CN101063103B

CN101063103B - Hainan sporic scorpion antibiotic and preparation method and application

Info

Publication number: CN101063103B
Application number: CN200710051966A
Authority: CN
Inventors: 曹志贱; 李文鑫; 吴英亮; 马一保; 戴潮
Original assignee: Wuhan University WHU
Current assignee: Wuhan University WHU
Priority date: 2007-04-26
Filing date: 2007-04-26
Publication date: 2010-05-19
Anticipated expiration: 2027-04-26
Also published as: CN101063103A

Abstract

The invention discloses a preparing method of HaiNan speckle equal scorpion antibiotic peptide gene and appliance, which comprises the following steps: restructuring bacillus coli Escherichia coli DH5a/ImAMP1, CCTCC NO: M207034; constructing HaiNan speckle equal scorpion ioterium cell cDNA library; designing primer; choosing PCR method; sieving positive colony of scorpion antibiotic peptide gene from ioterium cDNA library; sequence-analyzing coding trait of antibiotic peptide gene; assuring amino acid sequence of the antibiotic peptide gene; adopting chemosynthesis antibiotic peptide; possessing inhibition of diverse density for Gram's bacterium. This peptide can be used to medicine to prevent and cure Gram's bacterium.

Description

A kind of Hainan sporic scorpion antibiotic and preparation method and application

Technical field

The invention belongs to biological technical field, the present invention relates to a kind of Hainan sporic scorpion poison antibacterial peptide, also relate to the preparation method of this antibacterial peptide gene, also relate to the purposes of this gene simultaneously, the molecular designing of high reactivity antibacterial peptide and antibacterial are identified.Specifically, the present invention relates to a kind of isolation identification of Hainan sporic scorpion antibiotic gene; The antimicrobial spectrum that relates to a kind of scorpion antibiotic is identified: the Hainan sporic scorpion poison antibacterial peptide that adopts the chemosynthesis means to produce has resistance of wide spectrum to gram-positive microorganism, and Gram-negative bacteria does not have effect; It is effective to clinical isolating resistance staphylococcus haemolyticus to relate to scorpion antibiotic; The high reactivity molecular designing and the antibacterial that also relate to a kind of scorpion antibiotic are identified: the scorpion antibiotic of molecular designing has not only improved the fungistatic effect to gram-positive microorganism, and Gram-negative bacteria also had resistance, have the value of potential antibacterials exploitation.

Background technology

The antibiotic resistance problem has become the focus that the whole world is paid close attention to.China is the comparatively serious country of abuse of antibiotics in the world, and the microbial hospital infection number of resistance has accounted for about 30 percent of HOI patient total number of persons.Another harm of resistant organism is to propagate between the crowd between different areas, the country.Streptococcus pneumoniae is the common pathogeny bacterium that causes bacterial pneumonia, and streptococcus pneumoniae is in rising trend to antibiotic resistance in recent years, and multiple antibiotic resistant strain occurs, is a thorny difficult problem in the clinical infection control.

Studies show that in a large number maybe may cause at bacteria infection under the situation of courses of infection (bacterial injection or fungi, body wall damage etc.), insect can be synthesized a large amount of antibacterial peptides fast, kills the germ of having invaded rapidly, and stop germ continue infect.Up to the present, in insect, found a large amount of antibacterium peptides, anti-fungus peptide, and not only antimycotic but also antibacterial antibacterial peptide.These antibacterial peptides not only have the broad-spectrum antimicrobial ability to bacterium, fungi, and virus, protozoon and cancer cells are also had effect.In addition, also have the mechanism of action uniqueness, to characteristics such as the higher animal normal cell are harmless, facing under the exceedingly difficult situation of the new microbiotic of resistance and screening, insect antimicrobial peptide may become antibiotic new source.

Scorpion is a kind of traditional rare Chinese medicine of China, just puts down in writing the medicinal history of scorpion before more than 2000 year.Ming Dynasty's Compendium of Material Medica more write up scorpion cures mainly multiple diseases such as " all urticarias, apoplexy, hemiplegia, facial hemiparalysis, language are puckery, brothers take out sincere; the pediatric epilepsy scared tetany ", have antitumor, desinsection, antibacterial and antibiotic effect, its effect is mainly derived from scorpion tail poison gland excretory venom.To be a class have a multiple bioactive micromolecule polypeptide by what 10-100 amino acid was formed to the main component of venom, they can selectivity, the membranin on the specific and cytolemma interacts, thereby change cell to the penetrating ability of ionic, regulate various kinds of cell metabolic process and various physiological processes such as emiocytosis, hormonal action and signal transduction such as cell volume, pH, membrane potential, excitability.According to estimates, there are 100000 kinds of different biologically active peptidess to be present in the various scorpion venom glands approximately.Therefore, scorpion toxin has important theoretical research meaning and application and development value.

There is experimental study to show to buthus martensii Karscs, the scorpio ethanol extraction all has restraining effect external to 8 kinds of shallow pathomycetes of table, especially comparatively responsive to Fonsecaea pedrosor, middle Ke Shi sporothrix, trichophyton gypseum, acrothesium floccosum, its antifungic action is better than the garlic leach liquor.Ceng Xianchun etc. have been separated to an antibacterial peptide gene BmKn2 from China's buthus martensii Karscs poison gland, find that this scorpion venom peptide has the function of Chinese People's Anti-Japanese Military and Political College enterobacteria, subtilis (Zeng X C, Wang S X, Zhu Y, Zhu S Y, Li W X.Identification andfunctional characterization of novel scorpion venom peptides with nodisulfide bridge from Buthus martensii Karsch.Peptides, 2004,25:143-150.), the ImAMP that the present invention obtains ₁It is isolating one new gene from Hainan sporic scorpion poison gland.Simultaneously, the patent that relates to the Hainan sporic scorpion toxin gene does not at present also have, and the patent that relates to buthus martensii Karscs poison gland toxin gene only has 7: the 1. application of buthus martensii Karscs toxin BmKAS in pharmacy, this invention relates to the application of buthus martensii Karscs toxin BmKAS in the anti-periphery injury of preparation medicine, and the application of buthus martensii Karscs toxin BmKAS in the anti-hyperalgesic of preparation; 2. a kind of recombinant baculovirus that contains divalent insect-resistant gene, this invention relates to buthus martensii Karscs insect-specific neurotoxin gene BmKIT and a kind of chitinase genes of insects (Chi), obtains to contain the recombinant baculovirus AcNPV-BmKIT-Chi of divalent insect-resistant gene; 3. arrhythmia-resistant scorpion peptide recombined colibacillus and construction process thereof, this invention has related to a kind of BmKIM BmKIM gene recombined escherichia coli, is used for the recombinant peptide that mass production is solvable, have antiarrhythmic activity; 4. BmKIM and its production and application, this disclosure of the Invention a kind of BmKIM BmKIM and its production and application, the resulting reorganization of the present invention BmKIM polypeptide has efficient antiarrhythmic activity, and solubility is good, the output height; 5. a kind of scorpion chloride channel neurotoxin gene-rBmKCTa of synthetic, this patent relates to chloride channel neurotoxin BmKCT gene, the rBmK CTa of the improvement of employing genetically engineered gained is inhibited to neurogliocyte, can be used for preparing by suppressing the medicine of the treatable disease of neurogliocyte; 6. a kind of purposes of transitional scorpion toxin BmK abT, the purposes of the transitional scorpion toxin BmK abT that the invention discloses, it can be used as the sodium channel modulator of a uniqueness, the research sodium channel is formed, the probe of 26S Proteasome Structure and Function, can regulate and treat the modulator and the medicine of sodium channel relative disease, can prepare and regulate or treat hyperkalemic paralysis, congenital myotonia and other skeletal muscle disease, the long QT of the 3rd the class modulator or the medicine of disease (LQT3), primary ventricular fibrillation and other heart diseases at interval; 7. a kind of recombinant scorpion toxin and solubility expression and purification process, this invention relate to a kind of recombinant scorpion toxin rBmKIT and solubility expression and purification process.

Although 1. 2. 3. 4. 5. 6. 7. patent all be content about the buthus martensii Karscs toxin, and employed scorpion is a Hainan sporic scorpion among the present invention, the ImKAMP1 gene that the scorpion toxin gene BmKAS that patent relates to, BmKIT, BmKIM, BmKCT, BmKabT and the present invention obtain is diverse toxin gene, and 1. 2. 3. 4. 5. 6. 7. patented invention all do not relate to the antibacterial of scorpion toxin.

Summary of the invention

The objective of the invention is to be to provide a kind of Hainan sporic scorpion antibiotic gene, have antibacterial.

Another object of the present invention also is to provide a kind of Hainan sporic scorpion scorpion venom antibacterial peptide, and antibacterial effect is good.

A further object of the present invention is the method that is to provide a kind of Hainan sporic scorpion antibiotic of preparation, and easy to implement the method, simple to operate, the mutant of preparation has improved antibacterial effect.

A further object of the present invention is to be to provide the application of a kind of Hainan sporic scorpion antibiotic in the medicine of preparation treatment or prevention gram-bacteria.

To achieve these goals, the present invention adopts following technical measures: 1. made up a high quality Hainan sporic scorpion poison gland tissue cDNA library, at first got the poison gland of Hainan sporic scorpion; Next is to extract total RNA, and purified mRNA; The 3rd is the reverse transcription synthetic double chain cDNA; The 4th is that double-stranded cDNA (adopts T with being connected of carrier pSPORT1 ₄Dna ligase); The 5th is the electricity conversion of recombinant molecule; The 6th is to obtain the poison gland cell cdna library; 2. based on the first step poison gland tissue cDNA library, the method by PCR has screened a clone sub-A165 (numbering), and sequential analysis is a kind of antibacterial peptide gene, called after ImAMP ₁, this bacterium is preserved in Chinese typical culture collection center, address: China. and Wuhan. Wuhan University, preservation date: on April 3rd, 2007, deposit number: CCTCC NO:M207034, classification name: bacillus coli DH 5 alpha/ImAMP ₁(Escherichia coli DH5 α/ImAMP ₁); 3. adopt the method (synthetic) of chemosynthesis, obtained scorpion venom antibacterial peptide ImAMP by Shanghai section peptide bio tech ltd ₁, antibacterial tests result shows, ImAMP ₁Gram positive bacterium bacillus thuringiensis (minimal inhibitory concentration MIC is 25 μ g/ml), subtilis (MIC is 50 μ g/ml), streptococcus aureus (MIC is 25 μ g/ml) are had the restraining effect of different concns, and invalid to gram negative bacterium intestinal bacteria (100 μ g/ml do not have effect) and Pseudomonas aeruginosa (100 μ g/ml do not have effect).This scorpion venom antibacterial peptide ImAMP ₁Gram positive bacterium had specificity; 4. molecular designing ImAMP ₁Mutant ImAMP ₁-M, antibacterial tests shows, the mutant ImAMP of this scorpion venom antibacterial peptide ₁-M has improved to gram-positive microorganism (subtilis MIC is 25 μ g/ml and is 5 μ g/ml to streptococcus aureus MIC) with to the resistance of Gram-negative bacteria (intestinal bacteria MIC is 12.5 μ g/ml and is 100 μ g/ml to Pseudomonas aeruginosa MIC); 5. ImAMP ₁And ImAMP ₁-M can have resistance effect (ImAMP to the isolating resistance staphylococcus haemolyticus in maternity ﹠ child care center, Hubei Province ₁MIC be 25 μ g/ml, and ImAMP ₁The MIC of-M is 5 μ g/ml).So scorpion venom antibacterial peptide ImAMP ₁Value with potential antibacterials exploitation.

The objective of the invention is to be to provide a kind of method that makes up high quality Hainan sporic scorpion poison gland tissue cDNA library, the toxin gene fraction of coverage reaches more than 95%.Make up the technological line such as the Fig. 1 in high quality Hainan sporic scorpion poison gland tissue cDNA library.Comprise and buy Hainan sporic scorpion 48h after electric shock is got poison, its poison gland is used for the separation (Fig. 2) of total RNA; The scorpion tail gland of getting 500mg is ground into fine powder in liquid nitrogen, by the total RNA of scorpion venom gland of Trizol method preparation; The total RNA of the scorpion venom gland of preparation adopts denaturing formaldehyde its quality of detected through gel electrophoresis (Fig. 3).

Be 2mg by the total RNA amount of the scorpion venom gland of method for preparing, adopt PolyA Tract mRNA separation system (available from U.S. Promega) to separate and purified mRNA.The scorpion venom gland mRNA that ultraviolet spectrophotometer is measured its acquisition measures about 10 μ g.With 5 μ gmRNA as initial amount, first chain and second chain that carry out cDNA are synthetic, continue being connected of double-stranded cDNA and SalI adapter, NotI digests double-stranded cDNA, excessive SalI adapter and the enzyme removed in the double-stranded cDNA molecule are cut small segment, double-stranded cDNA is connected and conversion with pSPORT1 carrier (available from American I nvitrogen), and it is 1.0*10 that the result has obtained an abundance ⁷Individual clone's/μ gcDNA.The positive insertion rate in the scorpion venom gland cDNA library that makes up reaches that (Fig. 4: 17/17), the toxin gene fraction of coverage of Hainan sporic scorpion reaches more than 95% more than 95%.

Another object of the present invention also is to provide a kind of the screening from Hainan sporic scorpion poison gland cDNA library to obtain antibacterial peptide gene.Design a specific primer 5 '-gatcattgccaagcatt-3 ' according to BmKb1, adopt the PCR strategy from the cDNA library, to screen the purpose toxin gene in conjunction with the downstream universal primer.Its strategy is seen Fig. 5.The bacterium liquid 800 μ l that 5ng cDNA are connected the product conversion with 25ng pSPORT1 carrier evenly coat 10 LB/Ap ⁺Dull and stereotyped (every plate 80 μ l bacterium liquid), 37 ℃ of overnight incubation, each flat board approximately contains the bacterium colony (clone's) about 500, and it is seeded to the LB/Ap that contains 950 μ l with toothpick one by one ⁺The 1.5ml Ep pipe (and numbering in order) of plate culture medium, 37 ℃ of 280rpm joltings are spent the night, and take out 100 μ ls as preparation pcr template from every pipe next day, then every pipe added 150 μ l glycerine ,-20 ℃ or-70 ℃ of preservations.In each flat board, add 800 μ l LB/Ap simultaneously ⁺(every liter contains Tryptones 10g to liquid nutrient medium, yeast extract 5g, NaCl 10g, pH value to 7.4, penicillin 100 μ g/ml), bacterium colony is scraped, divide the 1.5ml Ep pipe of packing into the aseptic inoculation ring, 37 ℃ cultivate a few hours after, prepare plasmid with boiling method ,-20 ℃ of preservations are as pcr template.Library screening divides three rounds, and the first run time is used from the mixing plasmids of 10 dull and stereotyped preparations and made template, carries out 10 pipe PCR, and 10 pipes (50 clones of every pipe) that after the electrophoresis detection 500 clones of positive pipe correspondence are divided into carry out 10 pipe PCR.The third round screening just can obtain needed purpose clone by 50 pipe PCR.Send company's order-checking with positive colony.The result shows that A165 clone is a new Hainan sporic scorpion antibiotic gene, called after ImAMP ₁A kind of isolating gene, its sequence are the nucleotide sequence shown in the SEQ ID NO:1.

Another object of the present invention also is to provide a kind of Hainan sporic scorpion scorpion venom antibacterial peptide.ImAMP ₁74 amino-acid residues of prosoma organization form coding, by three the part form, promptly signal peptide (22 residues), mature peptide (17 residues) and precursor peptide (35 residues) are seen Fig. 6.Based on the processing rule of scorpion toxin precursor C-terminal residue, ImAMP ₁Terminal last residue Lys is excised by specificity carboxypeptidase (Carboxypeptidase), and by amidated.Therefore, the invention provides a Hainan sporic scorpion scorpion venom antibacterial peptide, a kind of separation or synthetic protein, its sequence is the aminoacid sequence shown in the SEQ ID NO:2.

Another object of the present invention provides the scorpion antibiotic of a kind of specific effect in gram positive bacterium, can be used as the antibacterials exploitation.By the way of chemosynthesis, obtained purity and reached more than 95%, and with natural antibacterial peptide ImAMP ₁The synthetic polypeptide of consensus amino acid sequence (mass spectroscopy molecular weight and HPLC purity assay) (Fig. 7).The anti-bacterial result shows that gram positive bacterium bacillus thuringiensis, subtilis (Fig. 8), streptococcus aureus (Fig. 9) are had the restraining effect of different concns, and invalid to gram negative bacterium intestinal bacteria (Figure 10) and Pseudomonas aeruginosa (Figure 11), ask for an interview following table 1.This scorpion venom antibacterial peptide ImAMP ₁Medicine has specificity to gram positive bacterium, has similar antibacterial effect with penbritin.And ImAMP ₁Medicine can have resistance effect (Figure 12) to resistance staphylococcus haemolyticus (a strain staphylococcus haemolyticus of Hubei Province clinical laboratory of healthcare hospital for women ﹠ children acute isolation is through being accredited as cephalosporin analog antibiotic tolerance MRCNS, numbering 1538).

Table 1: scorpion venom antibacterial peptide ImAMP ₁The fungistatic effect of medicine

ImAMP ₁Medicine is 25 μ g/ml, the MIC of subtilis is 50 μ g/ml, is 25 μ g/ml to the MIC of streptococcus aureus the minimal inhibitory concentration MIC of gram positive bacterium bacillus thuringiensis.And ImAMP ₁Medicine is 25 μ g/ml to the MIC of the isolating resistance staphylococcus haemolyticus in maternity ﹠ child care center, Hubei Province (tolerance erythromycin).But ImAMP ₁When drug level reaches 100 μ g/ml, still invalid to Gram-negative bacteria intestinal bacteria and Pseudomonas aeruginosa.

A further object of the present invention provides a kind of mutant scorpion venom antibacterial peptide.According to ImAMP ₁Mature peptide sequence (SEQ ID NO:2), and utilize software AHTHEPROT 2000 ( Ftp: //ftp.ibcp.fr/pub/ Antheprot/Windows/anthe_5_0.exe) show its secondary structure image.The result shows, ImAMP ₁Have typically amphipathic (amphiphilic) α-Helix structure, contain a large amount of hydrophobic residue (Phe and Pro etc.) (Figure 13).ImAMP ₁Iso-electric point (pHi) calculation result is 8.75, meets this feature of polyvalent cation antibacterial peptide.Based on ImAMP ₁α-Helix the structure of mature peptide aminoacid sequence (SEQ ID NO:2), amphipathic and iso-electric point adopts point mutation with ImAMP ₁The 3rd Gly of mature peptide aminoacid sequence (SEQ ID NO:2) becomes Arg, and the 6th Pro becomes Lys, and the 10th Gly becomes Lys and the 11st Gly becomes Arg.Its mutant scorpion venom antibacterial peptide ImAMP ₁The amino acid of-M, a kind of separation or synthetic protein, its sequence is the aminoacid sequence shown in the SEQ ID NO:3.Antibacterial tests result shows, the mutant ImAMP of chemosynthesis ₁-M has not only improved the fungistatic effect to gram-positive microorganism, and Gram-negative bacteria has also been had resistance, asks for an interview following table 2, has enlarged antimicrobial spectrum.In addition, ImAMP ₁-M medicine still has resistance (Figure 14) to the resistance staphylococcus haemolyticus.

Table 2: mutant ImAMP ₁The fungistatic effect of-M medicine

Mutant scorpion venom antibacterial peptide ImAMP ₁-M is 25 μ g/ml, the MIC of subtilis is 25 μ g/ml, is 5 μ g/ml to the MIC of streptococcus aureus the minimal inhibitory concentration MIC of gram positive bacterium bacillus thuringiensis.ImAMP ₁-M is 12.5 μ g/ml, is 100 μ g/ml to the MIC of Pseudomonas aeruginosa the colibacillary MIC of Gram-negative bacteria.Mutant ImAMP ₁-M and wild-type ImAMP ₁Compare, its resistance to gram positive bacterium and Gram-negative bacteria strengthens greatly.And ImAMP ₁-M medicine is 5 μ g/ml to the MIC of the isolating resistance staphylococcus haemolyticus in maternity ﹠ child care center, Hubei Province (tolerance erythromycin), than its wild-type ImAMP ₁MIC25 μ g/ml improved 5 times.

The scorpion venom antibacterial peptide gene ImAMP that the present invention obtains ₁Being isolating first scorpion venom peptide gene from Hainan sporic scorpion poison gland, also is simultaneously first antibacterial peptide gene of identifying from Hainan sporic scorpion poison gland.And, synthetic wild-type ImAMP ₁With mutant ImAMP ₁-M is effective to the isolating resistance staphylococcus haemolyticus of hospital.

Description of drawings

Fig. 1 Hainan sporic scorpion poison gland cell cdna library makes up synoptic diagram.

1. get the poison gland of Hainan sporic scorpion; 2. extract total RNA, and purified mRNA; 3. reverse transcription synthetic double chain cDNA;

4. double-stranded cDNA is connected with carrier pSPORT1's; 5. the electricity of recombinant molecule transforms; 6. obtain poison gland cell cDRA library.

Fig. 2 takes from the scorpion and the poison gland thereof such as spot in Hainan.

The denaturing formaldehyde electrophoresis of the total RNA of Fig. 3 Hainan sporic scorpion poison gland.

1: the total RNA of scorpion venom gland.

Fig. 4 PCR detects library quality electrophorogram.

M: standard DNA molecular weight Mark; 1-16: 16 of random choose different clone's from the library.

The strategy in Fig. 5 PCR screening cDNA library.

Fig. 6 Hainan sporic scorpion scorpion venom antibacterial peptide ImAMP ₁Gene and amino acid thereof.

The corresponding amino sequence of cDNA sequence below for inferring; Signal peptide amino acid is with single underscore mark; Mature peptide amino acid is with the black matrix mark; The square frame partial amino-acid is the carboxypeptidase recognition site; Dash area amino acid is C end precursor peptide; Two line parts are the PolyA tailing signal

Fig. 7 chemosynthesis Hainan sporic scorpion antibiotic ImAMP ₁With its mutant ImAMP ₁The HPLC purity of-M and mass spectrum molecular weight identification figure.

A:ImAMP ₁Wild-type HPLC purity is identified figure; B:ImAMP ₁Wild-type mass spectrum molecular weight identification figure; C:ImAMP ₁Mutant HPLC purity is identified figure; D:ImAMP ₁Mutant mass spectrum molecular weight identification figure.

Fig. 8 ImAMP ₁Medicine is to the restraining effect of subtilis.

Negative control is 1%BSA; Positive control is 50 μ g/ml penbritins; Antibacterial peptide ImAMP ₁Drug level is 10 μ g/ml and 100 μ g/ml.

Fig. 9 ImAMP ₁Medicine is to aureus with inhibition.

Figure 10 ImAMP ₁Medicine is to colibacillary restraining effect.

Negative control is 1%BSA; Positive control is 20 μ g/ml kantlex; Antibacterial peptide ImAMP ₁Drug level is 10 μ g/ml and 100 μ g/ml.

Figure 11 ImAMP ₁Medicine is to the restraining effect of Pseudomonas aeruginosa.

Figure 12 Hainan sporic scorpion antibiotic ImAMP ₁And mutant ImAMP ₁Helix wheel figure and the PREDICTION FOR THE ISOELECTRIC POINT of-M.

A:ImAMP ₁The helix wheel figure of wild-type; B ImAMP ₁The helix wheel figure of-M mutant.

Figure 13 wild-type ImAMP ₁Medicine is to the resistance effect of resistance staphylococcus haemolyticus.

Positive control is 30 μ g vancomycins; The resistance microbiotic is 15 μ g erythromycin; Wild-type antibacterial peptide ImAMP ₁Medicine is 50 μ g; Negative control is 1%BSA.

Figure 14 mutant ImAMP ₁-M medicine is to the resistance effect of resistance staphylococcus haemolyticus.

Positive control is 30 μ g vancomycins; The resistance microbiotic is 15 μ g erythromycin; Mutant antibacterial peptide ImAMP ₁-M medicine is 50 μ g; Negative control is 1%BSA.

Embodiment

The following examples can make those skilled in the art more fully understand the present invention, but do not limit the present invention in any way.

Embodiment 1: the extraction of the total RNA of scorpion venom gland (Trizol LS single stage method)

1. the scorpion tail gland of getting 500mg is ground into fine powder in liquid nitrogen, add 10ml TRIZOL reagent (available from beautiful Invitrogen) mixing, and room temperature (20-25 ℃, below identical) was placed 5 minutes; 2. add the 2ml chloroform then and mixed 15 seconds, room temperature was placed 2-3 minute, centrifugal 15 minutes of 4 ℃ of following 12000g; 3. the 1 times of volume Virahol of addition of fetching water, room temperature was placed 10 minutes, centrifugal 10 minutes of 4 ℃ of following 12000g the RNA precipitation; 4. precipitate and use 5m175% washing with alcohol, centrifugal 5 minutes of 7500g; 5. be dissolved in DEPC-treatedwater after the RNA precipitation drying, 55-60 ℃ is incubated 10 minutes with thorough dissolving RNA.Whole process is carried out with reference to TR1ZOL (Total RNAIsolation) Reagent Kit recommend method.The total RNA of the scorpion venom gland of preparation adopts its quality of denaturing formaldehyde detected through gel electrophoresis.

The separation and purification of embodiment 2:mRNA

Adopt PolyA Tract mRNA separation system (Promega, USA) separation and purified mRNA, its principle of work is based on the complementary pairing characteristic of Oligo (dT) and mRNA 3 ' end poly (A) tail, with biotin labeling Oligo (dT), hold the annealing of poly (A) to form crossbred by it and mRNA 3 ', catch and wash vitamin H Oligo (dT)/mRNA crossbred with the magnetic bead and the magnetic separation rack that indicate the affinity element then, use the ddH of no RNA enzyme at last ₂O elutes it, reaches the purpose of separating mRNA from total RNA.1. the preparation of sample: RNA is joined among the GTC of the 800 μ l that contain 32 μ l beta-mercaptoethanols.2. the annealing of probe: get 250pM concentration Oligo (dT) 5 μ l, adding distil water to 50 μ l; The dilution buffer (dilution buffer has added 32 μ l beta-mercaptoethanols) that adds the 1.6ml preheating, with the RNA mixing, 70 ℃ of incubations 5 minutes.3. the activation of magnetic bead: the magnetic bead SA-PMPS (available from beautiful Promega) that gets 1.2ml is in the centrifuge tube of 1.5ml; With the resuspended SA-PMPS of 0.5 * SSC, with magnet stand absorption magnetic bead, original volume 0.5 * SSC washing SA-PMPS3 time.4. obtaining of mRNA: the RNA of 70 ℃ of incubations is mixed with SA-PMPS, and room temperature is placed to put in 5 minutes and is adsorbed magnetic bead on the magnet stand, abandons supernatant liquor; The 0.5XSSC suspension magnetic bead of 2ml, washing repeats 2 times, removes SSC for the last time as far as possible; The ddH that adds no RNA enzyme ₂O to magnetic bead, mixing gently, centrifugal then (12000g * 3 minute) or magnet stand absorption magnetic bead; Get supernatant, obtain mRNA.Concentration and purity by electrophoresis and ultraviolet determination mRNA.5. the precipitation of mRNA: add the dehydrated alcohol of glycogen and 2.5 times of volumes among the mRNA that will 4. obtain, precipitation is spent the night, and mRNA will be used for the synthetic of cDNA.

3: the first chain cDNA of embodiment are synthetic

1. add 2 μ l Not I Primer-adapter and 6 μ l mRNA (containing 3 μ g mRNA) in 1.5ml Ep pipe, 70 ℃ of incubation 10min are put in rapidly on ice, simple centrifugal after, add following ingredients: 4 μ l 5X first strand buffer; 2 μ l 0.1M DTT; 1 μ l 10mM dNTPs; 1 μ l DEPCH ₂O.Simply centrifugal behind the mixing gently, put to 2min for 37 ℃; 2. add 5 μ l reversed transcriptive enzymes, get 2 μ l behind the mixing, add 1 μ l[α- ³²P] dCTP (4 μ Ci) (spike pipe).With above-mentioned reactive component (sample hose) while 37 ℃ of incubation 1h, put into termination reaction on ice then; 3. for the spike pipe, add 43 μ l 20mM EDTA and 5 μ l yeast tRNA successively, behind the mixing, get respectively two part 10 μ l o'clock on two filter membranes, wash 3 times each 5min for 1 part with 10%TCA, 95% ethanol is washed 1 time, and after the dry air, putting into the 1.5ml scintillation solution (is 1 ^#Sample); After other 1 part of dry air, putting into the 1.5ml scintillation solution (is 2 ^#Sample).30 μ l traced fluids add 1.5 μ l 7.5M NH in addition ₄OAc and 90 μ l dehydrated alcohols (20 ℃), behind the mixing immediately 14, the centrifugal 20min of 000rpm abandons supernatant, add 0.5ml 70% dehydrated alcohol (20 ℃), 14, the centrifugal 2min of 000rpm abandons supernatant, 37 ℃ of dry 10min allow ethanol volatilize, be dissolved in 10 μ l TEN solution, add 10 μ l 2X sample loading buffers, get 10 μ l and be used for alkaline gel electrophoresis.With [α- ³²P] dCTP mark λ DNA HindII fragment makes molecular weight marker; 4. place 15min under the room temperature behind the mixing, add 2 μ l 0.2M EDTA termination reactions.Get 6 μ l reaction solutions and 6ml 2X alkalescence electrophoretic buffer mixing, behind the electrophoresis 5h, soak 20min, until the bromjophenol blue flavescence with 7%TCA.Blot (about 8h) with toilet paper then, carry out radioautograph; 5. for sample hose, be used for the synthetic of second chain.

Hind?III?10X?buffer 2μl

dGTP 0.2mM

dATP 0.2mM

[α- ³²P]dCTP 2μCi

Hind?III?markers 1μg

Klenow?DNA?polymerase 2unit

Add?ddH ₂O?to?final?volume?of 20μl

4: the second chain cDNA of embodiment are synthetic

1. on ice in sample hose successively according to the form below add following ingredients; 2. gently behind the mixing, 16 ℃ of incubation 2h; 3. add 2 μ l (10units) T4DNA polysaccharases, continue 16 ℃ of reaction 5min; 4. change on ice, add 10 μ l 0.5M EDTA; 5. add equal-volume (150 μ l) phenol/chloroform/primary isoamyl alcohol (25/24/1), thoroughly behind the vortex, under the room temperature 14, the centrifugal 5min of 000rpm.Change water (140 μ l) over to another 1.5ml Ep pipe; 6. add 1/2 volume (70 μ l) 7.5M NH ₄OAc and 0.5ML dehydrated alcohol (20 ℃), behind the vortex, under the room temperature 14, the centrifugal 20min of 000rpm; 7. abandon supernatant, add 0.5ml 70% ethanol (20 ℃), the same centrifugal 2min.Abandon supernatant, 37 ℃ of dry 10min.

DEPC-treated?water 92μl

5X?second?strand?buffer 30μl

10mM?dNTP?mix 3μl

E.coli?DNA?ligase(10units/μl) 1μl

E.coli?DNA?polymerase(10units/μl) 4μl

E.coli?RNase?H(2units/μl) 1μl

Final?Volume 150μl

Embodiment 5: double-stranded cDNA is connected with Sal I adapter

1. the ddH that handles with 25 μ l_DEPC ₂The cDNA sample of O dissolving embodiment 4, according to the form below adds successively then; 2. mixing gently, 16 ℃ of reactions spend the night (about 20h).3. use (25/24/1) extracting of phenol/chloroform/primary isoamyl alcohol and NH ₄Behind the Oac/ ethanol sedimentation, 37 ℃ of dry 10min.

5X?T4DNA?ligase?buffer 10μl

Sal?I?adapters 10μl

T ₄DNA?ligase 5μl

Final?Volume 50μl

Embodiment 6:Not I digests double-stranded cDNA

1. the sample with embodiment 5 is dissolved in 41 μ l, and according to the form below adds successively then; 2. behind the mixing, 37 ℃ of incubation 2h; 3. use phenol/chloroform/primary isoamyl alcohol (25/24/1) extracting once, use 7.5M NH then ₄The Oac/ ethanol sedimentation, 37 ℃ of dry 10min.4. be dissolved in 70 μ l TEN, get 1 μ l and be used for quantitatively, all the other-20 ℃ of preservations are standby.

REACT?3?buffer 5μl

Not?I 4μl

Final?Volume 50μl

Embodiment 7: excessive Sal I adapter and the enzyme removed in the double-stranded cDNA molecule are cut small segment

(Amersham USA) removes excessive Sal I adapter and enzyme and cuts small segment with nucleon extraction and purification kit.1. room temperature low suspension resin is got 600 μ l then and is added in the centrifugal post, and the centrifugal 10s of 2000rpm removes liquid.Central authorities add the above-mentioned cDNA solution of 40 μ l at resin.The same centrifugal; 2. collect elutriant and be used for ligation.

Embodiment 8: double-stranded cDNA is connected and conversion with the pSPORT1 carrier

1. in 1.5ml Ep pipe successively according to the form below add composition; 2. react 16h under the room temperature; 3. in the foregoing description 7, add following ingredients successively: 5.0 μ l yeast tRNA, 12.5 μ l 7.5M NH4Oac, 70

μ l dehydrated alcohol (20 ℃).14000 centrifugal 20min immediately behind the vortex mixing; 4. precipitation is dissolved in 4 μ l with 70% ethanol (20 ℃) washing after 37 ℃ of dryings; 5. get 2 μ l electric shock and transform 50 μ l E.coli K12MC1061.

5X?T ₄?DNA?ligase?buffer 4μl

pSPORT1，NotI-SalI-Cut(50ng/μl) 1μl

cDNA(3ng/μl) 4μl

T ₄DNA?ligase 1μl

Add?ddH ₂O?to?final?volume 20μl

Embodiment 9: the preliminary evaluation of poison gland cell cdna library

Identify the quality in library with PCR method, forward primer: 5 '-TCGACCCACGCGTCCG-3 ' (pressing SalI adapter sequences Design); Reverse primer: 5 '-GAGCGGCCGCCT15-3 ' (pressing the sequences Design of NotI primer-adapter).

Embodiment 10:PCR primer design

Precursor nucleotide sequence based on scorpion toxin BmKb1: agaatattcgaaactcggccaagatggaaataaagtatcttcttaccgtcttctta gtcctgctaatagtgtcc tctgttttctctaataccatcagccatcagcgggctcatcagcgcttttaaaggaagaaggaaaagagatttgaatggctatatagaccacttcaagaattttagaaaacgtgatgccgaattggaagaattactttctaaactaccaatttattaacttctttacgtactacagtcgttagtctctcttccggtcgtttcctaatataaattaaaaattataaactgttggtgaaattaataaatattttttcttaaatataaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa。Design specific forward primer FP1:5 '-GATCATTGCCAAGCATT-3 '.Reverse primer RP1:5 '-GAGCGGCCGCCT15-3 ' is according to building the sequences Design of synthesizing the first chain cDNA primer that the storehouse test kit provides.

Embodiment 11:PCR Policy Filtering cDNA library

Adopt the method for PCR that the Hainan sporic scorpion poison gland cell cdna library that makes up among the embodiment 8 is screened, its screening strategy sees that Fig. 5 and concrete operations step are as follows: 1. get cDNA scorpion venom storehouse 800 μ l and evenly coat 10 LB/AP ⁺Flat board, 37 ℃ of overnight incubation; 2. each flat board approximately contains the single bacterium colony about 500, and it is seeded to the LB/AP of 600 μ l one by one with toothpick ⁺In the liquid nutrient medium, 37 ℃ of overnight incubation; 3. get 50 μ l and boiled 1 minute, with the preparation pcr template; 4. add 300 μ l60% aseptic glycerine-20 ℃ preservations in all the other bacterium solution; 5. simultaneously, in each flat board, add 500 μ lLB/AP ⁺Solution scrapes bacterium colony with the aseptic inoculation ring, divides the 1.5mlEp pipe of packing into, cultivates after 6 hours for 37 ℃, gets 100 μ l and boils 1 minute, and preparation becomes pcr template; 6. at first use each dull and stereotyped mixed bacterium solution as pcr template, carry out pcr amplification with PCR primers F P1 and RP1, the PCR reaction conditions: 94 ℃ of pre-sex change 5 minutes, 94 ℃ of sex change 1 minute, 50 ℃ of annealing 1 minute, 72 ℃ were extended 1 minute, last 72 ℃ were extended 5 minutes, and circulated 35 times.Screen again expanding the flat board that about 200bp band, promptly get the bacterium solution 10 μ l of each the single bacterium colony in this flat board, carry out the PCR reaction again after per 50 pipes mix, pairing 50 bacterium of the pipe that positive signal is arranged are carried out the PCR reaction again through the PCR reaction.The mono-clonal bacterium solution of the 200bpPCR amplified band of having an appointment is delivered company's order-checking.The result shows that A165 clone is a new antibacterial peptide gene, called after ImAMP ₁A kind of isolated polypeptide gene, its sequence are the nucleotide sequence shown in the SEQ ID NO:1.

Embodiment 12:DNA order-checking and Computer Analysis

Positive clone uses ABI PRISM by PCR screening preliminary evaluation ^TMAutomatic dna sequencer (the big genome company of Beijing China) checks order.Homology comparison and signal peptide cutting site forecasting software be respectively CLUSTAL X 1.8 (Thompson et al., 1997) and PC/GENE (Intelligenetics Inc., Switzerland).

Embodiment 13: chemosynthesis scorpion venom antibacterial peptide ImAMP ₁

ImAMP ₁74 amino-acid residues of prosoma organization form coding, form by three parts, i.e. signal peptide (22 residues), mature peptide (17 residues) and precursor peptide (35 residues), as shown in Figure 6.Based on the processing rule of scorpion toxin precursor C-terminal residue, ImAMP ₁Terminal last residue Lys is excised by specificity carboxypeptidase (Carboxypeptidase), and by amidated.Therefore, adopt the way of chemosynthesis to obtain highly purified scorpion venom antibacterial peptide: a kind of synthetic protein, its sequence are the aminoacid sequence shown in the SEQ ID NO:2.

Embodiment 14: scorpion venom peptide ImAMP ₁Medicine is to the inhibition test of gram-positive microorganism and Gram-negative bacteria

Gram-positive microorganism bacillus thuringiensis (CCTCC:AB92037), subtilis (CCTCC:AB91021), streptococcus aureus (CCTCC:AB94004) and Gram-negative bacteria intestinal bacteria (CCTCC:AB94012), Pseudomonas aeruginosa (CCTCC:AB93066) are all available from China typical culture collection center.

96 orifice plate culture methods: 1. respectively gram-positive microorganism bacillus thuringiensis (CCTCC:AB92037), subtilis (CCTCC:AB91021), streptococcus aureus (CCTCC:AB94004) and Gram-negative bacteria intestinal bacteria (CCTCC:AB94012), Pseudomonas aeruginosa (CCTCC:AB93066) are cultivated OD ₆₀₀=0.8 o'clock, get 80 μ l after diluting 400 times and join in 96 orifice plates, add the ImAMP of 20 μ l to porous respectively then through proportional diluted ₁, reaching final concentration is 100 μ g/ml, 10 μ g/ml, 1 μ g/ml, 0.1 μ g/ml.Negative control and positive control hole add kantlex (Gram-negative bacteria: final concentration is 20 μ g/ml) or the penicillin (gram-positive microorganism: final concentration is 50 μ g/ml) of 20 μ l 1%BSA and 20 μ l respectively; 2. cultivate after 12 hours for 37 ℃, survey the light absorption value at 600nM wavelength place in each hole in 96 orifice plates with microplate reader; 3. determine medicine ImAMP ₁The minimum inhibitory concentration of 10 times of dilutions after, minimum inhibitory concentration is carried out 2 times of proportional diluted, the preceding 1. 2. step of revision test.Final definite scorpion venom antibacterial peptide ImAMP ₁Minimum inhibitory concentration to bacterium.Wild-type scorpion venom antibacterial peptide ImAMP ₁To the minimal inhibitory concentration MIC of gram positive bacterium bacillus thuringiensis is that the MIC of 25 μ g/ml, subtilis is 50 μ g/ml, is 25 μ g/ml to the MIC of streptococcus aureus; And ImAMP ₁When drug level reaches 100 μ g/ml, to Gram-negative bacteria intestinal bacteria and Pseudomonas aeruginosa unrestraint effect.

Be coated with flat band method: (1) cultivates OD with gram-positive microorganism bacillus thuringiensis (CCTCC:AB92037), subtilis (CCTCC:AB91021) and Gram-negative bacteria intestinal bacteria (CCTCC:AB94012), Pseudomonas aeruginosa (CCTCC:AB93066) respectively ₆₀₀=0.8 o'clock, get 800 μ l after diluting 400 times and join in the sterilization test tube, add the ImAMP of 200 μ l to test tube respectively then through proportional diluted ₁, reaching final concentration is 100 μ g/ml, 10 μ g/ml, 1 μ g/ml, 0.1 μ g/ml.Negative control and positive control hole add kantlex (Gram-negative bacteria: final concentration is 20 μ g/ml) or the penicillin (gram-positive microorganism: final concentration is 50 μ g/ml) of 200 μ l 1%BSA and 200 μ l respectively; (2), after 250 commentaries on classics cultivations each test tube bacterium liquid after 6 hours is done suitable dilution, get 10 μ l spread plates, to guarantee that the colony number that the negative control bacterium forms is 50-300, so that count from 37 ℃; (3) first round is determined medicine ImAMP ₁The minimum inhibitory concentration of 10 times of dilutions after, minimum inhibitory concentration is carried out 2 times of proportional diluted, preceding (1) (2) step of revision test.Final definite scorpion venom antibacterial peptide ImAMP ₁Fungistatic effect.Wild-type scorpion venom antibacterial peptide ImAMP ₁Effective Mlc of gram positive bacterium bacillus thuringiensis is 75 μ g/ml, effective Mlc of subtilis is 75 μ g/ml, is 20 μ g/ml to effective Mlc of streptococcus aureus; And ImAMP ₁When drug level reaches 100 μ g/ml, to Gram-negative bacteria intestinal bacteria and Pseudomonas aeruginosa unrestraint effect.

Embodiment 15: mutant ImAMP ₁-M medicine is to the inhibition test of Gram-negative bacteria and gram-positive microorganism

96 orifice plate culture methods: 1. respectively intestinal bacteria, Pseudomonas aeruginosa (Gram-negative bacteria) and golden bacillus thuringiensis, subtilis, staphylococcus aureus (gram-positive microorganism) are cultivated OD ₆₀₀=0.8 o'clock, get 80 μ l after diluting 400 times and join in 96 orifice plates, add the ImAMP of 20 μ l to porous respectively then through proportional diluted ₁-M, reaching final concentration is 100 μ g/ml, 10 μ g/ml, 1 μ g/ml, 0.1 μ g/ml.Negative control and positive control hole add kantlex (Gram-negative bacteria: final concentration is 20 μ g/ml) or the penicillin (gram-positive microorganism: final concentration is 50 μ g/ml) of 20 μ l 1%BSA and 20 μ l respectively; 2. cultivate after 12 hours for 37 ℃, survey the light absorption value at 600nM wavelength place in each hole in 96 orifice plates with microplate reader; 3. determine medicine ImAMP ₁Behind the minimum inhibitory concentration of 10 times of dilutions of-M, minimum inhibitory concentration is carried out 2 times of proportional diluted, the preceding 1. 2. step of revision test.Final definite scorpion venom antibacterial peptide ImAMP ₁-M is to the minimum inhibitory concentration of bacterium.Mutant scorpion venom antibacterial peptide ImAMP ₁-M is 25 μ g/ml, the MIC of subtilis is 25 μ g/ml, is 5 μ g/ml to the MIC of streptococcus aureus the minimal inhibitory concentration MIC of bacillus thuringiensis gram positive bacterium, and ImAMP ₁-M is 12.5 μ g/ml, is 100 μ g/ml to the MIC of Pseudomonas aeruginosa the colibacillary MIC of Gram-negative bacteria.Mutant ImAMP ₁-M and wild-type ImAMP ₁Compare, not only strengthen effect, and its resistance to Gram-negative bacteria strengthens greatly gram-positive microorganism.

Embodiment 16: scorpion venom antibacterial peptide ImAMP ₁The molecular designing of-M mutant

With ImAMP ₁Mature peptide sequence (SEQ ID NO:2), utilize software ANTHEPROT2000 (ftp: //ftp.ibcp.fr/pub/antheprot/windows/anthe_5_0.exe) show its secondary structure image.The result shows, ImAMP ₁Has typically amphipathic (amphiphilic) α-Helix structure, the 4th leucine, the 15th L-Ala, the 8th leucine, the 1st leucine, the 12nd leucine, the 5th Isoleucine, the 16th phenylalanine, the 9th Isoleucine, the 2nd phenylalanine and the 13rd 's a word used in person's names propylhomoserin forms a hydrophobic surface, and the 11st glycine, the 7th Serine, the 14th Serine, the 3rd glycine, the 10th glycine, the 17th Methionin and the 6th 's proline(Pro) forms a hydrophilic surface (Figure 13).ImAMP ₁Iso-electric point (pHi) calculation result is 8.75, meets this feature of polyvalent cation antibacterial peptide.Based on ImAMP ₁The α of mature peptide aminoacid sequence-Helix structure, amphipathic and iso-electric point adopts point mutation with ImAMP ₁The 3rd glycine of mature peptide aminoacid sequence becomes arginine, and the 6th proline(Pro) becomes Methionin, and the 10th glycine becomes Methionin and the 11st glycine becomes arginine.To its mutant ImAMP ₁-M amino acid carries out secondary structure prediction, and utilizes software AHTHEPROT 2000 to show its mutant ImAMP ₁-M secondary structure image.The result shows, with wild-type ImAMP ₁Compare mutant ImAMP ₁-M has more typical amphipathic.Its mutant scorpion venom antibacterial peptide ImAMP ₁The aminoacid sequence of-M is: a kind of synthetic protein, its sequence are the aminoacid sequence shown in the SEQ ID NO:3.

Embodiment 17:ImAMP ₁And ImAMP ₁-M medicine is to the inhibition test of resistance staphylococcus haemolyticus

The strain of resistance staphylococcus haemolyticus: a strain staphylococcus haemolyticus of Hubei Province clinical laboratory of healthcare hospital for women ﹠ children acute isolation, through being accredited as MRCNS (cephalosporin analog antibiotic tolerance), numbering " 1538 ".

96 orifice plate culture methods: 1. the resistance staphylococcus haemolyticus is cultivated OD ₆₀₀=0.8 o'clock, get 80 μ l after diluting 400 times and join in 96 orifice plates, add the ImAMP of 20 μ l to porous respectively then through proportional diluted ₁Or ImAMP ₁-M, reaching final concentration is 100 μ g/ml, 10 μ g/ml, 1 μ g/ml, 0.1 μ g/ml.Negative control and positive control hole add the penbritin (final concentration is 50 μ g/ml) of 20 μ l 1%BSA and 20 μ l respectively; 2. cultivate after 12 hours for 37 ℃, survey the light absorption value at 600nM wavelength place in each hole in 96 orifice plates with microplate reader; 3. determine medicine ImAMP ₁Or ImAMP ₁Behind the minimum inhibitory concentration of 10 times of dilutions of-M, minimum inhibitory concentration is carried out 2 times of proportional diluted, the preceding 1. 2. step of revision test.Final definite scorpion venom antibacterial peptide ImAMP ₁And ImAMP ₁-M is respectively 5 μ g/ml and 2.5 μ g/ml to the minimum inhibitory concentration of resistance staphylococcus haemolyticus.

Antibacterial spot laboratory method: the resistance staphylococcus haemolyticus spot overnight incubation of fresh inoculation, with aseptic medical cotton stick picking colony, and be diluted to 0.5 Maxwell concentration with aseptic physiological saline, with aseptic cotton carrier above-mentioned bacteria suspension evenly is applied to the 9cm flat board then; Be to add 20 μ l polypeptide solutions on the filter paper of 5mm to the diameter of having sterilized, make the ImAMP that finally contains 50 μ g on the scraps of paper ₁Or ImAMP ₁-M polypeptide is attached to these scraps of paper on the flat board then.Negative control is 20 μ l 1%BSA, and positive control is the antibiotic filter paper that contains of Britain Oxoid company production, is respectively erythromycin (15 μ g) and vancomycin (30 μ g); After treating that the scraps of paper post, flat board is inverted overnight incubation, observes antibacterial spot size.Consequently inhibition zone does not appear in erythromycin sample and 1%BSA, and vancomycin sample has the inhibition zone of 20mm, scorpion venom antibacterial peptide ImAMP ₁And ImAMP ₁The inhibition zone size of-M medicine is respectively 10mm and 12mm.

SEQUENCE?LISTING

＜110〉Wuhan University

＜120〉a kind of Hainan sporic scorpion antibiotic and preparation method and application

＜130〉a kind of Hainan sporic scorpion antibiotic and preparation method and application

<160>3

<170>PatentIn?version?3.1

<210>1

<211>442

<212>DNA

<213>Isometrus?maculates

<400>1

atcaatttca?ctactaggaa?aatgaaagtt?aaattccttc?tcgctgtctt?cttgatcgtt 60

ttggttgtta?ctgatcattg?tcatgcattg?ttcggactta?tcccttcgtt?gatcggaggg 120

ctggtatcag?cattcaaggg?ccgaaggaaa?cgccagatgg?aagctcgatt?cgaaccccaa 180

aataggaatt?acaggaaacg?cgagctcgac?cttgaaaagt?tattcgcaaa?tatgcctgat 240

tactgatctc?aattactctt?tcagtttcat?cgcttagcat?aagtttttca?agttactgcc 300

gctactattg?catcatgatg?tgaattggtt?actttctaat?ataataaaaa?aactatactt 360

aatcataaaa?aaaaaaaaaa?aaaaaaaaaa?aaaaaaaaaa?aaaaaaaaaa?aaaaaaaaaa 420

aaaaaaaaaa?aaaaaaaaaa?aa 442

<210>2

<211>17

<212>PRT

<213>Isometrus?maculates

<400>2

Leu?Phe?Gly?Leu?Ile?Pro?Ser?Leu?Ile?Gly?Gly?Leu?Val?Ser?Ala?Phe

1 5 10 15

Lys

<210>3

<211>17

<212>PRT

<213>Isometrus?maculates

<400>3

Leu?Phe?Arg?Leu?Ile?Lys?Ser?Leu?Ile?Lys?Arg?Leu?Val?Ser?Ala?Phe

1 5 10 15

Lys

Claims

1. isolating antimicrobial peptide protein matter, its sequence is the aminoacid sequence shown in the SEQ ID NO:2.

2. isolating antimicrobial peptide protein matter, its sequence is the aminoacid sequence shown in the SEQ ID NO:3.

3. claim 1 or the 2 described a kind of isolating antimicrobial peptide protein matter application in the medicine of preparation treatment or prevention gram positive bacterium.