CN100537748C - A kind of East-Asia scorpion antibiotic peptide gene and preparation method and application - Google Patents
A kind of East-Asia scorpion antibiotic peptide gene and preparation method and application Download PDFInfo
- Publication number
- CN100537748C CN100537748C CNB2007100519653A CN200710051965A CN100537748C CN 100537748 C CN100537748 C CN 100537748C CN B2007100519653 A CNB2007100519653 A CN B2007100519653A CN 200710051965 A CN200710051965 A CN 200710051965A CN 100537748 C CN100537748 C CN 100537748C
- Authority
- CN
- China
- Prior art keywords
- bmkamp
- scorpion
- peptide
- antibacterial peptide
- asia
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Landscapes
- Peptides Or Proteins (AREA)
Abstract
The invention discloses a kind of East-Asia scorpion antibiotic peptide gene and preparation method and application, it is characterized in that scorpion venom antibacterial peptide recombination bacillus coli Escherichia coli DH5a/BmKAMP
1, CCTCC NO:M207036 the steps include: it at first is to make up buthus martensii Karscs poison gland cell cdna library; Next is positive colony that screens scorpion antibiotic peptide gene with PCR method from poison gland cDNA library; The coding characteristic of sequential analyzer antibacterial peptide gene is determined the aminoacid sequence of this antibacterial peptide; Adopt the antibacterial peptide of chemosynthesis gram-bacteria to be had the restraining effect of different concns.Particularly this East-Asia scorpion antibiotic peptide has stronger restraining effect, good anti-bacterial effect to the resistance staphylococcus haemolyticus.East-Asia scorpion antibiotic peptide of the present invention has specificity to gram-bacteria, and active high, and method is easy.Can be used as antibacterials uses.
Description
Technical field
The invention belongs to biological technical field, the present invention relates to a kind of scorpion antibiotic and this scorpion antibiotic peptide gene, also relate to a kind of preparation method of buthus martensii Karscs toxin gene, also relate to the purposes of this gene simultaneously, specifically, the present invention relates to a kind of separation of scorpion antibiotic peptide gene; The antimicrobial spectrum that relates to a kind of scorpion antibiotic is identified: gram-positive microorganism is had resistance of wide spectrum, and Gram-negative bacteria does not have effect; Relate to its antibacterial peptide of point mutation and improved resistance Gram-negative bacteria; It is effective to clinical isolating resistance staphylococcus haemolyticus also to relate to scorpion antibiotic, has the value of potential antibacterials exploitation.
Background technology
(Buthus martensii Karsch is a kind of traditional rare Chinese medicine of China BmK) to buthus martensii Karscs, just puts down in writing the medicinal history of scorpion before more than 2000 year.Ming Dynasty's Compendium of Material Medica more write up scorpion cures mainly multiple diseases such as " all urticarias, apoplexy, hemiplegia, facial hemiparalysis, language are puckery, brothers take out sincere; the pediatric epilepsy scared tetany ", have antitumor, desinsection, antibacterial and antibiotic effect, its effect is mainly derived from scorpion tail poison gland excretory venom.To be a class have a multiple bioactive micromolecule polypeptide (being scorpion toxin usually) by what 10-100 amino acid was formed to the main component of venom, they can selectivity, the membranin on the specific and cytolemma interacts, thereby change cell to the penetrating ability of ionic, regulate various kinds of cell metabolic process and various physiological processes such as emiocytosis, hormonal action and signal transduction such as cell volume, pH, membrane potential, excitability.According to estimates, there are 100000 kinds of different biologically active peptidess to be present in the various scorpion venom glands approximately.Therefore, scorpion toxin has important theoretical research meaning and application and development value.But because the scorpion venom complicated component, structural similitude is difficult to separate, many composition roles even opposite, and effective constituent often content is low, these have all limited the research and the application of scorpion venom undoubtedly.The physiological function of necessary employing modern molecular biology technique research scorpion venom monomer component.
There is experimental study to show to buthus martensii Karscs, the scorpio ethanol extraction all has restraining effect external to 8 kinds of shallow pathomycetes of table, especially comparatively responsive to Fonsecaea pedrosor, middle Ke Shi sporothrix, trichophyton gypseum, acrothesium floccosum, its antifungic action is better than the garlic leach liquor.Ceng Xianchun etc. have been separated to an antibacterial peptide gene BmKn2 from China's buthus martensii Karscs poison gland, find that this scorpion venom peptide has the function of Chinese People's Anti-Japanese Military and Political College enterobacteria, subtilis (Zeng X C, Wang S X, Zhu Y, Zhu S Y, Li W X.Identification andfunctional characterization of novel scorpion venom peptides with nodisulfide bridge from Buthus martensii Karsch.Peptides, 2004,25:143-150.), the BmKAMP that the present invention obtains
1It is isolating another new gene from buthus martensii Karscs poison gland.Simultaneously, the patent that relates to buthus martensii Karscs poison gland toxin gene at present has 7: the 1. application of buthus martensii Karscs toxin BmKAS in pharmacy, this invention relates to the application of buthus martensii Karscs toxin BmKAS in the anti-periphery injury of preparation medicine, and the application of buthus martensii Karscs toxin BmKAS in the anti-hyperalgesic of preparation; 2. a kind of recombinant baculovirus that contains divalent insect-resistant gene, this invention relates to buthus martensii Karscs insect-specific neurotoxin gene BmKIT and a kind of chitinase genes of insects (Chi), obtains to contain the recombinant baculovirus AcNPV-BmKIT-Chi of divalent insect-resistant gene; 3. arrhythmia-resistant scorpion peptide recombined colibacillus and construction process thereof, this invention has related to a kind of BmKIM BmKIM gene recombined escherichia coli, is used for the recombinant peptide that mass production is solvable, have antiarrhythmic activity; 4. BmKIM and its production and application, this disclosure of the Invention a kind of BmKIM BmKIM and its production and application, the resulting reorganization of the present invention BmKIM polypeptide has efficient antiarrhythmic activity, and solubility is good, the output height; 5. a kind of scorpion chloride channel neurotoxin gene-rBmKCTa of synthetic, this patent relates to chloride channel neurotoxin BmKCT gene, the rBmK CTa of the improvement of employing genetically engineered gained is inhibited to neurogliocyte, can be used for preparing by suppressing the medicine of the treatable disease of neurogliocyte; 6. a kind of purposes of transitional scorpion toxin BmK abT, the purposes of the transitional scorpion toxin BmK abT that the invention discloses, it can be used as the sodium channel modulator of a uniqueness, the research sodium channel is formed, the probe of 26S Proteasome Structure and Function, can regulate and treat the modulator and the medicine of sodium channel relative disease, can prepare and regulate or treat hyperkalemic paralysis, congenital myotonia and other skeletal muscle disease, the long QT of the 3rd the class modulator or the medicine of disease (LQT3), primary ventricular fibrillation and other heart diseases at interval; 7. a kind of recombinant scorpion toxin and solubility expression and purification process, this invention relate to a kind of recombinant scorpion toxin rBmKIT and solubility expression and purification process.
Although 1. 2. 3. 4. 5. 6. 7. patent all be content about the buthus martensii Karscs toxin, the BmKAMP that the scorpion toxin gene BmKAS that patent relates to, BmKIT, BmKIM, BmKCT, BmKabT and the present invention obtain
1Gene is diverse toxin gene, and 1. 2. 3. 4. 5. 6. 7. patented invention all do not relate to the antibacterial of scorpion toxin.
Summary of the invention
One object of the present invention is to provide a kind of buthus martensii Karscs toxin antibacterial peptide gene, has antibacterial.
Another object of the present invention also is to provide a kind of scorpion of Buthus martensii venom antibacterial peptide, and this antibacterial peptide contains 13 amino acid, and production cost is low.
Further object of the present invention is to provide a kind of method for preparing East-Asia scorpion antibiotic peptide gene, and this method is simple, and it is good to improve the anti-microbial activity effect.
A further object of the invention is to provide the application of a kind of East-Asia scorpion antibiotic peptide in the medicine of preparation treatment or prevention gram-bacteria.
To achieve these goals, of the present invention being contemplated that: 1. make up a high quality buthus martensii Karscs poison gland tissue cDNA library, at first get the poison gland of buthus martensii Karscs; Next is to extract total RNA, and purified mRNA; The 3rd is the reverse transcription synthetic double chain cDNA; The 4th is that double-stranded cDNA (adopts T with being connected of carrier pSPORT1
4Dna ligase); The 5th is the electricity conversion of recombinant molecule; The 6th is to obtain the poison gland cell cdna library; 2. based on 1. poison gland tissue cDNA library, the method by PCR has screened a clone sub-I5 (numbering), and sequential analysis is a kind of antibacterial peptide gene, called after BmKAMP
1, this bacterium is preserved in Chinese typical culture collection center, address: China. and Wuhan. Wuhan University, preservation date: on April 3rd, 2007, deposit number: CCTCC NO:M207036, classification name: escherichia coli DH5a/BmKAMP
1(Escherichia coliDH5 α/BmKAMP
1); 3. adopt the method (synthetic) of chemosynthesis, obtained scorpion venom antibacterial peptide BmKAMP by Shanghai section peptide bio tech ltd
1, antibacterial tests result shows, BmKAMP
1Gram positive bacterium bacillus thuringiensis (minimal inhibitory concentration MIC is 10 μ g/ml), subtilis (MIC is 6 μ g/ml), streptococcus aureus (MIC is 3 μ g/ml), the yellow micrococci of Teng (MIC is 50 μ g/ml) are had the restraining effect of different concns, and invalid to gram negative bacterium intestinal bacteria (100 μ g/ml do not have effect) and Pseudomonas aeruginosa (100 μ g/ml do not have effect).This scorpion venom antibacterial peptide BmKAMP
1Gram positive bacterium had specificity; 4. molecular designing BmKAMP
1Mutant BmKAMP
1-M, antibacterial tests shows, the mutant BmKAMP of this scorpion venom antibacterial peptide
1-M has improved resistance to Gram-negative bacteria (intestinal bacteria MIC is 10 μ g/ml and is 50 μ g/ml to Pseudomonas aeruginosa MIC); 5. BmKAMP
1And BmKAMP
1-M can have resistance effect (BmKAMP to the isolating resistance staphylococcus haemolyticus in maternity ﹠ child care center, Hubei Province
1MIC be 5 μ g/ml, and BmKAMP
1The MIC of-M is 2.5 μ g/ml).So scorpion venom antibacterial peptide BmKAMP
1Value with potential antibacterials exploitation.
The objective of the invention is to be to provide a kind of method that makes up high quality buthus martensii Karscs poison gland tissue cDNA library, the toxin gene fraction of coverage reaches more than 95%.Make up the technological line such as the Fig. 1 in high quality buthus martensii Karscs poison gland tissue cDNA library.Comprise and buy buthus martensii Karscs 48h after electric shock is got poison, its poison gland is used for the separation (Fig. 2) of total RNA; The scorpion tail gland of getting 500mg is ground into fine powder in liquid nitrogen, by the total RNA of scorpion venom gland of Trizol method preparation; The total RNA of the scorpion venom gland of preparation adopts denaturing formaldehyde its quality of detected through gel electrophoresis (Fig. 3).
Be 3mg by the total RNA amount of the scorpion venom gland of method for preparing, adopt PolyA Tract mRNA separation system (available from U.S. Promega) to separate and purified mRNA.The scorpion venom gland mRNA that ultraviolet spectrophotometer is measured its acquisition measures about 10 μ g.With 5 μ gmRNA as initial amount, first chain and second chain that carry out cDNA are synthetic, continue being connected of double-stranded cDNA and SalI adapter, NotI digests double-stranded cDNA, excessive SalI adapter and the enzyme removed in the double-stranded cDNA molecule are cut small segment, double-stranded cDNA is connected and conversion with pSPORT1 carrier (available from American I nvitrogen), and it is 1.5*10 that the result has obtained an abundance
6Individual clone's/μ gcDNA.The positive insertion rate in the scorpion venom gland cDNA library that makes up reaches (Fig. 4) more than 95%, and this library has higher quality.
Another object of the present invention also is to provide a kind of antibacterial peptide gene that screening obtains from buthus martensii Karscs poison gland cDNA library.Designing a specific primer according to the aminoacid sequence of BmKn1 and/or nucleotide sequence adopts the PCR strategy to screen the purpose toxin gene from the cDNA library in conjunction with the downstream universal primer.Its strategy is seen Fig. 5.The bacterium liquid 800 μ l that 5ng cDNA are connected the product conversion with 25ng pSPORT1 carrier evenly coat 10 LB/Ap
+It is dull and stereotyped that (every liter contains Tryptones 10g, yeast extract 5g, NaCl 10g, pH value to 7.4, penicillin 100 μ g/ml), 37 ℃ of overnight incubation, each flat board approximately contains the bacterium colony (clone's) about 500, and it is seeded to the LB/Ap that contains 950 μ l with toothpick one by one
+The 1.5ml Ep pipe (and numbering in order) of plate culture medium, 37 ℃ of 280rpm joltings are spent the night, and take out 100 μ ls as preparation pcr template from every pipe next day, then every pipe added 150 μ l glycerine ,-20 ℃ or-70 ℃ of preservations.In each flat board, add 800 μ l LB/Ap simultaneously
+Liquid nutrient medium scrapes bacterium colony with the aseptic inoculation ring, divides the 1.5ml Ep pipe of packing into, 37 ℃ cultivate a few hours after, prepare plasmid with boiling method ,-20 ℃ of preservations are as pcr template.Library screening divides three rounds, and the first run time is used from the mixing plasmids of 10 dull and stereotyped preparations and made template, carries out 10 pipe PCR, and 10 pipes (50 clones of every pipe) that after the electrophoresis detection 500 clones of positive pipe correspondence are divided into carry out 10 pipe PCR.The third round screening just can obtain our needed purpose clone by 50 pipe PCR.Send company's order-checking with positive colony.The result shows that I5 clone is a new East-Asia scorpion antibiotic peptide gene, called after BmKAMP
1A kind of isolated polypeptide gene, its sequence are the nucleotide sequence shown in the SEQ ID NO:1.
Another object of the present invention also is to provide a kind of scorpion of Buthus martensii venom antibacterial peptide.BmKAMP
170 amino-acid residues of prosoma organization form coding, form i.e. signal peptide (23 residues), mature peptide (13 residues) and precursor peptide (34 residues) by three parts.Based on the processing rule of scorpion toxin precursor C-terminal residue, BmKAMP
1Terminal last residue Phe is excised by specificity carboxypeptidase (Carboxypeptidase), and by amidated.Therefore, the invention provides a scorpion of Buthus martensii venom antibacterial peptide: a kind of separation or synthetic protein, its sequence are the aminoacid sequence shown in the SEQ ID NO:2.
Another object of the present invention provides the scorpion antibiotic of a kind of specific effect in gram positive bacterium, can be used as the antibacterials exploitation.By the way of chemosynthesis, obtained purity and reached more than 95%, and with natural antibacterial peptide BmKAMP
1The synthetic polypeptide of consensus amino acid sequence (HPLC purity assay) (Fig. 7).The anti-bacterial result shows that gram positive bacterium bacillus thuringiensis, subtilis (Fig. 8), streptococcus aureus (Fig. 9), the yellow micrococci of Teng are had the restraining effect of different concns, ask for an interview following table 1, and invalid to gram negative bacterium intestinal bacteria (Figure 10) and Pseudomonas aeruginosa (Figure 11), this scorpion venom antibacterial peptide BmKAMP
1Medicine has specificity to gram positive bacterium, has similar antibacterial effect with penbritin.And BmKAMP
1Medicine can have resistance effect (Figure 12) to resistance staphylococcus haemolyticus (a strain staphylococcus haemolyticus of Hubei Province clinical laboratory of healthcare hospital for women ﹠ children acute isolation is through being accredited as cephalosporin analog antibiotic tolerance MRCNS, numbering 1538).
Table 1: scorpion venom antibacterial peptide BmKAMP
1The fungistatic effect of medicine
BmKAMP
1Medicine is 10 μ g/ml, the MIC of subtilis is 6 μ g/ml, the MIC of streptococcus aureus is 3 μ g/ml, is 50 μ g/ml to the yellow micrococcal MIC of Teng the minimal inhibitory concentration MIC of gram positive bacterium bacillus thuringiensis.And BmKAMP
1When drug level reaches 100 μ g/ml, still invalid to Gram-negative bacteria intestinal bacteria and Pseudomonas aeruginosa.And BmKAMP
1Medicine is 5 μ g/ml to the MIC of the isolating resistance staphylococcus haemolyticus in maternity ﹠ child care center, Hubei Province (tolerance erythromycin).
A further object of the present invention provides a kind of molecular design method that improves anti-microbial activity.According to BmKAMP
1Mature peptide sequence (SEQ ID NO:2), utilize freeware ANTHEPROT2000 (ftp: //ftp.ibcp.fr/pub/antheprot/windows/anthe_5_0.exe) show its secondary structure image.The result shows, BmKAMP
1Has typically amphipathic (amphiphilic) α-Helix structure (Figure 13).Based on BmKAMP
1α-Helix the structure of mature peptide aminoacid sequence (SEQ ID NO:2), amphipathic and iso-electric point adopts point mutation with BmKAMP
1The 3rd Gly of mature peptide aminoacid sequence (SEQ ID NO:2) becomes Arg, and the 6th Pro becomes Lys, and the 10th Gly becomes Lys and the 11st Gly becomes Arg (Figure 13).Its mutant scorpion venom antibacterial peptide BmKAMP
1The aminoacid sequence of-M: a kind of separation or synthetic protein, its sequence are the aminoacid sequence shown in the SEQ ID NO:3.Antibacterial tests result shows, the mutant BmKAMP of chemosynthesis
1-M has improved the resistance to Gram-negative bacteria, asks for an interview following table 2, has enlarged antimicrobial spectrum.And BmKAMP
1-M medicine still has resistance (Figure 14) to the resistance staphylococcus haemolyticus.
Table 2: mutant BmKAMP
1The fungistatic effect of-M medicine
Mutant scorpion venom antibacterial peptide BmKAMP
1-M is 3 μ g/ml, the yellow micrococcal MIC of Teng is 50 μ g/ml, the MIC of subtilis is 6 μ g/ml, is 10 μ g/ml to the minimal inhibitory concentration MIC of bacillus thuringiensis the MIC of gram positive bacterium streptococcus aureus, and BmKAMP
1-M is 10 μ g/ml, is 50 μ g/ml to the MIC of Pseudomonas aeruginosa the colibacillary MIC of Gram-negative bacteria.Mutant BmKAMP
1-M and wild-type BmKAMP
1Compare, its resistance to Gram-negative bacteria strengthens greatly.And BmKAMP
1-M medicine is 2.5 μ g/ml to the MIC of the isolating resistance staphylococcus haemolyticus in maternity ﹠ child care center, Hubei Province (tolerance erythromycin), than its wild-type BmKAMP
1MIC5 μ g/ml be doubled.
The scorpion venom antibacterial peptide that the present invention obtains has BmKAMP
1The specificity of gram positive bacterium, and effective to the isolating resistance staphylococcus haemolyticus of hospital.And molecular design method of the present invention, have simple and characteristics of high efficiency, can effectively improve the anti-microbial activity of antibacterial peptide by this method, thereby avoid a large amount of screenings of random point mutation and do not had purpose.
Description of drawings
Fig. 1 buthus martensii Karscs poison gland cell cdna library makes up synoptic diagram.
1. get the poison gland of buthus martensii Karscs; 2. extract total RNA, and purified mRNA; 3. reverse transcription synthetic double chain cDNA;
4. double-stranded cDNA is connected with carrier pSPORT1's; 5. the electricity of recombinant molecule transforms; 6. obtain the poison gland cell cdna library.
Fig. 2 takes from the buthus martensii Karscs and the poison gland thereof of Suizhou, Hubei.
The denaturing formaldehyde electrophoresis of the total RNA of Fig. 3 buthus martensii Karscs poison gland.
1: adopt the NaAc precipitation; 2: do not adopt the NaAc precipitation.
Fig. 4 PCR detects library quality electrophorogram.
M: standard DNA molecular weight Mark; 1-16: 16 of random choose different clone's from the library.
The strategy in Fig. 5 PCR screening cDNA library.
Fig. 6 scorpion of Buthus martensii venom antibacterial peptide BmKAMP
1Gene and amino acid thereof.
The corresponding amino sequence of cDNA sequence below for inferring; Signal peptide amino acid is with single underscore mark; Mature peptide amino acid is with the black matrix mark; The square frame partial amino-acid is the carboxypeptidase recognition site; Dash area amino acid is C end precursor peptide.
Fig. 7 chemosynthesis East-Asia scorpion antibiotic peptide BmKAMP
1HPLC purity identify figure.
Fig. 8 BmKAMP
1Medicine is to the restraining effect of subtilis.
Negative control is 1%BSA; Positive control is 50 μ g/ml penbritins; Antibacterial peptide BmKAMP
1Drug level is 25 μ g/ml and 50 μ g/ml.
Fig. 9 BmKAMP
1Medicine is to aureus with inhibition.
Negative control is 1%BSA; Positive control is 50 μ g/ml penbritins; Antibacterial peptide BmKAMP
1Drug level is 5 μ g/ml and 10 μ g/ml.
Figure 10 BmKAMP
1Medicine is to colibacillary restraining effect.
Negative control is 1%BSA; Positive control is 20 μ g/ml kantlex; Antibacterial peptide BmKAMP
1Drug level is 50 μ g/ml and 100 μ g/ml.
Figure 11 BmKAMP
1Medicine is to the restraining effect of Pseudomonas aeruginosa.
Negative control is 1%BSA; Positive control is 20 μ g/ml kantlex; Antibacterial peptide BmKAMP
1Drug level is 50 μ g/ml and 100 μ g/ml.
Figure 12 wild-type BmKAMP
1Medicine is to the resistance effect of resistance staphylococcus haemolyticus.
Positive control is 30 μ g vancomycins; The resistance microbiotic is 15 μ g erythromycin; Wild-type antibacterial peptide BmKAMP
1Medicine is 50 μ g; Negative control is 1%BSA.
Figure 13 wild-type BmKAMP
1With mutant BmKAMP
1The amphipathic a-Helix structure of-M scorpion venom antibacterial peptide.
Figure 14 mutant BmKAMP
1-M medicine is to the resistance effect of resistance staphylococcus haemolyticus.
Positive control is 30 μ g vancomycins; The resistance microbiotic is 15 μ g erythromycin; Mutant antibacterial peptide BmKAMP
1-M medicine is 50 μ g; Negative control is 1%BSA.
Embodiment
The following examples can make those skilled in the art more fully understand the present invention, but do not limit the present invention in any way.
Embodiment 1: the extraction of the total RNA of scorpion venom gland (Trizol LS single stage method: Trizol LS is available from beautiful Invitrogen)
1. the scorpion tail gland of getting 500mg is ground into fine powder in liquid nitrogen, add 10ml TRIZOL reagent mixing, and room temperature (20-25 ℃, below identical) was placed 5 minutes; 2. add the 2ml chloroform then and mixed 15 seconds, room temperature was placed 2-3 minute, centrifugal 15 minutes of 4 ℃ of following 12000g; 3. the 1 times of volume Virahol of addition of fetching water, room temperature was placed 10 minutes, centrifugal 10 minutes of 4 ℃ of following 12000g the RNA precipitation; 4. precipitate and use 5m175% washing with alcohol, centrifugal 5 minutes of 7500g; 5. be dissolved in DEPC-treated water after the RNA precipitation drying, 55-60 ℃ is incubated 10 minutes with thorough dissolving RNA.Whole process is carried out with reference to TR1ZOL (Total RNA Isolation) ReagentKit recommend method.The total RNA of the scorpion venom gland of preparation adopts its quality of denaturing formaldehyde detected through gel electrophoresis.
The separation and purification of embodiment 2:mRNA
Adopt PolyA Tract mRNA separation system (Promega, USA) separation and purified mRNA, its principle of work is based on the complementary pairing characteristic of Oligo (dT) and mRNA 3 ' end poly (A) tail, with biotin labeling Oligo (dT), hold the annealing of poly (A) to form crossbred by it and mRNA 3 ', catch and wash vitamin H Oligo (dT)/mRNA crossbred with the magnetic bead and the magnetic separation rack that indicate the affinity element then, use the ddH of no RNA enzyme at last
2O elutes it, reaches the purpose of separating mRNA from total RNA.1. the preparation of sample: RNA is joined among the GTC of the 800 μ l that contain 32 μ l beta-mercaptoethanols.2. the annealing of probe: get 250pM concentration Oligo (dT) 5 μ l, adding distil water to 50 μ l; The dilution buffer (dilution buffer has added 32 μ l β-mercaptoethanols) that adds the 1.6ml preheating, with the RNA mixing, 70 ℃ of incubations 5 minutes.3. the activation of magnetic bead: the magnetic bead SA-PMPS (available from beautiful Promega) that gets 1.2ml is in the centrifuge tube of 1.5ml; With the resuspended SA-PMPS of 0.5 * SSC, with magnet stand absorption magnetic bead, original volume 0.5 * SSC washing SA-PMPS3 time.4. obtaining of mRNA: the RNA of 70 ℃ of incubations is mixed with SA-PMPS, and room temperature is placed to put in 5 minutes and is adsorbed magnetic bead on the magnet stand, abandons supernatant liquor; The 0.5XSSC suspension magnetic bead of 2ml, washing repeats 2 times, removes SSC for the last time as far as possible; The ddH that adds no RNA enzyme
2O to magnetic bead, mixing gently, centrifugal then (12000g * 3 minute) or magnet stand absorption magnetic bead; Get supernatant, obtain mRNA.Concentration and purity by electrophoresis and ultraviolet determination mRNA.5. the precipitation of mRNA: add the dehydrated alcohol of glycogen and 2.5 times of volumes among the mRNA that will 4. obtain, precipitation is spent the night, and mRNA will be used for the synthetic of cDNA.
3: the first chain cDNA of embodiment are synthetic
1. add 2 μ l Not I Primer-adapter and 6 μ l mRNA (containing 3 μ gmRNA) in 1.5ml Ep pipe, 70 ℃ of incubation 10min are put in rapidly on ice, centrifugal after, add following ingredients: 4 μ l 5X firststrand buffer; 2 μ l 0.1M DTT; 1 μ l 10mM dNTPs; 1 μ l DEPCH
2O.Centrifugal behind the mixing gently, put to 2min for 37 ℃; 2. add 5 μ l reversed transcriptive enzymes, get 2 μ l behind the mixing, add 1 μ l[α-
32P] dCTP (4 μ Ci) (spike pipe).With above-mentioned reactive component (sample hose) while 37 ℃ of incubation 1h, put into termination reaction on ice then; 3. for the spike pipe, add 43 μ l 20mM EDTA and 5 μ l yeast tRNA successively, behind the mixing, get respectively two part 10 μ l o'clock on two filter membranes, wash 3 times each 5min for 1 part with 10%TCA, 95% ethanol is washed 1 time, and after the dry air, putting into the 1.5ml scintillation solution (is 1
#Sample); After other 1 part of dry air, putting into the 1.5ml scintillation solution (is 2
#Sample).30 μ l traced fluids add 1.5 μ l 7.5M NH in addition
4OAc and 90 μ l dehydrated alcohols (20 ℃), behind the mixing immediately 14, the centrifugal 20min of 000rpm abandons supernatant, add 0.5ml 70% dehydrated alcohol (20 ℃), 14, the centrifugal 2min of 000rpm abandons supernatant, 37 ℃ of dry 10min allow ethanol volatilize, be dissolved in 10 μ l TEN solution, add 10 μ l 2X sample loading buffers, get 10 μ l and be used for alkaline gel electrophoresis.With [α-
32P] dCTP mark λ DNA HindIII fragment makes molecular weight marker; 4. place 15min under the room temperature behind the mixing, add 2 μ l 0.2M EDTA termination reactions.Get 6 μ l reaction solutions and 6ml 2X alkalescence electrophoretic buffer mixing, behind the electrophoresis 5h, soak 20min with 7% TCA, until the bromjophenol blue flavescence.Blot (about 8h) with toilet paper then, carry out radioautograph; 5. for sample hose, be used for the synthetic of second chain.
4: the second chain cDNA of embodiment are synthetic
1. in sample hose, add following ingredients on ice successively; 2. gently behind the mixing, 16 ℃ of incubation 2h; 3. add 2 μ l (10units) T4DNA polysaccharases, continue 16 ℃ of reaction 5min; 4. change on ice, add 10 μ l0.5M EDTA; 5. add equal-volume (150 μ l) phenol/chloroform/primary isoamyl alcohol (25/24/1), thoroughly behind the vortex, under the room temperature 14, the centrifugal 5min of 000rpm.Change water (140 μ l) over to another 1.5ml Ep pipe; 6. the 7.5M NH that adds 70 μ l
4OAc and 0.5ML dehydrated alcohol (20 ℃), behind the vortex, under the room temperature 14, the centrifugal 20min of 000rpm; 7. abandon supernatant, add 0.5ml 70% ethanol (20 ℃), the same centrifugal 2min.Abandon supernatant, 37 ℃ of dry 10min.
Embodiment 5: double-stranded cDNA is connected with Sal I adapter
1. the ddH that handles with 25 μ l DEPC
2The cDNA sample of O dissolving embodiment 4, according to the form below adds successively then; 2. mixing gently, 16 ℃ of reactions spend the night (about 20h).3. use (25/24/1) extracting of phenol/chloroform/primary isoamyl alcohol and NH
4Behind the Oac/ ethanol sedimentation, 37 ℃ of dry 10min.
Embodiment 6:Not I digests double-stranded cDNA
1. the sample with embodiment 5 is dissolved in 41 μ l, and according to the form below adds successively then; 2. behind the mixing, 37 ℃ of incubation 2h; 3. use phenol/chloroform/primary isoamyl alcohol (25/24/1) extracting once, use 7.5M NH then
4The Oac/ ethanol sedimentation, 37 ℃ of dry 10min.4. be dissolved in 70 μ l TEN, get 1 μ l and be used for quantitatively, all the other-20 ℃ of preservations are standby.
Embodiment 7: excessive Sal I adapter and the enzyme removed in the double-stranded cDNA molecule are cut small segment
(Amersham USA) removes excessive SalI adapter and enzyme and cuts small segment with nucleon extraction and purification kit.1. room temperature low suspension resin is got 600 μ l then and is added in the centrifugal post, and the centrifugal 10s of 2000rpm removes liquid.Central authorities add the above-mentioned cDNA solution of 40 μ l at resin.The same centrifugal; 2. collect elutriant and be used for ligation.
Embodiment 8: double-stranded cDNA is connected and conversion with the pSPORT1 carrier
1. in 1.5ml Ep pipe, add following ingredients successively; 2. react 16h under the room temperature; 3. in 2. reaction solution, add following ingredients successively: 5.0 μ l yeast tRNA, 12.5 μ l 7.5M NH40ac, 70 μ l dehydrated alcohols (20 ℃).14000 centrifugal 20min immediately behind the vortex mixing; 4. precipitation is dissolved in 4 μ l with 70% ethanol (20 ℃) washing after 37 ℃ of dryings; 5. get 2 μ l electric shock and transform 50 μ l E.coli K12 MC1061.
Embodiment 9: the preliminary evaluation of poison gland cell cdna library
Identify the quality in library, forward primer: 5 ' TCGACCCACGCGTCCG3 ' (pressing Sal adapter sequences Design) with PCR method; Reverse primer: 5 ' GAGCGGCCGCCCT15 3 ' (pressing the sequences Design of Not I primer-adapter).
Embodiment 10:PCR primer design
Precursor nucleotide sequence aaacttcctctgtgaaagtaacttctgtgaaactcactcttcgataaaatgaaatc tcagacctttttccttctttttctagttgttttattattagcaatttcacaatcag aagctttcattggtgctgttgctggtcttctctctaaaatttttggaaaaagaagt atgagagatatggatactatgaagtacttatatgatccaagtttgagtgcagctga tttgaaaaccttacaaaaactaatggaaaattactgattatttgaatataataatg ttatctctattttagattataaatatttcttttgaaaaaaaaaaaaaaaaaaaaaa aaa (gene accession number AF150010) based on scorpion toxin BmKn1. Design specific forward primer FP1:5 '-TGGATACTATGAAGTACTTA-3 ' .Reverse primer RP1:5 '-GAGCGGCCGCCT15-3 ' is according to building the sequences Design of synthesizing the first chain cDNA primer that the storehouse test kit provides.
Embodiment 11:PCR Policy Filtering cDNA library
Adopt the method for PCR that the buthus martensii Karscs poison gland cell cdna library that makes up among the embodiment 8 is screened, its screening strategy sees that Fig. 5 and concrete operations step are as follows: 1. get cDNA scorpion venom storehouse 800 μ l and evenly coat 10 LB/AP
+Flat board, 37 ℃ of overnight incubation; 2. each flat board approximately contains the single bacterium colony about 500, and it is seeded to the LB/AP of 600 μ l one by one with toothpick
+In the liquid nutrient medium, 37 ℃ of overnight incubation; 3. get 50 μ l and boiled 1 minute, with the preparation pcr template; 4. add 300 μ l60% aseptic glycerine-20 ℃ preservations in all the other bacterium solution; 5. simultaneously, in each flat board, add 500 μ lLB/AP
+Solution scrapes bacterium colony with the aseptic inoculation ring, divides the 1.5mlEp pipe of packing into, cultivates after 6 hours for 37 ℃, gets 100 μ l and boils 1 minute, and preparation becomes pcr template; 6. at first use each dull and stereotyped mixed bacterium solution as pcr template, carry out pcr amplification with PCR primers F P1 and RP1 among the embodiment 10, the PCR reaction conditions: 94 ℃ of pre-sex change 5 minutes, 94 ℃ of sex change 1 minute, 50 ℃ of annealing 1 minute, 72 ℃ were extended 1 minute, last 72 ℃ were extended 5 minutes, and circulated 35 times.Screen again expanding the flat board that about 200bp band, promptly get the bacterium solution 10 μ l of each the single bacterium colony in this flat board, carry out the PCR reaction again after per 50 pipes mix, pairing 50 bacterium of the pipe that positive signal is arranged are carried out the PCR reaction again through the PCR reaction.The mono-clonal bacterium solution of the 200bpPCR amplified band of having an appointment is delivered company's order-checking.
Embodiment 12:DNA order-checking and Computer Analysis
Positive clone uses ABI PRISM by PCR screening preliminary evaluation
TMAutomatic dna sequencer (the big genome company of Beijing China) checks order.Sequence typing software is BioEdit v4.5.8 (Tom Hall, 1999), homology comparison and signal peptide cutting site forecasting software be respectively CLUSTAL X 1.8 (Thompson et al., 1997) and PC/GENE (Intelligenetics Inc., Switzerland).Sequential analysis shows that positive colony is a new gene, called after BmKAMP
1
Embodiment 13: chemosynthesis scorpion venom antibacterial peptide BmKAMP
1
BmKAMP
170 amino-acid residues of prosoma organization form coding, form i.e. signal peptide (23 residues), mature peptide (13 residues) and precursor peptide (34 residues) by three parts.Based on the processing rule of scorpion toxin precursor C-terminal residue, BmKAMP
1Terminal last residue Phe is excised by specificity carboxypeptidase (Carboxypeptidase), and by amidated.Therefore, adopt the way of chemosynthesis to obtain highly purified scorpion venom antibacterial peptide, its sequence is the aminoacid sequence shown in the SEQ ID NO:2.
Embodiment 14: scorpion venom peptide BmKAMP
1Medicine is to the inhibition test 96 orifice plate culture methods of bacillus thuringiensis (CCTCC:AB92037): 1. bacillus thuringiensis (Bacillus thuringensis) is cultivated OD
600=0.8 o'clock, get 80 μ l after diluting 400 times and join in 96 orifice plates, add the BmKAMP of 20 μ l to porous respectively then through proportional diluted
1, reaching final concentration is 100 μ g/ml, 10 μ g/ml, 1 μ g/ml, 0.1 μ g/ml.Negative control and positive control hole add the penbritin (final concentration is 50 μ g/ml) of 20 μ l, 1% BSA and 20 μ l respectively; 2. cultivate after 12 hours for 37 ℃, survey the light absorption value at 600nM wavelength place in each hole in 96 orifice plates with microplate reader; 3. determine medicine BmKAMP
1The minimum inhibitory concentration of 10 times of dilutions after, minimum inhibitory concentration is carried out 2 times of proportional diluted, the preceding 1. 2. step of revision test.Final definite scorpion venom antibacterial peptide BmKAMP
1Minimum inhibitory concentration to bacillus thuringiensis is 10 μ g/ml.
Embodiment 15: scorpion venom peptide BmKAMP
1Medicine is to the inhibition test of subtilis (CCTCC:AB91021)
Be coated with flat band method: 1. subtilis (Bacillus subtillis) is cultivated OD
600=0.8 o'clock, get 800 μ l after diluting 400 times and join in the sterilization test tube, add the BmKAMP of 200 μ l to test tube respectively then through proportional diluted
1, reaching final concentration is 100 μ g/ml, 10 μ g/ml, 1 μ g/ml, 0.1 μ g/ml.Negative control and positive control hole add the penbritin (final concentration is 50 μ g/ml) of 200 μ l, 1% BSA and 200 μ l respectively; 2. from 37 ℃, after 250 commentaries on classics cultivations each test tube bacterium liquid after 6 hours is done suitable dilution, get 10 μ l spread plates, to guarantee that the colony number that the negative control bacterium forms is 50-300, so that count; 3. the first round is determined medicine BmKAMP
1The minimum inhibitory concentration of 10 times of dilutions after, minimum inhibitory concentration is carried out 2 times of proportional diluted, the preceding 1. 2. step of revision test.Final definite scorpion venom antibacterial peptide BmKAMP
1Effective inhibition concentration to subtilis is 20 μ g/ml.
96 orifice plate culture methods: (1) cultivates OD with subtilis
600=0.8 o'clock, get 80 μ l after diluting 400 times and join in 96 orifice plates, add the BmKAMP of 20 μ l to porous respectively then through proportional diluted
1, reaching final concentration is 100 μ g/ml, 10 μ g/ml, 1 μ g/ml, 0.1 μ g/ml.Negative control and positive control hole add the penbritin (final concentration is 50 μ g/ml) of 20 μ l1%BSA and 20 μ l respectively; Cultivate after 12 hours for (2) 37 ℃, survey the light absorption value at 600nM wavelength place in each hole in 96 orifice plates with microplate reader; (3) determine medicine BmKAMP
1The minimum inhibitory concentration of 10 times of dilutions after, minimum inhibitory concentration is carried out 2 times of proportional diluted, preceding (1) (2) step of revision test.Final definite scorpion venom antibacterial peptide BmKAMP
1Minimum inhibitory concentration to subtilis is 6 μ g/ml.
Embodiment 16: scorpion venom peptide BmKAMP
1Medicine is to the inhibition test of streptococcus aureus (CCTCC:AB94004)
Be coated with flat band method: 1. streptococcus aureus (Staphylococcus aureus) is cultivated OD
600=0.8 o'clock, get 800 μ l after diluting 400 times and join in the sterilization test tube, add the BmKAMP of 200 μ l to test tube respectively then through proportional diluted
1, reaching final concentration is 100 μ g/ml, 10 μ g/ml, 1 μ g/ml, 0.1 μ g/ml.Negative control and positive control hole add the penbritin (final concentration is 50 μ g/ml) of 200 μ l, 1% BSA and 200 μ l respectively; 2. from 37 ℃, after 250 commentaries on classics cultivations each test tube bacterium liquid after 6 hours is done suitable dilution, get 10 μ l spread plates, to guarantee that the colony number that the negative control bacterium forms is 50-300, so that count; 3. the first round is determined medicine BmKAMP
1The minimum inhibitory concentration of 10 times of dilutions after, minimum inhibitory concentration is carried out 2 times of proportional diluted, the preceding 1. 2. step of revision test.Final definite scorpion venom antibacterial peptide BmKAMP
1Effective inhibition concentration to streptococcus aureus is 10 μ g/ml.
96 orifice plate culture methods: (1) cultivates OD with streptococcus aureus
600=0.8 o'clock, get 80 μ l after diluting 400 times and join in 96 orifice plates, add the BmKAMP of 20 μ l to porous respectively then through proportional diluted
1, reaching final concentration is 100 μ g/ml, 10 μ g/ml, 1 μ g/ml, 0.1 μ g/ml.Negative control and positive control hole add the penbritin (final concentration is 50 μ g/ml) of 20 μ l, 1% BSA and 20 μ l respectively; Cultivate after 12 hours for (2) 37 ℃, survey the light absorption value at 600nM wavelength place in each hole in 96 orifice plates with microplate reader; (3) determine medicine BmKAMP
1The minimum inhibitory concentration of 10 times of dilutions after, minimum inhibitory concentration is carried out 2 times of proportional diluted, preceding (1) (2) step of revision test.Final definite scorpion venom antibacterial peptide BmKAMP
1Minimum inhibitory concentration to streptococcus aureus is 3 μ g/ml.
Embodiment 17: scorpion venom peptide BmKAMP
1Medicine is to the inhibition test of the yellow micrococci of Teng (CCTCC:AB93113)
96 orifice plate culture methods: 1. the yellow micrococci of Teng (Micrococcus luteus) is cultivated OD
600=0.8 o'clock, get 80 μ l after diluting 400 times and join in 96 orifice plates, add the BmKAMP of 20 μ l to porous respectively then through proportional diluted
1, reaching final concentration is 100 μ g/ml, 10 μ g/ml, 1 μ g/ml, 0.1 μ g/ml.Negative control and positive control hole add the penbritin (final concentration is 50 μ g/ml) of 20 μ l, 1% BSA and 20 μ l respectively; 2. cultivate after 12 hours for 37 ℃, survey the light absorption value at 600nM wavelength place in each hole in 96 orifice plates with microplate reader; 3. determine medicine BmKAMP
1The minimum inhibitory concentration of 10 times of dilutions after, minimum inhibitory concentration is carried out 2 times of proportional diluted, the preceding 1. 2. step of revision test.Final definite scorpion venom antibacterial peptide BmKAMP
1To the yellow micrococcal minimum inhibitory concentration of Teng is 50 μ g/ml.
Embodiment 18: scorpion venom peptide BmKAMP
1Medicine is to the inhibition test of intestinal bacteria (CCTCC:AB94012)
Be coated with flat band method: 1. intestinal bacteria (Escherichia coli) are cultivated OD
600=0.8 o'clock, get 800 μ l after diluting 400 times and join in the sterilization test tube, add the BmKAMP of 200 μ l to test tube respectively then through proportional diluted
1, reaching final concentration is 100 μ g/ml, 10 μ g/ml, 1 μ g/ml, 0.1 μ g/ml.Negative control and positive control hole add the kantlex (final concentration is 20 μ g/ml) of 200 μ l, 1% BSA and 200 μ l respectively; 37 ℃; 2. from 37 ℃, after 250 commentaries on classics cultivations each test tube bacterium liquid after 6 hours is done suitable dilution, get 10 μ l spread plates, to guarantee that the colony number that the negative control bacterium forms is 50-300, so that count; The first round is determined medicine BmKAMP
1The minimum inhibitory concentration of 10 times of dilutions after, minimum inhibitory concentration is carried out 2 times of proportional diluted, the preceding 1. 2. step of revision test.Final definite scorpion venom antibacterial peptide BmKAMP
1When concentration reaches 100 μ g/ml, to still unrestraint effect of intestinal bacteria.
96 orifice plate culture methods: (1) cultivates OD with intestinal bacteria
600=0.8 o'clock, get 80 μ l after diluting 400 times and join in 96 orifice plates, add the BmKAMP of 20 μ l to porous respectively then through proportional diluted
1, reaching final concentration is 100 μ g/ml, 10 μ g/ml, 1 μ g/ml, 0.1 μ g/ml.Negative control and positive control hole add the kantlex (final concentration is 20 μ g/ml) of 20 μ l1%BSA and 20 μ l respectively; Cultivate after 12 hours for (2) 37 ℃, survey the light absorption value at 600nM wavelength place in each hole in 96 orifice plates with microplate reader; (3) determine medicine BmKAMP
1The minimum inhibitory concentration of 10 times of dilutions after, minimum inhibitory concentration is carried out 2 times of proportional diluted, preceding (1) (2) step of revision test.Final definite scorpion venom antibacterial peptide BmKAMP
1To colibacillary minimum inhibitory concentration greater than 100 μ g/ml.
Embodiment 19: scorpion venom peptide BmKAMP
1Medicine is to the inhibition test of Pseudomonas aeruginosa (CCTCC:AB93066)
Be coated with flat band method: 1. Pseudomonas aeruginosa (Pseudomonas aeroginosa) is cultivated OD
600=0.8 o'clock, get 800 μ l after diluting 400 times and join in the sterilization test tube, add the BmKAMP of 200 μ l to test tube respectively then through proportional diluted
1, reaching final concentration is 100 μ g/ml, 10 μ g/ml, 1 μ g/ml, 0.1 μ g/ml.Negative control and positive control hole add the kantlex (final concentration is 20 μ g/ml) of 200 μ l, 1% BSA and 200 μ l respectively; 2. from 37 ℃, after 250 commentaries on classics cultivations each test tube bacterium liquid after 6 hours is done suitable dilution, get 10 μ l spread plates, to guarantee that the colony number that the negative control bacterium forms is 50-300, so that count; 3. the first round is determined medicine BmKAMP
1The minimum inhibitory concentration of 10 times of dilutions after, minimum inhibitory concentration is carried out 2 times of proportional diluted, the preceding 1. 2. step of revision test.Final definite scorpion venom antibacterial peptide BmKAMP
1When concentration reaches 100 μ g/ml, to still unrestraint effect of Pseudomonas aeruginosa.
96 orifice plate culture methods: (1) cultivates OD with Pseudomonas aeruginosa
600=0.8 o'clock, get 80 μ l after diluting 400 times and join in 96 orifice plates, add the BmKAMP of 20 μ l to porous respectively then through proportional diluted
1, reaching final concentration is 100 μ g/ml, 10 μ g/ml, 1 μ g/ml, 0.1 μ g/ml.Negative control and positive control hole add the kantlex (final concentration is 20 μ g/ml) of 20 μ l1%BSA and 20 μ l respectively; Cultivate after 12 hours for (2) 37 ℃, survey the light absorption value at 600nM wavelength place in each hole in 96 orifice plates with microplate reader; (3) determine medicine BmKAMP
1The minimum inhibitory concentration of 10 times of dilutions after, minimum inhibitory concentration is carried out 2 times of proportional diluted, preceding (1) (2) step of revision test.Final definite scorpion venom antibacterial peptide BmKAMP
1To the minimum inhibitory concentration of green pseudomonas greater than 100 μ g/ml.
Embodiment 20: scorpion venom peptide BmKAMP
1The molecular designing of mutant
According to BmKAMP
1The mature peptide sequence, utilize software ANTHEPROT 2000 to show its secondary structure images.The result shows, BmKAMP
1Has typically amphipathic (amphiphilic) α-Helix structure.Based on BmKAMP
1The α of mature peptide aminoacid sequence-Helix structure, amphipathic and iso-electric point adopts point mutation with BmKAMP
1The 3rd Gly of mature peptide aminoacid sequence becomes Arg, and the 6th Pro becomes Lys, and the 10th Gly becomes Lys and the 11st Gly becomes Arg.Its mutant scorpion venom antibacterial peptide BmKAMP
1The aminoacid sequence of-M is: FIKRIARLLRKIF-NH2, its sequence is the aminoacid sequence shown in the SEQ ID NO:3.
Embodiment 21: scorpion venom peptide mutant BmKAMP
1-M medicine is to the inhibition test of Gram-negative bacteria and gram-positive microorganism
96 orifice plate culture methods: 1. respectively intestinal bacteria, Pseudomonas aeruginosa (Gram-negative bacteria) and streptococcus aureus, the yellow micrococci sun of Teng, subtilis, bacillus thuringiensis (gram-positive microorganism) are cultivated OD
600=0.8 o'clock, get 80 μ l after diluting 400 times and join in 96 orifice plates, add the BmKAMP of 20 μ l to porous respectively then through proportional diluted
1-M, reaching final concentration is 100 μ g/ml, 10 μ g/ml, 1 μ g/ml, 0.1 μ g/ml.Negative control and positive control hole add kantlex (Gram-negative bacteria: final concentration is 20 μ g/ml) or the penicillin (gram-positive microorganism: final concentration is 50 μ g/ml) of 20 μ l, 1% BSA and 20 μ l respectively; 2. cultivate after 12 hours for 37 ℃, survey the light absorption value at 600nM wavelength place in each hole in 96 orifice plates with microplate reader; 3. determine medicine BmKAMP
1Behind the minimum inhibitory concentration of 10 times of dilutions of-M, minimum inhibitory concentration is carried out 2 times of proportional diluted, the preceding 1. 2. step of revision test.Final definite scorpion venom antibacterial peptide BmKAMP
1-M is to the minimum inhibitory concentration of bacterium.Mutant scorpion venom antibacterial peptide BmKAMP
1-M is 3 μ g/ml, the yellow micrococcal MIC of Teng is 50 μ g/ml, the MIC of subtilis is 6 μ g/ml, is 10 μ g/ml to the minimal inhibitory concentration MIC of bacillus thuringiensis the MIC of gram positive bacterium streptococcus aureus, and BmKAMP
1-M is 10 μ g/ml, is 50 μ g/ml to the MIC of Pseudomonas aeruginosa the colibacillary MIC of Gram-negative bacteria.Mutant BmKAMP
1-M and wild-type BmKAMP
1Compare, its resistance to Gram-negative bacteria strengthens greatly.
Embodiment 22:BmKAMP
1And BmKAMP
1-M medicine is to the inhibition test of resistance staphylococcus haemolyticus
The strain of resistance staphylococcus haemolyticus: a strain staphylococcus haemolyticus of Hubei Province clinical laboratory of healthcare hospital for women ﹠ children acute isolation, through being accredited as MRCNS (cephalosporin analog antibiotic tolerance), numbering " 1538 ".
96 orifice plate culture methods: 1. the resistance staphylococcus haemolyticus is cultivated OD
600=0.8 o'clock, get 80 μ l after diluting 400 times and join in 96 orifice plates, add the BmKAMP of 20 μ l to porous respectively then through proportional diluted
1Or BmKAMP
1-M, reaching final concentration is 100 μ g/ml, 10 μ g/ml, 1 μ g/ml, 0.1 μ g/ml.Negative control and positive control hole add the penbritin (final concentration is 50 μ g/ml) of 20 μ l1%BSA and 20 μ l respectively; 2. cultivate after 12 hours for 37 ℃, survey the light absorption value at 600nM wavelength place in each hole in 96 orifice plates with microplate reader; 3. determine medicine BmKAMP
1Or BmKAMP
1Behind the minimum inhibitory concentration of 10 times of dilutions of-M, minimum inhibitory concentration is carried out 2 times of proportional diluted, the preceding 1. 2. step of revision test.Final definite scorpion venom antibacterial peptide BmKAMP
1And BmKAMP
1-M is respectively 5 μ g/ml and 2.5 μ g/ml to the minimum inhibitory concentration of resistance staphylococcus haemolyticus.
Antibacterial spot laboratory method: the resistance staphylococcus haemolyticus spot overnight incubation of fresh inoculation, with aseptic medical cotton stick picking colony, be diluted to 0.5 Maxwell concentration with aseptic physiological saline, with aseptic cotton carrier above-mentioned bacteria suspension evenly is applied to the 9cm flat board; Be to add 20 μ l polypeptide solutions on the filter paper of 5mm to the diameter of having sterilized, make finally to contain 50 μ g polypeptide on the scraps of paper, then these scraps of paper are attached on the flat board.Negative control is 20 μ l1%BSA, and positive control is the antibiotic filter paper that contains of Britain Oxoid company production, is respectively erythromycin (15 μ g) and vancomycin (30 μ g); After treating that the scraps of paper post, flat board is inverted overnight incubation, observes antibacterial spot size.Consequently inhibition zone does not appear in erythromycin sample and 1%BSA, and vancomycin sample has the inhibition zone of 20mm, scorpion venom antibacterial peptide BmKAMP
1And BmKAMP
1The inhibition zone size of-M medicine is respectively 12mm and 14mm.
SEQUENCE?LISTING
＜110〉Wuhan University
＜120〉a kind of East-Asia scorpion antibiotic peptide gene and preparation method and application
＜130〉a kind of East-Asia scorpion antibiotic peptide gene and preparation method and application
<160>3
<170>PatentIn?version?3.1
<210>1
<211>338
<212>DNA
<213>Mesobuthus?martensi
<400>1
<210>2
<211>13
<212>PRT
<213>Mesobuthus?martensi
<400>2
<210>3
<211>13
<212>PRT
<213>Mesobuthus?martensi
<400>3
Claims (2)
1, a kind of isolating protein, its sequence are the aminoacid sequence shown in the SEQ ID NO:3.
2, the described a kind of isolating protein of claim 1 is preparing treatment or prevention to the application in the medicine of gram-bacteria.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2007100519653A CN100537748C (en) | 2007-04-26 | 2007-04-26 | A kind of East-Asia scorpion antibiotic peptide gene and preparation method and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2007100519653A CN100537748C (en) | 2007-04-26 | 2007-04-26 | A kind of East-Asia scorpion antibiotic peptide gene and preparation method and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101063102A CN101063102A (en) | 2007-10-31 |
| CN100537748C true CN100537748C (en) | 2009-09-09 |
Family
ID=38964387
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNB2007100519653A Active CN100537748C (en) | 2007-04-26 | 2007-04-26 | A kind of East-Asia scorpion antibiotic peptide gene and preparation method and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN100537748C (en) |
Families Citing this family (14)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101914140B (en) * | 2010-08-20 | 2012-01-11 | 武汉大学 | Scorpion source antivirus active polypeptide and application thereof |
| CN101948842B (en) * | 2010-09-02 | 2012-07-04 | 武汉大学 | Heterometrus spinifer poison antibacterial polypeptide gene and preparation method and application thereof |
| CN102295683B (en) * | 2011-08-24 | 2014-12-31 | 武汉摩尔生物科技有限公司 | Anti-herpes simplex virus polypeptide and its application |
| CN102382839A (en) * | 2011-10-26 | 2012-03-21 | 武汉大学 | Anti-herpes simplex virus (HSV) active polypeptide of Tibetan Pi scorpion and application thereof |
| CN103304630B (en) * | 2012-03-07 | 2014-09-17 | 中国科学院大连化学物理研究所 | GPCR active polypeptide in scorpion venom of Buthus martensii Karsch, and extracting separation and application thereof |
| CN103360464A (en) * | 2013-07-17 | 2013-10-23 | 武汉摩尔生物科技有限公司 | Polypeptide, DNA molecule encoding polypeptide, vector, preparation method and application thereof |
| CN104263749B (en) * | 2014-01-23 | 2017-03-29 | 深圳市圣西马生物技术有限公司 | A kind of expression of scorpion derived antimicrobial peptide IsCT in Pichia pastoris and its clinically application for the treatment of infectious trauma |
| CN103882029B (en) * | 2014-03-31 | 2017-03-08 | 中国地质大学（武汉） | A kind of Africa emperor's scorpion antibiotic peptide gene, antibacterial peptide Pi_4, its structure homology antibacterial peptide, preparation method and application |
| CN103865935B (en) * | 2014-03-31 | 2016-10-05 | 中国地质大学（武汉） | A kind of Africa yellow pawl scorpion antibiotic peptide gene, antibacterial peptide Os_116, its structure homology antibacterial peptide, preparation method and application |
| CN105153285B (en) * | 2015-09-17 | 2018-03-30 | 北京化工大学 | Antibacterial peptide |
| CN106432426B (en) * | 2016-11-09 | 2019-10-29 | 湖南科技学院 | It can inhibit and kill the antibacterial peptide of gram-positive bacteria and Gram-negative bacteria |
| CN111423501B (en) * | 2020-03-30 | 2022-02-08 | 东北农业大学 | Antibacterial peptide derived from scorpion venom as well as preparation method and application thereof |
| CN114349825B (en) * | 2021-12-30 | 2023-06-23 | 珠海市人民医院 | Scorpion venom derivative peptide and application thereof in preparation of antibacterial or anti-inflammatory drugs |
| CN117551175B (en) * | 2024-01-10 | 2024-03-19 | 内蒙古农业大学 | Antibacterial peptide PLN-2 and application thereof |
-
2007
- 2007-04-26 CN CNB2007100519653A patent/CN100537748C/en active Active
Non-Patent Citations (2)
| Title |
|---|
| Identification and functional characterizationofnovelscorpionvenom peptides with no disulfide bridgefromButhusmartensii Karsch. Zeng X C et al.Peptides,No.25. 2004 |
| Identification and functional characterizationofnovelscorpionvenom peptides with no disulfide bridgefromButhusmartensii Karsch. Zeng X C et al.Peptides,No.25. 2004 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101063102A (en) | 2007-10-31 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN100537748C (en) | A kind of East-Asia scorpion antibiotic peptide gene and preparation method and application | |
| Seo et al. | Purification and antimicrobial function of ubiquitin isolated from the gill of Pacific oyster, Crassostrea gigas | |
| CN101063103B (en) | Hainan sporic scorpion antibiotic and preparation method and application | |
| CN101450966B (en) | Polypeptide of antimicrobial agent and use | |
| CN101948842B (en) | Heterometrus spinifer poison antibacterial polypeptide gene and preparation method and application thereof | |
| Shang et al. | Molecular cloning of cDNAs encoding antimicrobial peptide precursors from the skin of the Chinese brown frog, Rana chensinensis | |
| Chen et al. | Mj-DWD, a double WAP domain-containing protein with antiviral relevance in Marsupenaeus japonicus | |
| Conlon et al. | Purification and characterization of antimicrobial peptides from the skin secretions of the carpenter frog Rana virgatipes (Ranidae, Aquarana) | |
| CN103214583A (en) | Secretory expression method of bacteriocin lacticin Q | |
| CN106496333A (en) | One kind expresses hybrid peptide and preparation method and application using bacillus subtilis | |
| CN112852794B (en) | Clostridium perfringens bacteriophage lyase and application thereof | |
| Huo et al. | Molecular characterization, antibacterial activity and mechanism analyzation of three different piscidins from black rockfish, Sebastes schlegelii | |
| CN101602792B (en) | Novel antibacterial lipopeptid and preparation and application thereof | |
| Yin et al. | A specific antimicrobial protein CAP-1 from Pseudomonas sp. isolated from the jellyfish Cyanea capillata | |
| CN102586262B (en) | Defensin gene of antimicrobial peptide of bemisia tabaci (Gennadius), antimicrobial peptide encoded by defensin gene and preparation method for defensin gene | |
| CN103965340A (en) | Antibacterial peptides from hylarana guentheri and application of antibacterial peptides | |
| KR102510118B1 (en) | Bacteriophage CAP-1 with growth inhibition activity against Cutibacterium acnes | |
| CN114703152B (en) | Bockholdele-like phage vB_ BpP _HN01 for treating meliter and application thereof | |
| CN102516382B (en) | Antimicrobial peptide Hainanenin-5 of Amolops hainanensis, gene of antimicrobial peptide Hainanenin-5 of Amolops hainanensis, and application of gene of antimicrobial peptide Hainanenin-5 of Amolops hainanensis | |
| CN102796176B (en) | Kunyuenin, preparation method and application | |
| CN107266546A (en) | Antibacterial peptide HlDFS1 and its application | |
| CN103467580B (en) | Preparation method and application of artificial antimicrobial peptide MA-D4 | |
| CN112321697A (en) | Hermetia illucens antibacterial peptide Cecropin-alpha and application thereof | |
| CN101392252B (en) | Lychas mucronatus Kv1.3 blocker gene, preparation method and application | |
| CN114736894B (en) | Chimeric enzyme ClyQ for degrading staphylococcus biofilm and preparation method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C41 | Transfer of patent application or patent right or utility model | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20090123 Address after: Hubei province Wuhan Wuluo road A Asian Trade Plaza No. 628 room 2401 post encoding: 430072 Applicant after: Tang Kehuang Address before: Hubei city of Wuhan province Wuchang Luojiashan post encoding: 430072 Applicant before: Wuhan University |
|
| ASS | Succession or assignment of patent right |
Owner name: TANG KEHUANG Free format text: FORMER OWNER: WUHAN UNIVERSITY Effective date: 20090123 |
|
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| PE01 | Entry into force of the registration of the contract for pledge of patent right |
Denomination of invention: East-Asia scorpion antibiotic peptide gene and preparation method and application Effective date of registration: 20140813 Granted publication date: 20090909 Pledgee: China Co truction Bank Corp Wuhan Optics Valley branch Pledgor: Wuhan More Biotechnology Co., Ltd. Registration number: 2014990000653 |
|
| PLDC | Enforcement, change and cancellation of contracts on pledge of patent right or utility model | ||
| PLDC | Enforcement, change and cancellation of contracts on pledge of patent right or utility model | ||
| PM01 | Change of the registration of the contract for pledge of patent right |
Change date: 20160606 Registration number: 2014990000653 Pledgee after: China Co truction Bank Corp Wuhan Optics Valley branch Pledgee before: China Co truction Bank Corp Wuhan Optics Valley branch |
|
| PC01 | Cancellation of the registration of the contract for pledge of patent right |
Date of cancellation: 20160614 Granted publication date: 20090909 Pledgee: China Co truction Bank Corp Wuhan Optics Valley branch Pledgor: Wuhan More Biotechnology Co., Ltd. Registration number: 2014990000653 |
|
| PLDC | Enforcement, change and cancellation of contracts on pledge of patent right or utility model | ||
| PE01 | Entry into force of the registration of the contract for pledge of patent right |
Denomination of invention: East-Asia scorpion antibiotic peptide gene and preparation method and application Effective date of registration: 20160622 Granted publication date: 20090909 Pledgee: China Co truction Bank Corp Wuhan Optics Valley branch Pledgor: Wuhan More Biotechnology Co., Ltd. Registration number: 2016420000023 |
|
| PLDC | Enforcement, change and cancellation of contracts on pledge of patent right or utility model |