CN101914140B - Scorpion source antivirus active polypeptide and application thereof - Google Patents

Abstract

The invention discloses a scorpion source antivirus active polypeptide and application thereof. Scorpion source anti-hepatitis C virus polypeptide AVP-W3 is obtained by a molecular biology method and a chemical synthesis method; antivirus activity of the scorpion source active polypeptide on the hepatitis C virus (HCV) is measured by a quantitative PCR method in real time; and HCV virus infection can be effectively suppressed at a low concentration. The scorpion source active polypeptide AVP-W3 has broad prospect in preparation of medicaments applied to treating or preventing diseases caused by HCV virus. The antivirus polypeptide of the invention has the advantages of high activity on the HCV, simple and convenient method and capability of being developed as anti-HCV virus medicaments.

Description

A kind of scorpion source antivirus active polypeptide and uses thereof

Technical field

The invention belongs to biological technical field, relate to the active polypeptide of the antiviral function of a kind of scorpion source tool.

Background technology

(hepatitis C virus is the main pathogens of a kind of non-A non-B hepatitis of being identified in 1989 HCV) to hepatitis C virus, causes human hepatitis C, infects to be worldwide distribution.Investigation shows that the infection rate of global HCV is about 3%, about 1.7 hundred million people's HCV infection.High popular district during China HCV infects and belongs to, average infection rate is 3.2%.HCV infects and is prone to chronicity, and its chronicity rate can be up to 85%, and part chronic hepatitis C patient finally can develop into hepatic fibrosis, liver cirrhosis even hepatocellular carcinoma.Therefore, HCV infects human beings'health is caused great harm.

HCV belongs to flaviviridae (flaviviridae), is tunicary single normal chain picornavirus, is made up of coating, capsid and core three parts.The outermost layer coating derives from host cell membrane, wherein is embedded with the E1 and the E2 albumen of virogene group coding mutually, and capsid mainly is made up of core protein (C albumen), and core is a sub-thread positive chain RNA.Its genome is about 9.6kb; Both sides are 5 ' and 3 ' non-coding region; The centre is an opening code-reading frame; The polyprotein that contains more than 3000 amino-acid residue of encoding, the protease cracking through cell and virus is structural protein C, E1 and E2 and Nonstructural Protein NS2, NS3, NS4A, NS4B, NS5A and NS5B.The variation of HCV genome height, especially HCV hypervariable region (HVR) variation is bigger.

HCV combines with cell receptor through the E1 on the coating, E2 and discharges positive chain RNA; And under the catalysis of the NS5BRdRp of encoding viral (RNA polymerase that RNA relies on), carry out the synthetic of RNA minus strand; Copy a large amount of normal chain through minus strand again, the viral protein that produces with the cracking of polyprotein body is packaged as ripe virion.In the replicative cycle of whole HCV virus; There are several the key links to can be used as the action target spot of antiviral: the processing of viral polyprotein body (NS3-NS4A Tryase); The transcribing and duplicating of virogene (NS5B RdRp polysaccharase, NS3 helicase); The regulation and control of duplicating expression of virogene (controlling element such as IRES), the penetrating of viral pair cell (E1, E2 albumen) etc.Any one link of destroying or suppressing wherein all can effectively be controlled duplicating of HCV virus.

Each link research and development anti-HCV medicament to the HCV virus replication is just like a raging fire; Like the NS2-NS3 proteinase inhibitor, the suppressor factor of NS3-NS4A Tryase, NS5B RdRp AG14361; NS3 helicase/ribonucleoside triphosphote enzyme inhibitors, IRES antisense nucleic acid etc.Yet, effectively be merely nonspecific drug Interferon, rabbit and ribavirin combination therapy hepatitis C at present clinically, but be not all effective all chronic hepatitis C patients.Add that HCV self genetic material is unstable, undergo mutation easily, thereby make vaccine reduce or complete failure the prophylactic effect of this new mutated viruses.And also there is not effective HCV vaccine at present clinically.Therefore, novel, the low toxicity of research and development, special anti-HCV virus drugs are imperative.

The positively charged ion defense peptides is one type and is generated by the host, and one type of little peptide of the defensive effect of specificity performance in the natural immunity.This small molecule polypeptide is made up of 10-50 amino acid usually, and static charge from+2 to+9 does not wait, and in organism is resisted the invasion of mikrobe, plays an important role.According to the difference of structure, the positively charged ion defense peptides can be divided into following several types: contain amphipathic molecule, amphiphilic, the coiled structure of 2-4 β lamella and the molecule that contains higher structure.The positively charged ion defense peptides all has the effect of effectively resisting to bacterium, fungi, parasite and infecting of virus in vivo.Research shows; Melittin Melitiin and cecropin Cecropins express the propagation that suppresses HIV-1 virus through repressor gene under inferior toxicity concentration; MSI-344 Magainin-2 has certain inhibition effect to simplexvirus HSV-1 and HSV-2, and these polypeptide all are α Corkscrews positively charged ion defense peptides.Present research shows that α Corkscrews positively charged ion defense peptides specific effect is in tunicary RNA viruses and dna virus, and its mode of action normally acts on the process that virus gets into, or directly acts on the coating of virus.For example, Dermaseptin causes the inactivation of HIV through the coating that acts on HIV, thereby reaches antiviral effect.So the positively charged ion defense peptides no longer is the traditional vaccine control, but reaches antiviral purpose through direct inhibition virus.

The research of positively charged ion defense peptides has also had history for many years in the scorpion.Except the defense peptides of from lymphsystem, finding, more be the defense peptides that from the scorpion venom gland, is separated to wherein, Hadrurin for example, Scorpine, Opistoporin, Parabutoporin, ISCT, Pandinin.The function of these peptides is all effectively identified.The inventor belongs to the research that scorpion toxin is engaged in the laboratory for a long time, from the library, screens and differentiated serial cationic polypeptide at present.

Summary of the invention

Technical problem to be solved by this invention is to provide a kind of anti-hepatitis c virus active high cationic polypeptide.

To achieve these goals; At first make up high quality Scorpio poison gland tissue cDNA library, specifically comprise separation and the mRNA purifying of the total RNA of scorpion venom gland, first chain of cDNA and second chain are synthetic; Double-stranded cDNA is connected and conversion with the pSPORT1 carrier, obtains scorpion venom glandular tissue cDNA library.On the basis that makes up the library, random choose 50 clone's check order, and sequential analysis finds that W3 clone is a new East-Asia scorpion antibiotic peptide gene, called after avp-w3.

The invention discloses a kind of isolated polypeptide gene avp-w3, its sequence is the nucleotide sequence shown in the SEQ ID NO:1: gacctctcccaacagaaacaccagaaatatttttgccactagtccaccaaactgtc gagaatgaagactcagtttgccatcttcctcatcaccctagttctgtttcaaatgt tctcccagtcggatgctatcttcaaggctatctggagtggaattaagagcctgttc ggaaagagaggattgagcgacctagatgacctcgatgagtcgttcgatggagaagt ctcacaggccgatattgacttcctgaaagaactaatgcaatagtttcaacgtaatt acgatggacgtttaacattgctcctttctagatttcgcgaaatgctaccgagttat ttcatacattaaacgataaataaaatacttttctgccaaaaaaaaaaaaaaaaaaa aaaaaaa.68 amino-acid residues of the prosoma organization form coding of avp-w3 are made up of three parts, i.e. signal peptide (23 residues), mature peptide (13 residues) and precursor peptide (32 residues).Based on the processing rule of scorpion toxin precursor C-terminal residue, the terminal last residue Phe of avp-w3 is by specificity carboxypeptidase (Carboxy-peptidase) excision, and by amidated, as shown in Figure 1, cDNA sequence below is the corresponding amino sequence of inferring; Signal peptide amino acid is with single underscore mark; Mature peptide amino acid is with the black matrix mark; The square frame partial amino-acid is the carboxypeptidase recognition site; Dash area amino acid is C end precursor peptide.Therefore, the present invention provides a scorpion source antivirus active polypeptide AVP-W3, and its sequence is shown in the SEQ ID NO:2: IFKAIWSGIKSLF.

The invention discloses a kind of AVP-W3 polypeptide of efficient anti-hepatitis c virus, its sequence is the aminoacid sequence shown in the SEQ ID NO:2.Through solid state chemistry synthetic way, obtained purity and reached the synthetic polypeptide A VP-W3 more than 95%.Antiviral result shows the efficient restraining effect of synthetic polypeptide A VP-W3 to HCV propagation, and when 20 μ g/mL, AVP-W3 just can reach 100% inhibition to the inhibiting rate of HCV.

The present invention discloses the application of scorpion source antivirus active polypeptide AVP-W3 in the medicine of preparation prevention or treatment HCV infection.Scorpion source antivirus active polypeptide of the present invention has the function that suppresses virus infection, suppresses effective, has no side effect, and it is remarkable by the caused infectious effect of HCV in prevention and treatment.

The invention also discloses the medicine that prevention or treatment HCV infect, wherein contain the AVP-W3 polypeptide.

The AVP-W3 antimicrobial polypeptide that the present invention relates to only contains 13 amino acid, and production cost is low, good water solubility.For HCV good inhibition effect is arranged, and be free from side effects.Compare with existing antiviral, have more directly and effective function.

Description of drawings

Fig. 1 scorpion source antivirus active polypeptide AVP-W3 gene and amino acid thereof.

The HPLC purity figure of Fig. 2 embodiment 2 gained scorpion source antivirus active polypeptide AVP-W3.

Fig. 3 embodiment 2 gained scorpion source antivirus active polypeptide AVP-W3 mass spectrums are identified the molecule spirogram.

The quantitative analysis of Fig. 4 different concns scorpion source antivirus active polypeptide AVP-W3 effect cells infected supernatant HCV viral RNA.

HCV viral RNA relative quantitative assay in Fig. 5 different concns scorpion source antivirus active polypeptide AVP-W3 effect cells infected born of the same parents.

The quantitative analysis of Fig. 6 scorpion source antivirus active polypeptide AVP-W3 different modes of administration effect cells infected supernatant HCV viral RNA.

HCV viral RNA relative quantitative assay in Fig. 7 scorpion source antivirus active polypeptide AVP-W3 different modes of administration effect cells infected born of the same parents.

Embodiment

Following embodiment can make those skilled in the art more fully understand the present invention, but does not limit the present invention in any way.

Embodiment 1: a kind of preparation of scorpion venom antiviral polypeptide gene.Step is following:

A: the extraction of the total RNA of scorpion venom gland (Trizol LS single stage method: Trizol LS is available from American I nvitrogen)

1. the scorpion tail gland of getting 500mg is ground into fine powder in liquid nitrogen, add 10ml TRIZOL reagent mixing, and room temperature (20-25 ℃, below identical) was placed 5 minutes; 2. add the 2ml chloroform then and mixed 15 seconds, room temperature was placed 2-3 minute, centrifugal 15 minutes of 4 ℃ of following 12000g; 3. the 1 times of volume Virahol of addition of fetching water, room temperature was placed 10 minutes, centrifugal 10 minutes of 4 ℃ of following 12000g the RNA deposition; 4. deposition is used 5ml75% washing with alcohol, centrifugal 5 minutes of 7500g; 5. be dissolved in the DEPC treating water after the RNA deposition drying, 55-60 ℃ is incubated 10 minutes with thorough dissolving RNA.Whole process is carried out with reference to TRlZOL (Total RNAIsolation) Reagent Kit recommend method.The total RNA of the scorpion venom gland of preparation adopts its quality of denaturing formaldehyde detected through gel electrophoresis.Obtained the total RNA of high-quality scorpion venom gland.

The separation and purification of B:mRNA

Adopt PolyA Tract mRNA separation system (Promega; USA) separation and purified mRNA; Its principle of work is based on Oligo (dT) and the complementary pairing characteristic that mRNA 3 ' holds poly (A) tail, with biotin labeling Oligo (dT), holds the annealing of poly (A) to form crossbred through it and mRNA3 '; Catch and wash vitamin H Oligo (dT)/mRNA crossbred with indicating affinity plain magnetic bead and magnetic separation rack then, use the sterilization distilled water (ddH of no RNA enzyme at last ₂O) it is eluted, reach the purpose of separating mRNA from total RNA.1. the preparation of sample: RNA is joined in the binding buffer liquid of the 800 μ l that contain 32 μ l beta-mercaptoethanols.2. the annealing of probe: get 250pmol/l concentration Oligo (dT) 5 μ l, adding distil water to 50 μ l; The dilution buffer liquid (dilution buffer liquid has added 32 μ l beta-mercaptoethanols) that adds the 1.6ml preheating, with the RNA mixing, 70 ℃ of incubations 5 minutes.3. the activation of magnetic bead: the magnetic bead SA-PMPS (available from beautiful Promega) that gets 1.2ml is in the centrifuge tube of 1.5ml; With the resuspended SA-PMPS of 0.5 * SSC, with magnet stand absorption magnetic bead, original volume 0.5 * SSC washing SA-PMPS3 time.4. obtaining of mRNA: the RNA of 70 ℃ of incubations is mixed with SA-PMPS, and room temperature is placed to put in 5 minutes and is adsorbed magnetic bead on the magnet stand, abandons supernatant; The 0.5XSSC suspension magnetic bead of 2ml, SSC is removed in washing repetition 2 times for the last time as far as possible; The ddH that adds no RNA enzyme ₂O to magnetic bead, mixing gently, centrifugal then (12000g * 3 minute) or magnet stand absorption magnetic bead; Get supernatant, obtain mRNA.Concentration and purity through electrophoresis and ultraviolet determination mRNA.5. the deposition of mRNA: add the absolute ethyl alcohol of glycogen and 2.5 times of volumes among the mRNA that will 4. obtain, deposition is spent the night, and mRNA will be used for the synthetic of cDNA.

C: the first chain cDNA is synthetic

1. in 1.5ml Ep pipe, add 2 μ l Not I Primer-adapter and 6 μ l mRNA (containing 3 μ g mRNA), 70 ℃ of incubation 10min are put in rapidly on ice, centrifugal after, add following ingredients: 4 μ l 5X first strand buffer; 2 μ l 0.1mol/l DTT; 1 μ l 10mmol/l dNTPs; 1 μ l H ₂O.Centrifugal behind the mixing gently, put to 2min for 37 ℃; 2. add 5 μ l reversed transcriptive enzymes, get 2 μ l behind the mixing, add 1 μ l [α- ³²P] dCTP (4 μ Ci) (spike pipe).With above-mentioned reactive component (sample hose) while 37 ℃ of incubation 1h, put into termination reaction on ice then; 3. for the spike pipe, add 43 μ l 20mmol/l EDTA and 5 μ l yeast tRNA successively, behind the mixing; Get respectively two part 10 μ l o'clock on two filter membranes, wash 3 times each 5min for 1 part with 10%TCA; 95% ethanol is washed 1 time, and after the dry air, putting into the 1.5ml scintillation solution (is 1 ^#Sample); After other 1 part of dry air, putting into the 1.5ml scintillation solution (is 2 ^#Sample).30 μ l traced fluids add 1.5 μ l 7.5mol/l Ammonium Acetate (NH in addition ₄Oac) and 90 μ l absolute ethyl alcohols (20 ℃), behind the mixing immediately 14, the centrifugal 20min of 000rpm; Abandon supernatant, add 0.5ml 70% absolute ethyl alcohol (20 ℃), 14; The centrifugal 2min of 000rpm abandons supernatant, and 37 ℃ of dry 10min let ethanol volatilize; Be dissolved in 10 μ l TEN solution, add 10 μ l2X sample loading buffers, get 10 μ l and be used for alkaline gel electrophoresis.With [α- ³²P] dCTP mark λ DNA HindIII fragment makes molecular weight marker; 4. room temperature held 15min behind the mixing adds 2 μ l 0.2mol/l EDTA termination reactions.Get 6 μ l reaction solutions and 6ml2X alkalescence electrophoretic buffer mixing, behind the electrophoresis 5h, soak 20min, until the bromjophenol blue flavescence with 7%TCA.Blot (about 8h) with toilet paper then, carry out radioautograph; 5. for sample hose, be used for the synthetic of second chain.

HindIII 10X damping fluid 2 μ l

dGTP 0.2mmol/l

dATP 0.2mmol/l

[α- ³²P]dCTP 2μCi

Hind?III?markers 1μg

Klenow archaeal dna polymerase 2unit

Mend ddH ₂O is to TV 20 μ l

D: the second chain cDNA is synthetic

1. in sample hose, add following ingredients on ice successively; 2. gently behind the mixing, 16 ℃ of incubation 2h; 3. add 2 μ l (10units) T ₄Archaeal dna polymerase continues 16 ℃ of reaction 5min; 4. change on ice, add 10 μ l 0.5mol/l EDTA; 5. add equal-volume (150 μ l) phenol/chloroform/primary isoamyl alcohol (25/24/1), thoroughly behind the vortex, under the room temperature 14, the centrifugal 5min of 000rpm.Change water (140 μ l) over to another 1.5ml Ep pipe; 6. the 7.5mol/l NH that adds 70 μ l ₄OAc and 0.5ML absolute ethyl alcohol (20 ℃), behind the vortex, under the room temperature 14, the centrifugal 20min of 000rpm; 7. abandon supernatant, add 0.5ml 70% ethanol (20 ℃), the same centrifugal 2min.Abandon supernatant, 37 ℃ of dry 10min.

DEPC treating water 92 μ l

5X?second?strand?buffer 30μl

10mmol/l?dNTP?mix 3μl

E.coli dna ligase (10units/ μ l) 1 μ l

E.coli archaeal dna polymerase (10units/ μ l) 4 μ l

E.coli?RNase?H(2units/μl) 1μl

TV 150 μ l

E: double-stranded cDNA is connected with the SalI adapter

1. dissolve the cDNA sample of real D with 25 μ l aqua sterilisas, according to the form below adds successively then; 2. mixing gently, 16 ℃ of reactions spend the night (about 20h).3. use (25/24/1) extracting of phenol/chloroform/primary isoamyl alcohol and NH ₄Behind the Oac/ ethanol sedimentation, 37 ℃ of dry 10min.

5X?T ₄DNA?ligase?buffer 10μl

Sal?I?adapters 10μl

T ₄Dna ligase 5 μ l

TV 50 μ l

F:Not I digests double-stranded cDNA

1. the sample with E is dissolved in 41 μ l, and according to the form below adds successively then; 2. behind the mixing, 37 ℃ of incubation 2h; 3. use phenol/chloroform/primary isoamyl alcohol (25/24/1) extracting once, use 7.5mol/l NH then ₄Oac/ alcohol deposition, 37 ℃ of dry 10min.4. be dissolved in 70 μ lTEN, get 1 μ l and be used for quantitatively, all the other-20 ℃ of preservations are subsequent use.

REACT?3?buffer 5μl

Not?I 4μl

TV 50 μ l

G: excessive Sal I adapter and the enzyme removed in the double-stranded cDNA molecule are cut small segment

(Amersham USA) removes excessive Sal I adapter and enzyme and cuts small segment with nucleon extraction and purification kit.1. room temperature low suspension resin is got 600 μ l then and is added in the centrifugal post, and the centrifugal 10s of 2000rpm removes liquid.Central authorities add the above-mentioned cDNA solution of 40 μ l at resin.The same centrifugal; 2. collect elutriant and be used for ligation.

H: double-stranded cDNA is connected and conversion with the pSPORT1 carrier

1. in 1.5ml Ep pipe, add following ingredients successively; 2. react 16h under the room temperature; 3. in 2. reaction solution, add following ingredients successively: 5.0 μ l yeast tRNA, 12.5 μ l 7.5mol/l NH4Oac, 70 μ l absolute ethyl alcohols (20 ℃).14000 centrifugal 20min immediately behind the vortex mixing; 4. deposition is dissolved in 4 μ l with 70% ethanol (20 ℃) washing after 37 ℃ of dryings; 5. get 2 μ l electric shock and transform 50 μ l E.coli K12 MC1061.Identify the quality in library, forward primer: 5 ' TCGACCCACGCGTCCG 3 ' (SEQ ID NO:3 presses SalI adapter sequences Design) with PCR method; Reverse primer: 5 ' GAGCGGCCGCCCT15 3 ' (SEQ ID NO:4, the sequences Design of pressing NotI primer-adapter).

5X T ₄Dna ligase damping fluid 4 μ l

pSPORT1，Not?I-Sal?I-Cut(50ng/μl) 1μl

cDNA(3ng/μl) 4μl

T ₄Dna ligase 1 μ l

Mend ddH ₂O is to TV 20 μ l

I: random sequencing Policy Filtering cDNA library

From the Scorpio poison gland cDNA library that builds, select 50 clone's at random, serve the order-checking of Hai Sanbo company.Sequence typing software is BioEdit v4.5.8 (Tom Hall; 1999); Homology comparison and signal peptide cutting site forecasting software be respectively CLUSTAL X 1.8 (Thompson et al., 1997) and PC/GENE (Intelligenetics Inc., Switzerland).Sequential analysis shows that the sub-W3 of clone is a brand-new antibacterial peptide gene, called after avp-w3.Having the sequence SEQ? ID? NO: 1 shows the nucleotide sequence: gacctctcccaacagaaacaccagaaatatttttgccactagtccaccaaactgtcgagaatgaagactcagtttgccatcttcctcatcaccctagttctgtttcaaatgttctcccagtcggatgctatcttcaaggctatctggagtggaattaagagcctgttcggaaagagaggattgagcgacctagatgacctcgatgagtcgttcgatggagaagtctcacaggccgatattgacttcctgaaagaactaatgcaatagtttcaacgtaattacgatggacgtttaacattgctcctttctagatttcgcgaaatgctaccgagttatttcatacattaaacgataaataaaatacttttctgccaaaaaaaaaaaaaaaaaaaaaaaaaa (Figure 1).68 amino-acid residues of the prosoma organization form coding of avp-w3 are made up of three parts, i.e. signal peptide (23 residues), mature peptide (13 residues) and precursor peptide (32 residues).Based on the processing rule of scorpion toxin precursor C-terminal residue, the terminal last residue Phe of AVP-W3 is excised by specificity carboxypeptidase (Carboxypeptidase), and by amidated.Aminoacid sequence, a kind of isolating Scorpio AVP-W3 peptide sequence, its sequence is IFKAIWSGIKSLF (SEQ ID NO:2).

Embodiment 2: chemosynthesis scorpion source activity polypeptide A VP-W3

Aminoacid sequence (IFKAIWSGIKSLF-FIGAIARLLSKIF) according to AVP-W3 carries out synthetic.Building-up process is following:

1) takes by weighing Rink Resin (resin) 8.772g, measure 120mlNMP and soak 2h, drain.

2) deprotection: earlier with draining behind the 60ml 20% piperidines vibration 10min; Again with draining behind the 60ml 20% piperidines vibration 60min; Add 60ml DMF, 60ml DCM, 60ml MeOH, 80ml DCM * 3 time, 60ml NMP * 3 time then successively, drain behind each 5min that vibrates.

3) activation of amino acid whose carboxyl terminal: measure 40mlNMP with transfer pipet and pour round-bottomed flask dissolving amino acid into; Treat that amino acid dissolves the back fully and adds HOBt; The dissolving back adds DIEA to round-bottomed flask on ice bath; Add HBTU etc. whole solution clarification back, need continue to be placed on the ice bath, shake until HBTU and dissolve.(annotate: HOBt consumption: 2.1283g; DIEA consumption: 5.2066ml; HBTU consumption: 6.0878g; Various amino acid whose requirements are I (Ile): 5.301g, F (Phe): 5.811g, K (Lys): 7.0275g, A (Ala): 4.6695g; I (Ile): 5.301g, W (Trp): 8.324g, S (Ser): 5.76g; G (Gly): 4.4595g, I (Ile): 5.301g, K (Lys): 7.0275g; S (Ser): 5.76g, L (Leu): 5.301g, F (Phe): 5.811g.

4) coupling: pour the activatory amino acid solution into the resin reaction chamber of deprotection, in the flask not evacuation partly use NMP (altogether about 20ml) to wash twice, shaking table oscillatory reaction 2h, 200r/min.

5) washing: add successively 60ml DMF, 60ml MeOH, 80ml DCM, 60ml DMF * 2 time, drain behind each 5min that vibrates.

6) cracking: lysate is joined in the beaker in proportion, stir, add the exsiccant peptide resin again, more than the stirring reaction 3h, 20～30 ℃ of temperature of reaction.Reaction mixture uses the G3 sand core funnel to filter, and collects filtrating, and resin is again with a small amount of TFA washing 2 times; Merging filtrate, 30～35 ℃ are evaporated to about 10% of original volume, liquid concentrator are added in the anhydrous diethyl ether of refrigeration about 4 ℃; Shake up the back and precipitate 60 minutes at 4 ℃ of refrigerators, the G4 sand core funnel filters, collecting precipitation; Again with a small amount of about 4 ℃ refrigeration the anhydrous diethyl ether washed twice, be transferred in the drying tray, at 20～30 ℃ of drying under reduced pressure to constant weight.Obtaining the polypeptide bullion is 5.865g.

7) purifying: the thick product dissolving that takes a morsel earlier, on the HPLC of analysis mode, analyze, confirm purification condition; Then, all thick products are all dissolved, cross the HPLC pillar of preparation type, collect desired polypeptides, freeze-drying has promptly obtained pure polypeptide.Obtaining the pure article of polypeptide is 3.888g.

8) remarks: Fmoc-Rink Resin is available from Tianjin Nankai Hecheng S&T Co., Ltd.; NMP (N-Methyl pyrrolidone), DMF (N, dinethylformamide), DCM (4-(methylene dicyanoethyl)-2-methyl-6-(4-dimethylamino styryl)-4H-pyrans), TFA (trifluoroacetic acid), tri isopropyl silane are all available from Beijing Bo Maijie Science and Technology Ltd.; Hexahydropyridine, anhydrous methanol, absolute ethyl alcohol (analytical pure), diacetyl oxide are all available from Shanghai Chemical Reagent Co., Ltd., Sinopharm Group; HOBt (1-hydroxy benzo triazole; Molecular weight 135.13g/mol), DIEA (N-ethyl diisopropyl amine; Molecular weight 129.3g/mol), HBTU (benzotriazole-N, N, N '; N '-tetramethyl-urea phosphofluoric acid ester, molecular weight 379.3g/mol), Fmoc-AA-OH is all available from the biochemical (Shanghai) Co., Ltd. of gill; 1, the 2-3-mercaptoethanol is available from MerK company; Anhydrous diethyl ether is available from Beijing reagent company; 20% piperidines (NMP of the hexahydropyridine of 20% volume+80% volume); KCN (analytical pure).

With the molecular weight of its synthetic polypeptide of mass spectrum evaluation, as shown in Figure 3.Analyze the purity of its synthetic polypeptide with performance liquid chromatography (HPLC), the result is as shown in Figure 2.

Embodiment 3: antiviral polypeptide AVP-W3 is to the inhibition of hepatitis C virus

Material:

The cultivation of A:Huh7.5.1 cell

Huh7.5.1 clone is transformed structure by people such as Zhong, available from China typical culture collection center.

Substratum: 10% (substratum goes down to posterity) or 2% (keeping substratum) calf serum (FCS, GIBCO-BRL), 56 ℃, 30 minutes heat sterilizations; 2mmol/l/mL D-glutamicacid salt; 100U/mL penicillium mould and 100 μ g/mL Streptomycin sulphates.Culture condition is: 37 ℃, and 5%CO ₂Incubator is cultivated.

B: virus strain

HCV 2a C-type virus C JFH-1 is separated from suffer from explosive HCV patients serum by people such as Wakita and obtains, and is so kind as to give by professor Zhu Ying of life science institute of Wuhan University.

Concrete operation method:

The amplification of A:2a type HCV JFH-1

Huh7.5.1 cell cultures to cell degree of converging～50%, the sucking-off substratum adds JFH-1 viral dilution liquid, and 37 ℃ of absorption 4-6h replenish 10%FBS-DMEM to the normal cultured volume.Behind about 48-72h, treat that cell monolayer covers with after, go down to posterity, with 10%FBS-DMEM cultivate one week the back collect.With cell multigelation 3-5 time, collecting cell and supernatant are to centrifuge tube, and 4 ℃ of centrifugal 10min of 3000-4000rpm remove cell debris, the supernatant packing, and-80 ℃ of preservations are subsequent use.

For measuring the effect of AVP-W3 to virus, attached cell will carry out following three steps and handle:

The B:AVP-W3 polypeptide infects the dose relationship that suppresses to HCV and detects

Huh7.5.1 is inoculated 6 orifice plates with～5 * 105/porocyte amount, 37 ℃, 5%CO ₂Cultivate 24h, dilution AVP-W3 polypeptide is to final concentration 0,6,9,12,15,20 μ g/ml, dilution HCV virus liquid to m.o.i. be 0.1, virus and AVP-W3 polypeptide solution are mixed, hatch 2h for 37 ℃; After serum free medium is washed cell three times, add virus and AVP-W3 polypeptide mixed solution, infect absorption 4-6h; Remove viral liquid, flush away free virus, the substratum that adds the AVP-W3 polypeptide of corresponding concentration continues to cultivate; Collecting infecting cell and supernatant behind the infection 48h extract cell total rna, cut with 37 ℃ of water-bath enzymes of DNaseI and handle 1h.Thereafter hepatitis C virus (HCV) nucleic acid amplification (PCR) the fluorescence quantitative detection kit specification sheets of producing according to Shanghai Kehua Bio-engineering Co., Ltd carries out quantitatively determined to HCV.The quantitative analysis of different concns scorpion source antivirus active polypeptide AVP-W3 effect cells infected supernatant HCV viral RNA is as shown in Figure 4, and X-coordinate is the concentration (μ g/mL) of AVP-W3, and ordinate zou is the titre (copies/mL) that the polypeptide of respective concentration is handled back virus.HCV viral RNA relative quantitative assay is as shown in Figure 5 in the different concns scorpion source antivirus active polypeptide AVP-W3 effect cells infected born of the same parents; X-coordinate is the concentration (μ g/mL) of AVP-W3, and ordinate zou is the concentration (HCV/GAPDH) that the polypeptide of respective concentration is handled back virus.

The C:AVP-W3 polypeptide infects the timing relationship that suppresses to HCV and detects

The Huh7.5.1 cell inserts 6 orifice plates, and 37 ℃, 5%CO2 cultivates 24h; Serum free medium is washed cell three times, and 37 ℃ of HCV absorption is infected, and adds the AVP-W3 polypeptide of 20 μ g/ml in different time, and concrete infectious condition is following:

A. virus is mixed 37 ℃ and is hatched adding cell infection 4-6h behind the 2h with AVP-W3, removes free virus, changes perfect medium;

B. virus adds cell absorption 4-6h simultaneously with AVP-W3, and the flush away free virus changes perfect medium and cultivates;

C.AVP-W3 adds in the cell culture medium 37 ℃ and removes after hatching 2h, adds virus infection liquid absorption 4-6h, removes free virus, changes perfect medium and cultivates;

D. behind the virus infection absorption 4-6h, the flush away free virus changes the perfect medium that contains 20 μ g/ml AVP-W3 and cultivates;

3) collecting infecting cell and supernatant behind the infection 48h, fluorescence quantitative RT-RCR detects.

Antiviral result shows that synthetic polypeptide A VP-W3 has efficient restraining effect to the propagation of hepatitis C virus: when the concentration of AVP-W3 is 20 μ g/mL, can reach 100% to hepatitis C virus inhibition of proliferation rate.AVP-W3 is 5.28 μ g/mL to the half-inhibition concentration of hepatitis C virus propagation.

Embodiment 4

The quantitative analysis of scorpion source antivirus active polypeptide AVP-W3 different modes of administration effect cells infected supernatant HCV viral RNA, as shown in Figure 6.Control: no antibacterial peptide is handled the cells infected positive control;-2h cell:AVP-W3 adds in the cell culture medium 37 ℃ and removes after hatching 2h, adds virus infection liquid absorption 4h, and the flush away free virus changes the normal cultured base that does not contain AVP-W3 and cultivates;-2h v: virus is mixed 37 ℃ and is hatched adding cell infection 4h behind the 2h with AVP-W3, the flush away free virus changes the normal cultured base that does not contain AVP-W3; 0h: virus adds cell absorption 4h simultaneously with AVP-W3, and the flush away free virus changes the normal cultured base that does not contain AVP-W3 and cultivates; + 4h: behind the virus infection absorption 4-6h, the flush away free virus changes the culture medium culturing that contains 20 μ g/mlAVP-W3.

Embodiment 5

HCV viral RNA relative quantitative assay in the scorpion source antivirus active polypeptide AVP-W3 different modes of administration effect cells infected born of the same parents, as shown in Figure 7.Control: no antibacterial peptide is handled the cells infected positive control;-2h cell:AVP-W3 adds in the cell culture medium 37 ℃ and removes after hatching 2h, adds virus infection liquid absorption 4h, and the flush away free virus changes the normal cultured base that does not contain AVP-W3 and cultivates;-2h v: virus is mixed 37 ℃ and is hatched adding cell infection 4h behind the 2h with AVP-W3, the flush away free virus changes the normal cultured base that does not contain AVP-W3; 0h: virus adds cell absorption 4h simultaneously with AVP-W3, and the flush away free virus changes the normal cultured base that does not contain AVP-W3 and cultivates; + 4h: behind the virus infection absorption 4-6h, the flush away free virus changes the culture medium culturing that contains 20 μ g/ml AVP-W3.

Claims (4)

1. Scorpio antiviral polypeptide, its aminoacid sequence is shown in SEQ ID NO:2.

2. the gene of coding claim 1 said polypeptide, its nucleotide sequence is shown in SEQ ID NO:1.

3. the application of the described Scorpio antiviral polypeptide of claim 1 in the medicine of preparation prevention or treatment hepatitis C virus.

4. the medicine of prevention or treatment HCV infection wherein contains the said Scorpio antiviral polypeptide of claim 1.

Images