
| CN103789317A (en) | Scylla paramamosain antibacterial peptide hyastatin gene clone, encoding protein recombination and application | |
| CN105219779B (en) | Red claw crayfish coagulogen and preparation method and application | |
| CN101906165A (en) | Expression product in series of two fish antibacterial peptide genes and expression method thereof | |
| CN113201059B (en) | Dichocrocis punctiferalis active antibacterial peptide, gene, recombinant vector and application thereof | |
| CN111349177A (en) | Preparation method and application of fusion antibacterial peptide CAT | |
| CN111004317A (en) | Canine recombinant interferon α 7, and preparation method and application thereof | |
| CN106366172A (en) | Bigeminal peptide Cec Md2ys, preparation method and application | |
| CN1936000A (en) | Fennero penaeus chinensis antibacterial protein gene and recombinant expression and use | |
| CN104356222B (en) | Mutant of one boar derived antimicrobial peptide PR 39 and its preparation method and application | |
| CN102061303B (en) | Fusion expression product of antimicrobial peptide genes of two marine animals and preparation method of fusion expression product | |
| CN111187765B (en) | Ruminant rumen specific lysozyme LYZ1 and application thereof | |
| CN113912691B (en) | Recombinant crassostrea gigas high mobility group protein r-CgHMGB1, preparation method and application thereof | |
| CN105753958B (en) | A kind of Novel fish derived antimicrobial peptide mutant and its preparation method and application | |
| CN101705231A (en) | Apis cerana royal jelly antibacterial peptide AccRoyalisin gene and encoded polypeptide thereof and application thereof | |
| CN104447976A (en) | Swine-derived antibacterial peptide cecropin P1 mutant as well as preparation method and application of swine-derived antibacterial peptide cecropin P1 mutant | |
| CN102080079B (en) | Preparation method and application of novel antimicrobial peptide Misgurin mutant | |
| CN109021112B (en) | Heterozygous antibacterial peptide PO-CH34 and its preparation method and application | |
| CN101851280B (en) | Plectasin mature polypeptide dimer fusion protein and preparation method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |