CN113201059B - Dichocrocis punctiferalis active antibacterial peptide, gene, recombinant vector and application thereof - Google Patents

Abstract

The invention belongs to the field of genetic engineering, relates to an antibacterial peptide, and particularly relates to an antibacterial peptide with dichocrocis punctiferalis activity, and a gene, a recombinant vector and application thereof. The amino acid sequence of the dichocrocis punctiferalis active antibacterial peptide is shown in SEQ ID No. 1. The method has an inhibiting effect on pathogenic fusarium graminearum-S, fusarium graminearum-J, bipolaris zeae, helminthosporium carbonum, curvularia lunata, fusarium verticillata and umbilicaria rostratus of important fungal diseases on corn, the average inhibiting rate is 11.12% -25.65%, wherein the inhibiting effect on the bipolaris carbonum and umbilicaria rostratum is strongest.

Description

Dichocrocis punctiferalis active antibacterial peptide, gene, recombinant vector and application thereof

Technical Field

The invention belongs to the field of genetic engineering, relates to an antibacterial peptide, and particularly relates to an active antibacterial peptide of dichocrocis punctiferalis, a gene, a recombinant vector and an application thereof.

Background

Antimicrobial peptides (AMPs) are immune products produced by animals for resisting invasion of foreign pathogens, are mainly polypeptides or small-molecule proteins with antibacterial activity, and are widely present in various organisms in the nature. The first antimicrobial peptides were isolated from insect lymph and frog epidermis, and nowadays, antimicrobial peptides have been isolated from various species including human, mammals, insects, amphibians, plants, bacteria and fungi. The source of the antibacterial peptide is wide, and the antibacterial peptide can be divided into 4 types according to the difference of the structure and the function of the antibacterial peptide, namely cecropin, defensin, proline-rich and glycine-rich. The action mechanism is quite complex, a plurality of related researches exist at home and abroad, and the action mechanisms of the antibacterial peptide are considered to be mainly 3: acting on cell walls, on cell membranes and on intracellular targets. The synthesis speed of the antibacterial peptide is very high, when organisms are invaded by unknown objects, the antibacterial peptide can be rapidly synthesized to kill invaders for the first time, and the antibacterial peptide is an important component of a plurality of innate non-specific defense systems of organisms, so the antibacterial peptide is the first natural immune defense line of the organisms.

The antibacterial peptide generally consists of 20-60 amino acids, has the relative molecular mass of 2-7kDa, usually exists in a cation form, and not only has the functions of inhibiting and killing various microorganisms, but also has a certain function in regulating the immune response of organisms. Has the characteristics of wide antibacterial spectrum, strong basicity, thermal stability, unique action mechanism, difficult generation of drug resistance and the like. Therefore, the antibacterial peptide has wide prospects and values in the aspects of development, research and application in the fields of agriculture, medical treatment, livestock raising, food, health care products and the like.

Insects are used as the group with the most species and the most quantity in the animal kingdom, and a large amount of precious antibacterial peptide resources are contained in the insects to be urgently developed. The application takes the important pest dichocrocis punctiferalis in agriculture and forestry production as an object, researches the antibacterial peptide resource with activity in the body and the bacteriostatic potential of the antibacterial peptide resource on important fungal diseases of corn, changes the pest into treasure, and more clearly defines the application potential of the insect antibacterial peptide in the prevention and control of plant diseases.

Disclosure of Invention

The invention provides a dichocrocis punctiferalis active antibacterial peptide, a gene, a recombinant vector and application thereof, which take the dichocrocis punctiferalis which is an important pest in agriculture and forestry production at present as an object, and research the antibacterial peptide resource with activity in vivo and the antibacterial potential of the dichocrocis punctiferalis on important fungal diseases of corn, so that the pest is changed into treasure, and the application potential of the insect antibacterial peptide in the prevention and control of plant diseases is more definite.

The technical scheme of the invention is realized as follows:

an amino acid sequence of the dichocrocis punctiferalis active antibacterial peptide is shown in SEQ ID No. 1.

The gene of the said dichocrocis punctiferalis active antibacterial peptide.

The sequence of the gene is shown as SEQ ID NO. 2.

A recombinant vector containing the gene.

The recombinant vector has pET32a (+), and the host is Escherichia coli Rosetta-gamiB (DE 3).

The preparation method of the recombinant vector comprises the following steps:

(1) the gene according to claim 2 involving the primer pairs CPAlo-13768-F and CPAlo-13768-R;

(2) performing PCR amplification by using cDNA of dichocrocis punctiferalis as a template and the primer pair in the step (1) as a primer;

(3) and (3) recovering the amplification product in the step (2), and transforming the amplification product into an escherichia coli competent cell to prepare the recombinant vector.

The sequences of the primer pair CPallo-13768-F and CPallo-13768-R are respectively shown as SEQ ID NO.3 and SEQ ID NO. 4.

The antibacterial peptide prepared by the recombinant vector.

The application of the antibacterial peptide in preparing biological pesticides for inhibiting corn fungal diseases.

The fungus is one or more of pathogen fusarium graminearum-S, fusarium graminearum-J, cornia umbilicalis, carbon color helminthosporium, curvularia lunata, fusarium verticillioides or umbilicaria mellea.

The invention has the following beneficial effects:

1. the present inventors have found a novel antibacterial peptide, antibacterial peptideCPAlo-13768Has a signal peptide sequence, a theoretical molecular weight of 6.37kDa, an isoelectric point of 8.29, is a hydrophobic stable protein, and has 3 beta turns in the secondary structure and 3 intramolecular disulfide bonds formed by 6 conserved cysteine residues. The gene expressing the antibacterial peptideCPAlo- 13768No similar sequences were found in GenBank, indicatingCPAlo-13768Is, modification of the geneProvides excellent gene material for high-efficiency expression in various exogenous gene expression systems.

2. The antibacterial peptide has an inhibiting effect on pathogenic substances of important fungal diseases on corn, namely fusarium graminearum-S, fusarium graminearum-J, bipolaris maydis, carbon color helminthosporium, curvularia, pseudoverticillium orbicularis and umbilicaria oris, the average inhibiting rate is 11.12% -25.65%, wherein the inhibiting effect on carbon color helminthosporium and umbilicaria oris is strongest, and the inhibiting rates are 24.12% and 25.65% respectively; the inhibition rate of the artificially synthesized polypeptide on 7 fungi is 4.59-45.13%, wherein 13768-1 and 13768-3 have good inhibition effect on C.thaliana Hemsl, the inhibition rates are 43.44% and 45.13% respectively, 13768-2 have good inhibition effect on curvularia and C.thaliana Hemsl, and the inhibition rates are 39.62% and 38.55% respectively. As a novel antibacterial peptide, the antibacterial peptide has wide application value in the aspect of preventing and treating agricultural diseases.

3. The application takes the important pest dichocrocis punctiferalis in agriculture and forestry production as an object, researches the antibacterial peptide resource with activity in the body and the bacteriostatic potential of the antibacterial peptide resource on important fungal diseases of corn, changes the pest into treasure, and more clearly defines the application potential of the insect antibacterial peptide in the prevention and control of plant diseases.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the embodiments or the prior art descriptions will be briefly described below, it is obvious that the drawings in the following description are only some embodiments of the present invention, and other drawings can be obtained by those skilled in the art without creative efforts.

FIG. 1 is a drawing ofCPAlo-13768Nucleotide to amino acid mapping of the gene.

FIG. 2 is a multiple alignment of CPalo-13768 amino acid sequences.

FIG. 3 is a phylogenetic tree of CPalo-13768 amino acid sequences.

FIG. 4 shows the hydropathicity of CPalo-13768 protein.

FIG. 5 shows the CPalo-13768 protein signal peptide prediction.

FIG. 6 shows the transmembrane structure of CPalo-13768 protein.

FIG. 7 shows the secondary structure of CPalo-13768 protein.

FIG. 8 shows the alignment of CPalo-13768 and antifungal peptide Alo-3 amino acid sequences.

FIG. 9 shows the tertiary structure of CPalo-13768 protein.

FIG. 10 shows the activity of the antimicrobial peptide CPalo-13768 of the present invention against Fusarium graminearum (F.graminearum-S) in control group (A) and treatment group (B).

FIG. 11 shows the activity of the antimicrobial peptide CPalo-13768 of the present invention against corn stalk rot pathogen (Fusarium graminearum-J), control group (A), treatment group (B).

FIG. 12 shows the activity of the antimicrobial peptide CPalo-13768 of the present invention against corn leaf spot pathogen (Helminthosporium maydis), control group (A), and treatment group (B).

FIG. 13 shows the activity test of the antimicrobial peptide CPalo-13768 of the present invention against Pantoea zeae (Helminthosporus carbonarius), control group (A), and treatment group (B).

FIG. 14 shows the activity of the antimicrobial peptide CPalo-13768 of the present invention against Curvularia lunata Blume (Curvularia lunata Blume), control group (A), and treatment group (B).

FIG. 15 shows the activity of the antimicrobial peptide CPalo-13768 of the present invention against maize cob rot (Fusarium verticillioides), control group (A), treatment group (B).

FIG. 16 shows the activity of the antibacterial peptide CPalo-13768 of the present invention against corn leaf spot pathogen (umbilicaria fumosorosea), control group (A), treatment group (B).

Detailed Description

Experimental reagents and materials

1. Vectors and host cells: the vector pET32a (+) was purchased from Biotech, Inc., of the Beijing Wash ocean, Rosetta-gamiB (DE 3) competent cells from Sangon Biotech, Shanghai.

2. Enzymes and necessary biochemical reagents: EcoRI and Hind III endonucleases were purchased from Takara, T4 ligase was purchased from Promega, the reverse transcription kit was purchased from Beijing TIANGEN, the SanPrep column plasmid DNA miniprep and the SanPrep column PCR product purification kit were purchased from Shanghai Sangon Biotech, and the cell culture related reagents were purchased from Beijing Solarbio.

3. The pathogenic bacteria to be tested comprise corn ear rot fungiFusarium gminearum(Fusarium graminearum-S) and corn stalk rotFusarium moniliforme(Fusarium graminearum-J), Sclerotinia zeaeBipolaris maydis(Helminthosporium maydis) and corn orbicularis maydisHelminthosporium carbonum(Helminthosporium carbonum) and Curvularia zeae LeptosporiumCurvularia lunata(Curvularia lunata) and corn ear rot fungiFusarium verticillioidesFusarium verticillium and corn leaf spotExserohilum rostratum(umbilicaria citrifolia), the strain used was provided by the plant pathology department of the plant protection institute of the university of south river, the teacher Yuanhong and the teacher Zhangang.

4. Culture medium: coli LB medium (1% peptone, 0.5% yeast extract, 1% NaCl); fungus PDA culture medium (peeled potato 200 g, cut into small pieces, boiled with distilled water to soften, filtered with 4 layers of gauze, added with glucose 20 g and agar 18 g, stirred, mixed well, distilled water to constant volume of 1L, sterilized at 121 deg.C for 20 min for use).

Description of the drawings: the molecular biological experiments, which are not specifically described in the following examples, were performed according to the methods specified in molecular cloning, a manual of experiments (fourth edition) m.r. green and j. sambrook, or according to kits and product instructions.

The technical solutions of the present invention will be described clearly and completely with reference to the following embodiments of the present invention, and it should be understood that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be obtained by a person skilled in the art without inventive effort based on the embodiments of the present invention, are within the scope of the present invention.

Example 1: cloning and sequence analysis of antibacterial peptide coding gene

Extracting the total RNA of the borer larva and performing reverse transcription to obtain cDNA. Designing and synthesizing PCR primer according to cDNA sequence of dichocrocis punctiferalis antibacterial peptide CPallo-13768 obtained by transcriptome sequencing screeningCPAlo-13768-F is shown in SEQ ID NO. 3: TGAAATTCAACCTGATCATCCT andCPAlo-13768-R is as shown in SEQ ID NO. 4: TTAACGACAGTAACCGGCGA, PCR amplification is carried out using cDNA of dichocrocis punctiferalis as a template.

The PCR reaction parameters are as follows: 2min at 98 ℃; 10sec at 98 ℃, 10sec at 58 ℃, 10s at 72 ℃ for 30 cycles; 5min at 72 ℃. Agarose electrophoresis detection to obtain a fragment between 100-250bp, purification and recovery, connection with pClone007 cloning vector, transformation into Escherichia coli DH5 alpha competent cell, and sending to sequencing after positive detection to obtain cloned fragmentCPAlo-13768A gene sequence.

According to the sequencing result, the sequence alignment is carried out in NCBI by using Blast (https:// blast.ncbi.nlm.nih.gov/blast.cgi), and the open reading frame sequence possibly existing in the NCBI is searched by the ORF finder online tool analysis of NCBI. The gene fragment is preliminarily judged to be an antibacterial peptide fragment, and similarity study of the fragment is carried out. The length of the gene fragment is 180bp, the nucleotide and amino acid map is shown in figure 1, the amino acid sequence andAcrocinus longimanusthe sequence identity of the derived antimicrobial peptide Alo-2 was up to 91.18%.

Will find outCPAlo-13768The nucleotide sequence and the amino acid sequence of the protein encoded by it were subjected to the corresponding Blast analysis in NCBI, respectively.CPAlo-13768As a result of Blastn search of the nucleotide sequence, no similar sequence was found. The results of the Blastp analysis (Table 1) show that at the protein level, 29 similar sequences from 13 species are shared, among which the amino acid sequence of CPalo-13768 is identical to that of longibrachial longicorn (Calf.) (Tak.)Acrocinuslongimanus) The amino acid sequence of the antimicrobial peptide Alo-2 (P83652.1) has the highest similarity, and the similarity is 91.18%.

TABLE 1 summary of the results of the NCBI Blastp amino acid sequence of CPALLO-13768

Using BioEdit software, the dichocrocis punctiferalisCPAlo-13768Multiple alignment of amino acid sequences with the amino acid sequences of 29 genes of other insects in Table 1, using MeGa 7.0 softwareAnd (4) constructing a phylogenetic tree by a neighbor method. As can be seen from the result of amino acid sequence multiple alignment (FIG. 2), the amino acid sequence of the dichocrocis punctiferalis antibacterial peptide CPallo-13768 has high similarity with the antibacterial peptide sequences of other species, and the amino acid sequence thereof contains the typical characteristics of insect defensin antibacterial peptides, namely 6 conserved cysteines (Cys), forming 3 intramolecular disulfide bonds; it was found from the phylogenetic tree of amino acid sequences (FIG. 3) that the amino acid sequence of CPalo-13768 has the closest relationship to the amino acid sequence of long-armed cecron Alo-1 (P83651.1). The gene was named in combination with the previous Blastp analysis and sequence alignmentCPAlo- 13768And uploaded to the NCBI GenBank database under accession No. MW 133083.

CPallo-13768 amino acid sequence was analyzed for physicochemical properties and hydropathic properties by the ExPASY-ProtParam tool and ProtScale on-line tool, the basic properties and amino acid composition are shown in tables 2 and 3, and the hydropathic and hydrophobic properties are shown in FIG. 4. The result shows that the predicted molecular weight of the dichocrocis punctiferalis CPallo-13768 protein is about 6.37 kDa; the theoretical isoelectric point PI =8.29, is a basic protein; an instability index of 36.13, below threshold 40, indicating that it is a stable protein; the content of cysteine (Cys) and glycine (Gly) in the amino acid composition is the same and most abundant, and both account for 10.2 percent of the total amount. In the hydropathic/hydrophobic assay, alanine (Ala) at position 10 with a maximum value of 3.756 and glycine (Gly) at position 32 with a minimum value of-2.433, and an overall average hydrophilicity value GRAVY =0.320, indicating that the protein is a hydrophobic protein (positive values of GRAVY are hydrophobic and negative values are hydrophilic).

TABLE 2 summary of basic Properties of CPALO-13678 protein

TABLE 3 summary of amino acid composition of CPALO-13678 protein

Signal peptide analysis: the signal peptide sequence generally refers to a region of RNA encoding a hydrophobic amino acid sequence located after the initiation codon, which functions to direct newly synthesized proteins into subcellular organelles containing different membrane structures in cells (Waxuefan et al, 2006). The signal peptide analysis of CPalo-13768 amino acid sequence by SignaiP 5.0 shows that the protein of dichocrocis punctiferalis CPalo-13768 has a peak value at 25 th amino acid, which indicates that the sequence contains a signal peptide sequence and the shearing site is between 25-26 amino acids; therefore, the first 25 amino acids were determined to be the signal peptide sequence, and the antimicrobial peptide protein was presumed to be a secreted protein (FIG. 5).

Transmembrane domain and subcellular localization analysis: analysis of the transmembrane structure and subcellular localization of CPallo-13768 amino acid sequence using the online tools TMHMM servers v 2.0 and PredictProtein revealed (FIG. 6) the presence of a transmembrane structure in CPallo-13768 amino acid sequence, with red lines indicating the transmembrane region; subcellular localization predicts the localization of the protein extracellularly in eukaryotes. In combination with the foregoing signal peptide analysis, it can be further determined that the protein is a secreted protein that functions outside the somatic cells of the worm.

And (3) secondary structure prediction: the secondary structure analysis of CPalo-13768 protein using the on-line tool SOPMA showed that random coil (c) was 42.37%, alpha helix (h) was 40.68% and all was the signal peptide sequence region, and beta turn (t) and extension (e) were 10.17% and 6.78%, respectively, in CPalo-13768 protein secondary structure (FIG. 7).

Modeling a three-level structure: the tertiary structure of the protein is a specific spatial structure which is formed on the basis of the secondary structure, the super-secondary structure or the structural domain of the protein, is further coiled and folded, and is fixed by depending on the maintenance of a secondary bond. Selecting the most similar MODEL from the existing MODELs by using the homologous modeling method of SWISS-MODEL (S-MODEL), namely a long-arm longicorn beetle: (A)Acrocinuslongimanus) The structure of the obtained novel antifungal peptide Alo-3 is used as a template to generate a homologous tertiary structure. From FIG. 8, it can be seen that CPalo-13768 and antifungal peptide Alo-3 (P83653.1) have a sequence identity of 85.29% with CPalo-13768 protein by on-line software SWISS-MODELModeling was performed (FIG. 9), and as a result, it was found that the CPalo-13768 protein is a monomeric structure.

Example 2: antibacterial peptide geneCPAlo-13768Expression of

According to the results of sequencing and sequence analysis, removing the signal peptide part in the sequence and designing primers by using EcoRI and HindIII as enzyme cutting sitesCPAlo-13768-F1 is shown in SEQ ID NO. 5: CCGGAATTCTGCATCAAGAACCG andCPAlo- 13768-R1 is as shown in SEQ ID No. 6: CCCAAGCTTTTAACGACAGTAACCGG, PCR amplification is carried out by taking dichocrocis punctiferalis cDNA as a template. After purification and recovery, plasmid pET32a (+) and the gene fragment were subjected to double digestion (EcoRI and Hind III), and then ligated to form recombinant vector pET32a-CPAlo-13768The recombinant vector pET32a-CPAlo-13768E.coli DH 5. alpha. competent cells were transformed. After positive recombinants are identified, sequencing is carried out, and recombinant plasmids of strains with correct sequencing are extracted and transferred into escherichia coli Rosetta-gamiB (DE 3) competent cells. And inducing protein expression by the culture solution, and purifying and measuring the concentration of the protein.

Example 3: detection of bacteriostatic activity of antibacterial peptide

And (3) detecting the antibacterial activity: the target strains for detecting antibacterial activity are Fusarium graminearum-S, Fusarium graminearum-J, Helminthosporium maydis, Helminthosporium carbonum, curvularia lunata, Fusarium verticillarum and Hibiscus umbilicatus, and the results are shown in FIG. 10-FIG. 16,

the specific detection method comprises the following steps: (1) and (3) selecting activated pathogenic bacteria hypha, respectively and independently inoculating the hypha to a PDA flat plate, and carrying out inverted culture at 26 ℃ for about 10 days until the hypha grows over the whole flat plate.

(2) The purified CPalo-13768 recombinant protein solution and the artificially synthesized polypeptide were prepared into a 0.5 mg/mL solution using sterile water.

(3) And (3) taking 100 mu L of the solution prepared in the step (2) from a clean bench, uniformly coating the solution on a PDA (personal digital assistant) plate prepared in advance, coating the same amount of sterile water on a control group, and standing for about 30 min until the solution is completely absorbed.

(4) And (2) beating a bacterial cake on the pathogenic bacteria flat plate cultured in the step (1) by using an aseptic puncher with the diameter of 6 mm, inoculating the bacterial cake on the PDA flat plate cultured in the step (3), inversely culturing at 26 ℃ for several days (intermittently observing the growth condition of bacterial colonies during the culture), measuring and recording the diameter of a bacterial ring, and calculating the bacteriostasis rate according to the following formula.

The bacteriostasis rate = (the growth radius of the hypha of a control group-the growth radius of the hypha of a treatment group)/the growth radius of the hypha of the control group is multiplied by 100 percent.

As can be seen from the test results (table 4): the CPallo-13768 recombinant protein has good inhibitory effect on the 7 fungi.

TABLE 4 inhibition of 7 pathogenic fungi in maize by CPAllo-13768 recombinant protein

The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention, and any modifications, equivalents, improvements and the like that fall within the spirit and principle of the present invention are intended to be included therein.

<110> Henan university of agriculture

<120> dichocrocis punctiferalis active antibacterial peptide, gene, recombinant vector and application thereof

<141> 2021-06-08

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 59

<212> PRT

<213> Dichocrocis punctiferalis Guenée

<400> 1

Met Lys Phe Asn Leu Ile Ile Leu Val Ala Val Phe Leu Val Ala Ala

1 5 10 15

Met Ile Met Pro Thr Gln Val Leu Ala Cys Ile Lys Asn Arg Asp Gly

20 25 30

Cys Gln Pro Asp Gly Ser Gln Gly Asn Cys Cys Ser Gly Asn Cys His

35 40 45

Lys Glu Pro Gly Trp Val Ala Gly Tyr Cys Arg

50 55

<210> 2

<211> 180

<212> DNA

<213> Dichocrocis punctiferalis Guenée

<400> 2

atgaaattca acctgatcat cctcgtcgct gtcttcctgg tggctgccat gatcatgccg 60

acccaagtgc tggcgtgcat caagaaccgc gacgggtgcc agcctgatgg aagccagggc 120

aactgctgct ccgggaattg ccacaaggag ccgggatggg tcgccggtta ctgtcgttaa 180

<210> 3

<211> 22

<212> DNA

<213> Unknown (Unknown)

<400> 3

tgaaattcaa cctgatcatc ct 22

<210> 4

<211> 20

<212> DNA

<213> Unknown (Unknown)

<400> 4

ttaacgacag taaccggcga 20

<210> 5

<211> 23

<212> DNA

<213> Unknown (Unknown)

<400> 5

ccggaattct gcatcaagaa ccg 23

<210> 6

<211> 26

<212> DNA

<213> Unknown (Unknown)

<400> 6

cccaagcttt taacgacagt aaccgg 26

Claims (2)

1. The application of the dichocrocis punctiferalis active antibacterial peptide in preparing biological pesticide for inhibiting corn fungal diseases is characterized in that: the amino acid sequence of the dichocrocis punctiferalis active antibacterial peptide is shown in SEQ ID No. 1.

2. Use according to claim 1, characterized in that: the fungus is one or more of pathogenic substances of fusarium graminearum-S, fusarium graminearum-J, corncob helminthosporium, C-color helminthosporium, curvularia lunata, fusarium verticillioides or umbilicaria funiculorum.

Images