CN1361280A - New plasmin and its coding sequence and use - Google Patents
New plasmin and its coding sequence and use Download PDFInfo
- Publication number
- CN1361280A CN1361280A CN00137782A CN00137782A CN1361280A CN 1361280 A CN1361280 A CN 1361280A CN 00137782 A CN00137782 A CN 00137782A CN 00137782 A CN00137782 A CN 00137782A CN 1361280 A CN1361280 A CN 1361280A
- Authority
- CN
- China
- Prior art keywords
- protein
- earthworm fibrinolysin
- earthworm
- sequence
- polynucleotide
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
- C12N9/50—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
- C12N9/64—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue
- C12N9/6402—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue from non-mammals
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P7/00—Drugs for disorders of the blood or the extracellular fluid
- A61P7/02—Antithrombotic agents; Anticoagulants; Platelet aggregation inhibitors
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- Medicinal Chemistry (AREA)
- Biomedical Technology (AREA)
- General Health & Medical Sciences (AREA)
- General Chemical & Material Sciences (AREA)
- Microbiology (AREA)
- Pharmacology & Pharmacy (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Animal Behavior & Ethology (AREA)
- Hematology (AREA)
- Diabetes (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- Peptides Or Proteins (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Enzymes And Modification Thereof (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
The present invention provides one new kind of plasmin, earthworm plasmin Z, polynucleotides encoding this earthworm plasmin Z and recombination process to produce this earthworm plasmin Z. The present invention also discloses the method of applying the this earthworm plasmin Z in treating various diseases, such as thromboangitis disease, etc. The present invention also provides the medicine composite containing the said earthworm plasmin Z.
Description
The invention belongs to biotechnology and medical field, specifically, the present invention relates to the polynucleotide of new coding plasmin-earthworm fibrinolysin Z, and the protein of this polynucleotide encoding.The invention still further relates to these polynucleotide and proteinic method for making and purposes, and the pharmaceutical composition that contains this plasmin.
Earthworm fibrinolysin is the enzyme that the class extracted from earthworm can hydrolysis fibrinogen (former).It is present in the digestive tube of earthworm, molecular weight from 15,000 to 60,000 dalton.Earthworm fibrinolysin is not single a kind of enzyme, but has the general name of the multiple protein lytic enzyme of identical function.
Result of study shows that earthworm fibrinolysin has dual-use function, except energy direct hydrolysis scleroproein, can also activate profibr(in)olysin and become plasminogen, thereby have the effect of indirect hydrolysis of fibrin.The result of external pharmacological evaluation points out that earthworm fibrinolysin can also stimulate vascular endothelial cell to discharge tPA, thereby strengthen intravital fibrinolytic effect except directly dissolving the clot.Reach external thrombus formation model experiment and artificial thrombolysis experimental result in the body and point out that all earthworm fibrinolysin has tangible anti-bolt and thrombolytic effect.
Based on the such specific character of earthworm fibrinolysin, it has been made oral capsule both at home and abroad and be used for treating clinically thrombotic disease.For example, the commodity imperial heart by name, Lumbrukinase, Bo Luoke, general grace reach medicine such as thrombolysis capsule again and all make as raw material with earthworm fibrinolysin.But the structure of earthworm fibrinolysin is also rarely known by the people so far, and does not report the aminoacid sequence or the nucleotide sequence of any concrete earthworm fibrinolysin.
In view of plasmin have great application prospect at aspect such as treatment thrombotic disease etc., so this area presses for the new plasmin of exploitation.
The purpose of this invention is to provide a kind of new plasmin earthworm fibrinolysin with and fragment, analogue and derivative.
Another object of the present invention provides these proteinic polynucleotide of coding.
Another object of the present invention provides the purposes of producing these method of protein and this protein and encoding sequence.
In a first aspect of the present invention, novel isolated earthworm fibrinolysin Z protein is provided, this protein is from earthworm, and it comprises: protein or its conservative property variant protein matter or its active fragments or its reactive derivative with SEQ ID NO:2 aminoacid sequence.Preferably, this protein is the protein with SEQ ID NO:2 aminoacid sequence.
In a second aspect of the present invention, provide coding isolating these proteinic polynucleotide, these polynucleotide comprise a nucleotide sequence, and this nucleotide sequence is shown at least 70% homology with a kind of nucleotides sequence that is selected from down group: (a) the proteinic polynucleotide of the above-mentioned earthworm fibrinolysin Z of coding; (b) with polynucleotide (a) complementary polynucleotide.Preferably, this polynucleotide encoding has the protein of aminoacid sequence shown in the SEQ ID NO:2.More preferably, the sequence of these polynucleotide is be selected from down group a kind of: the sequence that (a) has 1-723 position among the SEQ ID NO:1; (b) has the sequence of 1-979 position among the SEQ ID NO:1.
In a third aspect of the present invention, the carrier that contains above-mentioned polynucleotide is provided, and has been transformed or host cell of transduceing or the host cell that is directly transformed or transduce by above-mentioned polynucleotide by this carrier.
In a fourth aspect of the present invention, provide preparation to have the method for protein of earthworm fibrinolysin Z protein active, this method comprises: (a) under the condition that is fit to expression earthworm fibrinolysin Z, cultivate the above-mentioned host cell that is transformed or transduce; (b) from culture, isolate protein with earthworm fibrinolysin Z protein active.
In a fifth aspect of the present invention, provide and above-mentioned earthworm fibrinolysin Z protein specific bonded antibody.
In a sixth aspect of the present invention, a kind of pharmaceutical composition is provided, it contains the earthworm fibrinolysin Z of the present invention and the pharmaceutically acceptable carrier of safe and effective amount.These pharmaceutical compositions can be treated illnesss such as thrombotic disease.
Others of the present invention are because disclosing of the technology of this paper is conspicuous to those skilled in the art.
Following accompanying drawing is used to illustrate specific embodiments of the present invention, and is not used in qualification by the scope of the invention that claims defined.
Fig. 1 has shown the pcr amplification band of earthworm fibrinolysin Z, and swimming lane 1 is the DNA standard; Swimming lane 2 is a pcr amplification product.
Fig. 2 has shown gene order and the encoded protein matter sequence thereof of earthworm fibrinolysin Z.
Fig. 3 has shown the building process among the prokaryotic expression carrier pET-28a (+) that expresses earthworm fibrinolysin Z.
Fig. 4 has shown the SDS-PAGE collection of illustrative plates and the western collection of illustrative plates of earthworm fibrinolysin Z expression product.Wherein each swimming lane is respectively: 1. protein standard molecular weight, and 2.IPTG induces preceding bacterial protein matter, and 3.IPTG induces back bacterial protein matter, 4.Western collection of illustrative plates.
It is 25125.0 daltonian earthworm fibrinolysins (mass spectroscopy results) that the inventor has separated a kind of molecular weight at first from multiple earthworm, and naming it is earthworm fibrinolysin Z. And, take William chamber ring earthworm (Metaphire guillelmi) as representative, measured one section amino acid sequence of N end of earthworm fibrinolysin Z, and take this as a foundation and synthesized corresponding primer, separating relevant mRNA then from earthworm is template, obtain cDNA through reverse transcription, the gene that increases and cloned earthworm fibrinolysin Z with the PCR method, and measured the complete sequence of gene. Then the coded sequence of earthworm fibrinolysin Z is inserted suitable carrier and changes suitable host cell over to, express and separated earthworm fibrinolysin Z. And identified by the Western engram analysis.
In the present invention, term " earthworm fibrinolysin Z ", " earthworm fibrinolysin Z protein " or " earthworm fibrinolysin Z polypeptide " are used interchangeably, all refer to basically have earthworm fibrinolysin Z amino acid sequence polypeptide or the protein of (SEQ ID NO:2). They comprise the fibrinolysin earthworm fibrinolysin Z that contains or do not contain initial methionine. These terms also comprise the earthworm fibrinolysin Z that contains or do not contain signal peptide.
As used herein, " separation " refers to that material separates (if crude, primal environment namely is natural surroundings) from its primal environment. Do not have separation and purification such as the polynucleotide under the native state in the active somatic cell and protein, but same polynucleotide or protein as from native state with in other materials that exist separately, then for separation and purification.
As used herein, " earthworm fibrinolysin Z polypeptide or the protein of separation " refers to that earthworm fibrinolysin Z protein is gone up substantially and does not contain natural relative other albumen, lipid, carbohydrate or other material. Those skilled in the art can go out earthworm fibrinolysin Z with purified technology of protein (especially FPLC) separation and purification of standard.
Protein of the present invention can be recombinant protein, native protein, synthetic protein, preferred recombinant protein. Protein of the present invention can be the product of natural purifying, or the product of chemical synthesis, or uses recombinant technique to produce from protokaryon or eucaryon host (for example, bacterium, yeast, higher plant, insect and mammalian cell). The host used according to the recombinant production scheme, protein of the present invention can be glycosylated, maybe can be nonglycosylated. Protein of the present invention also can comprise or not comprise initial methionine residues.
The present invention also comprises fragment, derivative and the analog of earthworm fibrinolysin Z. As used herein, term " fragment ", " derivative " refer to basically keep the identical biological function of natural earthworm fibrinolysin Z of the present invention or active protein with " analog ". Protein fragments of the present invention, derivative or analog can be that (i) has one or more conservative or substituted protein of non-conservation amino acid residue (preferred conservative amino acid residue), and the amino acid residue of such replacement can be also can not encoded by genetic code, or (ii) in one or more amino acid residues, has the protein of substituted radical, or (iii) mature protein and another compound (such as the compound that prolongs the protein half-life, polyethylene glycol for example) merges formed protein, or (iv) additional amino acid sequence is fused to this protein sequence and the protein that forms (such as targeting sequencing or secretion sequence or be used for sequence or the proenzyme sequence of this protein of purifying, or with the fusion of the formation of antigen I gG fragment). According to the instruction of this paper, these fragments, derivative and analog belong to the known scope of those skilled in the art.
In the present invention, term " earthworm fibrinolysin Z protein " refers to have the protein of the SEQ ID NO.2 sequence of earthworm fibrinolysin Z activity. This term also comprises having and variant forms earthworm fibrinolysin Z identical function, SEQ ID NO. 2 sequences. These variant forms comprise (but being not limited to): several (are generally 1-50, preferably 1-30, more preferably 1-20,1-10 best) amino acid whose disappearance, insertion and/or replacement, and add one or several and (be generally in 20 in that C end and/or N are terminal, preferably being in 10, more preferably is in 5) amino acid. For example, in the art, when replacing with the close or similar amino acid of performance, usually can not change the function of protein. Again such as, add the function that or several amino acid also can not change protein usually in that C end and/or N are terminal. This term also comprises active fragment and the reactive derivative of earthworm fibrinolysin Z.
The variant form of this protein comprises: homologous sequence, conservative variant, allelic variant, natural mutation, induced mutation body, under high or low stringency condition can with the coded albumen of the DNA of earthworm fibrinolysin Z DNA hybridization and the polypeptide or the protein that utilize the antiserum of anti-earthworm fibrinolysin Z protein to obtain. The present invention also provides other protein, as comprises the fusion of earthworm fibrinolysin Z protein or its fragment. Except the protein of total length almost, the present invention has also comprised the soluble fragments of earthworm fibrinolysin Z protein sequence. Usually, this fragment have earthworm fibrinolysin Z protein sequence at least about 10 continuous amino acids, usually at least about 30 continuous amino acids, preferably at least about 50 continuous amino acids, more preferably at least about 80 continuous amino acids, best at least about 100 continuous amino acids.
The invention also provide earthworm fibrinolysin Z or analog. These analogs and natural earthworm fibrinolysin Z albumen qualitative difference can be the difference on the amino acid sequence, also can be the difference that does not affect on the modified forms of sequence, perhaps have both at the same time. These protein comprise genetic variant natural or that induce. The induce variation body can obtain by various technology, as by radiation or be exposed to mutagens and produce random mutagenesis, also can pass through direct mutagenesis method or the biological technology of other known moleculars. Analog also comprises having the analog that is different from the amino acid whose residue of natural L-(such as D-amino acid), and the analog with that non-natural exists or synthetic amino acid (such as β, gamma-amino acid). Should be understood that protein of the present invention is not limited to the above-mentioned representational protein that exemplifies.
(usually the not changing primary structure) form of modification comprises: chemically derived form such as acetylation or the carboxylated of the protein that body is interior or external. Modification also comprises glycosylation, carries out glycosylation modified and protein that produce in the procedure of processing such as those in the synthetic and processing of protein or further. This modification can be carried out glycosylated enzyme (such as mammiferous glycosylase or deglycosylating enzyme) and finishes by protein is exposed to. Modified forms also comprises have the phosphorylated amino acid residue sequence of (such as phosphotyrosine, phosphoserine, phosphothreonine). Thereby also comprise the protein that has been improved its anti-proteolysis performance or optimized solubility property by modifying.
In the present invention, " earthworm fibrinolysin Z conservative variant protein matter " refers to compare with the amino acid sequence of SEQ ID N0:2, has 10 at the most, preferably at the most 8, more preferably at the most 5,3 amino acid is replaced by similar performance or close amino acid and is formed protein at the most best. These conservative variant protein matter are preferably carried out amino acid substitution according to table 1 and are produced.
Table 1
| Initial residue | Representational replacement | The preferred replacement |
| Ala(A) | Val；Leu；Ile | Val |
| Arg(R) | Lys；Gln；Asn | Lys |
| Asn(N) | Gln；His；Lys；Arg | Gln |
| Asp(D) | Glu | Glu |
| Cys(C) | Ser | Ser |
| Gln(Q) | Asn | Asn |
| Glu(E) | Asp | Asp |
| Gly(G) | Pro；Ala | Ala |
| His(H) | Asn；Gln；Lys；Arg | Arg |
| Ile(I) | Leu；Val；Met；Ala；Phe | Leu |
| Leu(L) | Ile；Val；Met；Ala；Phe | Ile |
| Lys(K) | Arg；Gln；Asn | Arg |
| Met(M) | Leu；Phe；Ile | Leu |
| Phe(F) | Leu；Val；Ile；Ala；Tyr | Leu |
| Pro(P) | Ala | Ala |
| Ser(S) | Thr | Thr |
| Thr(T) | Ser | Ser |
| Trp(W) | Tyr；Phe | Tyr |
| Tyr(Y) | Trp；Phe；Thr；Set | Phe |
| Val(V) | Ile；Leu；Met；Phe；Ala | Leu |
Polynucleotide of the present invention can be dna form or rna form.Dna form comprises the DNA of cDNA, genomic dna or synthetic.DNA can be strand or double-stranded.DNA can be coding strand or noncoding strand.The proteinic coding region sequence of encoding mature can be identical with the coding region sequence shown in the SEQ ID NO:1 or the varient of degeneracy.As used herein, " varient of degeneracy " is meant that in the present invention coding has the protein of SEQ ID NO:2, but with the differentiated nucleotide sequence of coding region sequence shown in the SEQ ID NO:1.
The polynucleotide of the mature protein of coding SEQ ID NO:2 comprise: the proteinic encoding sequence of an encoding mature; The encoding sequence of mature protein and various additional code sequence; Encoding sequence of mature protein (with optional additional code sequence) and non-coding sequence.
Term " polynucleotide of coded protein " can be to comprise these proteinic polynucleotide of coding, also can be the polynucleotide that also comprise additional code and/or non-coding sequence.
The invention still further relates to the varient of above-mentioned polynucleotide, it is encoded polypeptide or proteinic fragment, analogue and the derivative of identical aminoacid sequence with the present invention.The varient of these polynucleotide can be the allelic variant of natural generation or the varient that non-natural takes place.These nucleotide diversity bodies comprise and replace varient, deletion mutation body and insert varient.As known in the art, allelic variant is the replacement form of polynucleotide, and it may be replacement, disappearance or the insertion of one or more Nucleotide, but can be from not changing the function of its encoded protein matter in fact.
The invention still further relates to and above-mentioned sequence hybridization and two sequences between have at least 50%, preferably at least 70%, the polynucleotide of at least 80% homology more preferably.The present invention be more particularly directed under stringent condition and the interfertile polynucleotide of polynucleotide of the present invention.In the present invention, " stringent condition " is meant: (1) than hybridization under low ionic strength and the comparatively high temps and wash-out, as 0.2 * SSC, and 0.1%SDS, 60 ℃; Or (2) hybridization the time is added with denaturing agent, as 50% (v/v) methane amide, 0.1% calf serum/0.1% Ficoll, 42 ℃ etc.; Or (3) only in the homology between the two sequences at least more than 90%, be more preferably 95% and just hybridize when above.And the protein of interfertile polynucleotide encoding has identical biological function and activity with the mature protein shown in the SEQ ID NO:2.
The invention still further relates to nucleic acid fragment with above-mentioned sequence hybridization.As used herein, the length of " nucleic acid fragment " contains 15 Nucleotide at least, better is at least 30 Nucleotide, is more preferably at least 50 Nucleotide, preferably more than at least 100 Nucleotide.Nucleic acid fragment can be used for the amplification technique (as PCR) of nucleic acid to determine and/or to separate the polynucleotide of coding earthworm fibrinolysin Z.
Protein among the present invention and polynucleotide preferably provide with isolating form, more preferably are purified to homogeneous.
Earthworm fibrinolysin Z Nucleotide full length sequence of the present invention or its fragment can obtain with the method for pcr amplification method, recombination method or synthetic usually.For the pcr amplification method, can be disclosed according to the present invention about nucleotide sequence, especially open reading frame sequence designs primer, and with commercially available cDNA storehouse or by the prepared cDNA storehouse of ordinary method well known by persons skilled in the art as template, amplification and obtain relevant sequence.Also can be directly method amplification by RT-PCR obtain relevant sequence.When sequence is longer, usually needs to carry out twice or pcr amplification repeatedly, and then the fragment that each time amplifies is stitched together by proper order.
In case obtained relevant sequence, just can obtain relevant sequence in large quantity with recombination method.This normally is cloned into carrier with it, changes cell again over to, separates obtaining relevant sequence then from the host cell after the propagation by ordinary method.
In addition, also the method for available synthetic is synthesized relevant sequence, especially fragment length more in short-term.Usually, by first synthetic a plurality of small segments, and then connect and to obtain the very long fragment of sequence.
At present, can be fully obtain the dna sequence dna of code book invention protein (or its fragment, or derivatives thereof) by chemosynthesis.This dna sequence dna can be introduced in various existing dna moleculars as known in the art (or as carrier) and the cell then.In addition, also can will suddenly change and introduce in the protein sequence of the present invention by chemosynthesis.
Use method (Saiki, the et al.Science 1985 of round pcr DNA amplification/RNA; 230:1350-1354) be optimized for acquisition gene of the present invention.When particularly being difficult to obtain the cDNA of total length from the library, can preferably use RACE method (the terminal rapid amplifying method of RACE-cDNA), the primer that is used for PCR can suitably be selected according to sequence information of the present invention disclosed herein, and available ordinary method is synthetic.Available ordinary method is as the DNA/RNA fragment by gel electrophoresis separation and purifying amplification.
The present invention also relates to comprise the carrier of polynucleotide of the present invention, and the host cell that produces through genetically engineered with carrier of the present invention or earthworm fibrinolysin Z encoding sequence, and produce method of protein of the present invention through recombinant technology.
Recombinant DNA technology (Science, 1984 by routine; 224:1431), can utilize polymerized nucleoside acid sequence of the present invention to can be used to express or produce the earthworm fibrinolysin Z protein of reorganization.In general following steps are arranged:
(1). with the proteinic polynucleotide of coding earthworm fibrinolysin Z of the present invention (or varient), or transform or the transduction proper host cell with the recombinant expression vector that contains these polynucleotide;
(2). the host cell of in suitable medium, cultivating;
(3). separation, protein purification from substratum or cell.
Among the present invention, earthworm fibrinolysin Z polynucleotide sequence can be inserted in the recombinant expression vector.Term " recombinant expression vector " refers to that bacterial plasmid well known in the art, phage, yeast plasmid, vegetable cell virus, mammalian cell virus are as adenovirus, retrovirus or other carriers.The carrier of Shi Yonging includes but not limited in the present invention: and the expression vector based on T7 of in bacterium, expressing (Rosenberg, et al.Gene, 1987,56:125); The pMSXND expression vector of in mammalian cell, expressing (Lee and Nathans, J Bio Chem.263:3521,1988) and at the carrier that derives from baculovirus of expressed in insect cells.In a word, as long as can duplicate in host and stablize, any plasmid and carrier can be used.A key character of expression vector is to contain replication orgin, promotor, marker gene and translation controlling elements usually.
Method well-known to those having ordinary skill in the art can be used to make up and contains earthworm fibrinolysin Z DNA sequences encoding and suitable transcribing/the translate expression vector of control signal.These methods comprise (Sambroook, et al.Molecular Cloning, a Laboratory Manual, cold Spring Harbor Laboratory.New York, 1989) such as extracorporeal recombinant DNA technology, DNA synthetic technology, the interior recombinant technologys of body.Described dna sequence dna can effectively be connected on the suitable promotor in the expression vector, and is synthetic to instruct mRNA.The representative example of these promotors has: colibacillary lac or trp promotor; Lambda particles phage P
LPromotor; Eukaryotic promoter comprises LTRs and some other known may command gene expression promoter in protokaryon or eukaryotic cell or its virus of CMV immediate early promoter, HSV thymidine kinase promoter, early stage and late period SV40 promotor, retrovirus.Expression vector also comprises ribosome bind site and the transcription terminator that translation initiation is used.
In addition, expression vector preferably comprises one or more selected markers, to be provided for selecting the phenotypic character of transformed host cells, cultivate Tetrahydrofolate dehydrogenase, neomycin resistance and the green fluorescent protein (GFP) of usefulness as eukaryotic cell, or be used for colibacillary tsiklomitsin or amicillin resistance.
Comprise the carrier of above-mentioned suitable dna sequence dna and suitable promotor or control sequence, can be used to transform appropriate host cell, so that it can marking protein.
Host cell can be a prokaryotic cell prokaryocyte, as bacterial cell; Or eukaryotic cell such as low, as yeast cell; Or higher eucaryotic cells, as mammalian cell.Representative example has: intestinal bacteria, streptomyces; The bacterial cell of Salmonella typhimurium; Fungal cell such as yeast; Vegetable cell; The insect cell of fruit bat S2 or Sf9; The zooblast of CHO, COS, 293 cells or Bowes melanoma cells etc.
When polynucleotide of the present invention are expressed in higher eucaryotic cells, be enhanced if will make to transcribe when in carrier, inserting enhancer sequence.Enhanser is the cis acting factor of DNA, and nearly 10 to 300 base pairs act on promotor transcribing with enhancing gene usually.Can for example be included in the SV40 enhanser of 100 to 270 base pairs of replication origin side in late period one, at the polyoma enhanser of replication origin side in late period one and adenovirus enhanser etc.
Persons skilled in the art all know how to select appropriate carriers, promotor, enhanser and host cell.
Can carry out with routine techniques well known to those skilled in the art with the recombinant DNA transformed host cell.When the host was prokaryotic organism such as intestinal bacteria, the competent cell that can absorb DNA can be used CaCl in exponential growth after date results
2Method is handled, and used step is well-known in this area.Another kind method is to use MgCl
2If desired, transforming also the method for available electroporation carries out.When the host is an eukaryote, can select following DNA transfection method for use: coprecipitation of calcium phosphate method, conventional mechanical method such as microinjection, electroporation, liposome packing etc.
The transformant that obtains can be cultivated with ordinary method, expresses the protein of coded by said gene of the present invention.According to used host cell, used substratum can be selected from various conventional substratum in the cultivation.Under the condition that is suitable for the host cell growth, cultivate.After host cell grows into suitable cell density, induce the promotor of selection with suitable method (as temperature transition or chemical induction), cell is cultivated for some time again.
The extracellular can be expressed or be secreted into to recombinant protein in the above methods in cell or on cytolemma.If desired, can utilize its physics, the separating by various separation methods with other characteristic and the albumen of purification of Recombinant of chemistry.These methods are well-known to those skilled in the art.The example of these methods includes, but are not limited to: conventional renaturation handles, with protein precipitant handle (salt analysis method), centrifugal, the broken bacterium of infiltration, superly handle, the combination of super centrifugal, sieve chromatography (gel-filtration), adsorption chromatography, ion exchange chromatography, high performance liquid chromatography (HPLC) and other various liquid chromatography (LC) technology and these methods.
The earthworm fibrinolysin Z or the protein of reorganization are of use in many ways.These purposes include, but is not limited to: directly as the disease of pharmacological agent thrombotic disease and antibody, protein or other part that is used to screen promotion or resists earthworm fibrinolysin Z function.The protein molecule that can suppress or stimulate earthworm fibrinolysin Z function that can be used for seeking therapeutic value with the recombinant earthworm fibrinolysin Z screening protein library of expressing.
On the other hand, the present invention also comprises earthworm fibrinolysin Z DNA or the protein of its fragment coding has specific polyclonal antibody and monoclonal antibody, especially monoclonal antibody.Here, " specificity " is meant that antibody capable is incorporated into earthworm fibrinolysin Z gene product or fragment.Preferably, refer to that those can combine with earthworm fibrinolysin Z gene product or fragment but nonrecognition and be incorporated into the antibody of other irrelevant antigen molecule.Among the present invention antibody comprise those can in conjunction with and suppress the molecule of earthworm fibrinolysin Z, comprise that also those do not influence the antibody of earthworm fibrinolysin Z function.The present invention also comprise those can with modify or without the earthworm fibrinolysin Z gene product bonded antibody of modified forms.
The present invention not only comprises complete mono-clonal or polyclonal antibody, but also comprises having immunocompetent antibody fragment, as Fab ' or (Fab)
2Fragment; Heavy chain of antibody; Light chain of antibody; Genetically engineered strand Fv molecule; Or chimeric antibody, as have the murine antibody binding specificity but still keep antibody from people's antibody moiety.
Antibody of the present invention can be prepared by the known various technology of those skilled in that art.For example, the earthworm fibrinolysin Z gene product of purifying or its have antigenic fragment, can be applied to animal to induce the generation of polyclonal antibody.Similarly, expressing earthworm fibrinolysin Z or its has antigenic segmental cell and can be used to immune animal and produce antibody.Antibody of the present invention also can be monoclonal antibody.This type of monoclonal antibody can utilize hybridoma technology to prepare that (see people such as Kohler, Nature 256; 495,1975; People such as Kohler, Eur.J.Immunol.6:511,1976; People such as Kohler, Eur.J.Immunol.6:292,1976; People such as Hammerling, In Monoclonal Antibodies and T Cell Hybridomas, Elsevier, N.Y., 1981).Each antibody-like of the present invention can utilize the fragment or the functional zone of earthworm fibrinolysin Z gene product, obtains by the routine immunization technology.These fragments or functional zone can utilize recombinant methods or utilize protein synthesizer synthetic.Can come immune animal and produce with the gene product of producing in the prokaryotic cell prokaryocyte (for example E.Coli) with the unmodified form bonded antibody of earthworm fibrinolysin Z gene product; With posttranslational modification form bonded antibody (as the albumen or the polypeptide of glycosylation or phosphorylation), can come immune animal and obtain with the gene product that produces in the eukaryotic cell (for example yeast or insect cell).
Utilize earthworm fibrinolysin Z of the present invention,, can filter out with earthworm fibrinolysin Z interactional material takes place, as acceptor, inhibitor, agonist or antagonist etc. by various conventional screening methods.
Earthworm fibrinolysin Z of the present invention and antibody, inhibitor, agonist or antagonist etc. when using (administration) in treatment, can provide different effects.Usually, can these materials are formulated in nontoxic, inert and the pharmaceutically acceptable aqueous carrier medium, wherein pH is about 5-8 usually, and preferably pH is about 6-8, although the pH value can be with being changed to some extent by preparation Substance Properties and illness to be treated.The pharmaceutical composition for preparing can carry out administration by conventional route, comprising (but being not limited to): intramuscular, intraperitoneal, intravenously, subcutaneous, intracutaneous or topical.
Protein of the present invention can be directly used in disease treatment, for example, is used for the treatment of thrombus aspect.When using earthworm fibrinolysin Z of the present invention, also can use the other treatment agent simultaneously, as antitumor drug etc.
The present invention also provides a kind of pharmaceutical composition, and it contains earthworm fibrinolysin Z protein of the present invention and the pharmaceutically acceptable carrier or the vehicle of safe and effective amount.This class carrier comprises (but being not limited to): salt solution, damping fluid, glucose, water, glycerine, ethanol and combination thereof.Pharmaceutical preparation should be complementary with administering mode.Pharmaceutical composition of the present invention can be made into the injection form, for example is prepared by ordinary method with the physiological saline or the aqueous solution that contains glucose and other assistant agents.Pharmaceutical composition such as tablet and capsule can be prepared by ordinary method.Pharmaceutical composition such as injection, solution, tablet and capsule should be made under aseptic condition.The dosage of activeconstituents is the treatment significant quantity, for example every day about 0.1 microgram/kg body weight-Yue 5 mg/kg body weight.In addition, protein of the present invention also can use with the other treatment agent.
When making pharmaceutical composition, be that earthworm fibrinolysin Z with safe and effective amount is applied to Mammals, wherein this safe and effective amount is usually at least about 10 microgram/skies, and in most of the cases be no more than about 8 mg/kg body weight, preferably this dosage is about 10 microgram/skies-Yue 1 mg/kg body weight.Certainly, concrete dosage also should be considered factors such as route of administration, patient health situation, and these all are within the skilled practitioners skill.
A kind of method that whether has earthworm fibrinolysin Z in the test sample that detects is to utilize the specific antibody of earthworm fibrinolysin Z to detect, and it comprises: sample is contacted with earthworm fibrinolysin Z specific antibody; Observe whether form antibody complex, formed antibody complex and just represented to exist in the sample earthworm fibrinolysin Z.
The invention has the advantages that: the plasmin that contains kind more than 10 in the earthworm.Separation and purification a kind of composition wherein has certain degree of difficulty to single purity on technology from earthworm.Earthworm fibrinolysin Z gene is cloned in the present invention, assay determination its gene order, and successfully express.These achievements in research not only are that the development research gene engineering product has been created good condition from now on, also provide necessary chemical structure data for developing the earthworm fibrinolysin injection from now on.In addition, earthworm fibrinolysin Z of the present invention provides new treatment approach for diseases such as treatment thrombotic diseases, thereby has great application prospect.
Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to people such as normal condition such as Sambrook, molecular cloning: laboratory manual (New York:Cold SpringHarbor Laboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.
The natural earthworm fibrinolysin Z of separation and purification from earthworm
In the present embodiment, following 4 kinds of earthworm kinds have been adopted: huge tooth earthworm far away (Amynthasdancatala), Eisenia foetida (Eisenia faetide), grand ring earthworm far away (Amynthas robustus), William chamber ring earthworm (Metaphire guillelmi).In present embodiment and following examples, unless dated especially, otherwise refer to above four kinds of earthworms.
It is some to get fresh and alive earthworm, through mechanical disintegration, is cooled to 4-10 degree centigrade rapidly.Add the long-pending organic solvent (acetone) of monoploid, low-temperature extraction goes out impurity such as lipid, moisture, soluble protein, salt.10000rpm frozen centrifugation, and collecting precipitation.Add isopyknic water in the precipitation, stirred 10 minutes, the 10000rpm frozen centrifugation is collected supernatant liquor.Supernatant liquor adopts freeze-drying with its freeze-drying after filtration.9-12 protein peak appears in the lyophilized solid analysis that takes a morsel on the FPLC collection of illustrative plates, according to the difference of appearance time, and difference to some extent mutually, these peaks are the isozyme of earthworm fibrinolysin, wherein the 3rd peak has the most significant plasmin activity.Use dissolved in distilled water, through ion exchange column, affinity column, multistep separation and purification such as molecular sieve column obtain the refining sample of earthworm fibrinolysin.Sample is through the HPLC method, or the SDS electrophoretic analysis, presents single band.Then, to this earthworm fibrinolysin mass spectroscopy determining molecular weight, the result is 25125.0 dalton.This enzyme is named as earthworm fibrinolysin Z.All contain this earthworm fibrinolysin Z in 4 kinds of earthworms of test, this shows that earthworm fibrinolysin Z is a kind of ubiquitous plasmin.
Embodiment 2
The mensuration of the purifying of earthworm fibrinolysin Z and 10 aminoacid sequences of N end
Fresh and alive earthworm blends after cleaning.Utilize organic solvent precipitation method to make the earthworm fibrinolysin crude preparation by using.Then by Sephadex G-75, DEAE-Sepharose CL-6B and Mono Q post separate, and are purified to earthworm fibrinolysin Z sample.The earthworm fibrinolysin Z sample of purifying through 10 circulations, records following N terminal sequence: ILGGTHARVG on the PE491 protein sequencer.
Embodiment 3
Primer design and synthetic
Sequence according to the N end of the earthworm fibrinolysin Z that measures among the embodiment 2, design upstream oligonucleotide primer is: 5 ' ATGAATCCATGATC C TGGGAG (T) GG (ATC) ACG (ACT) A (GC) A3 ' (SEQ ID NO:6), and added initiator codon and BamHI site at the N of maturation protein end, be beneficial to this expression of gene research and operate.Because lack any information in earthworm fibrinolysin C end and gene downstream thereof up to now, the inventor clones this gene with 3 ' RACE method.Downstream primer is: 5 ' GACCACGCGTATCGATGTCG AC3 ' (SEQID NO:3).The synthetic trust Shanghai of primer is given birth to worker bio-engineering corporation and is finished.
Embodiment 4
The extraction of total RNA
Get one of William chamber ring earthworm, grind into powder in liquid nitrogen.Get the 200mg powder, and adding 4mL solution D (contain the 4mol/L guanidinium isothiocyanate, 25m mol/L Trisodium Citrate, pH 7.0; 5% sarcosyl, the 0.1mol/L beta-mercaptoethanol), fully after the homogenate, solution is transferred in the centrifuge tube, 4 ℃, 12, centrifugal 5 minutes of 000g.Supernatant sucks in the new centrifuge tube, adds 0.4mL 2mol/L NaAc, and Ph 4.0,4mL water-saturated phenol and 2mL chloroform: primary isoamyl alcohol (49: 1) mixture, and after fully vibrating, ice bath 15min.4 ℃, 10, the centrifugal 20min of 000g.Get upper strata water and equal-volume Virahol mixing, place 1h for-20 ℃.4 ℃, 10, the centrifugal 20min collecting precipitation of 000g. precipitation heavily is dissolved in the 2mL solution D, and 65 ℃ of incubation 2-3min fully dissolve it, adds 0.2mL 2mol/L NaAc, and pH4.0 and 2mL Virahol are placed 1h for-20 ℃ behind the mixing.4 ℃, 10, the centrifugal 20min of 000g, precipitation is open in the air and placed several minutes with after 75% washing with alcohol, and ethanol is fully volatilized totally.Be dissolved at last among the aqua sterilisa 30 μ L that DEPC (diethylpyrocarbonate) handled.Get the OD that 1 μ L surveys RNA
260/ OD
280, 1 μ L walks the denaturing formaldehyde electrophoresis, to determine purity and the integrity of RNA.
Embodiment 5
RT-PCR amplification earthworm fibrinolysin Z gene
Encircling the total RNA of earthworm with the William chamber that makes among the embodiment 4 is template, and with the Po Lam 3 ' RACE KIT of Man reverse transcription, the operation by specification carries out.
Using synthetic primer among the embodiment 3, is template from the cDNA of above-mentioned gained, carries out pcr amplification.The total reaction system is 50 μ L, wherein MgCl
2Final concentration be 1.5m mol/L, the final concentration of dNTP is 200 μ mol/L.Primer concentration is 30n mol/L, Tag enzyme 2 units (available from Gibco BRL company).Reaction conditions is: 94 ℃ of sex change 3min of elder generation.Enter circulation then.94 ℃, sex change 1min; 50 ℃ of annealing min; 72 ℃ are extended 1.5min, carry out 30 circulations, at last at 72 ℃ of insulation 10min.The PCR product is got 5 μ L and is carried out 1% agarose electrophoresis inspection, amplifies the dna fragmentation (see figure 1) of a treaty 1000bp.Product is with the chloroform extracting, and ethanol sedimentation reclaims, and is dissolved in the aqua sterilisa of 10 μ L.
The clone of earthworm fibrinolysin Z gene
Because amplification is the nucleic acid of a unknown nucleotide sequence, destroys its integrity for the restriction enzyme site of avoiding gene inside coincidence to occur causes gene to be cut, and clones with the T-carrier.
1) preparation of T-carrier: carrier pBluescript-SK (available from Stratagene company) 1 μ g cuts equal-volume phenol with EcoRI: chloroform is handled, ethanol sedimentation, be dissolved in the 50 μ L systems, include 10 * PCR damping fluid, 5 μ L, 100m mol/L dNTP2 μ L, Taq enzyme 1 unit.At 70 ℃ of insulation 2h, isopyknic phenol: chloroform is handled, and behind the ethanol sedimentation, is dissolved in 10 μ L aqua sterilisas.
2) get PCR recovery product 2 μ L and be connected with self-control T-carrier 1 μ L, transform, through blue hickie screening, enzyme is cut with PCR and is identified, the acquisition positive colony.
Embodiment 7
The preparation of the anti-earthworm fibrinolysin Z of rabbit antibody
Get body weight and be one of male new zealand rabbit about 2 kilograms.Add Freund's complete adjuvant with 1mg earthworm fibrinolysin Z sample and grind to form emulsion state, at rabbit strength portion multi-point injection.After raising two weeks, add Freund's incomplete adjuvant with 1mg earthworm fibrinolysin Z sample and grind to form emulsion state, again at rabbit strength portion multi-point injection.After one month, add Freund's incomplete adjuvant with same method booster immunization with 1.5mg earthworm fibrinolysin Z sample.Behind the two weeks, add Freund's incomplete adjuvant booster immunization once more with 1mg earthworm fibrinolysin Z sample again.After raising two weeks, the strength arterial blood extracting, 4 ℃ of standing over night, 2,000 left the heart 3 minutes.Upper serum is the anti-earthworm fibrinolysin Z of rabbit antibody.
Embodiment 8
The evaluation of plasmin Z gene
The positive colony that obtains among the embodiment 6 is entrusted and is gone up sea base health biotech company mensuration.Gene complete sequence and encoded protein matter sequence are seen Fig. 2.This gene is shown in SEQ ID NO:1, long 924 bp, the long 723bp of reading frame (the 1st～723) wherein, 241 amino acid (SEQ ID NO:2) of encoding.723 bp are 3 later on '-non-translational region, two polyA tailing signal AATAAA are arranged.
The cDNA encoded protein matter sequence homology that earthworm fibrinolysin Z cDNA encoded protein matter sequence and another are called as Lumbricus bimastus reaches 54%.Therefore, this is a new earthworm fibrinolysin gene that does not appear in the newspapers.From the aminoacid sequence of this new coded by said gene, the molecular weight that is calculated through computer software DNASTAR is 25138.10, and this molecular weight size with the plasmin Z that is extracted from earthworm is coincide.
Embodiment 9
The expression of earthworm fibrinolysin Z and evaluation
In this embodiment, for further confirming this gene earthworm fibrinolysin Z that encoded really, the translation district of this gene is expressed in prokaryotic expression carrier pET-28a (+) (Novagen company), carry out Western hybridization with the rabbit that makes among the embodiment 7 anti-earthworm fibrinolysin Z antibody and expression product and identify.Wherein the plasmid construction collection of illustrative plates is seen Fig. 3, expression the results are shown in Figure 4.
(1) expresses
According in addition synthetic two primers of complete genome sequence, so that express in pET-28a (+): upstream primer is 5 ' GCGAATTCATCCTGGGAGGGACGAAA3 ' (primer 3) (SEQ ID NO:4), and downstream primer is: 5 ' CACTCGAGTTAGTGCAGTCGGCTCCA3 ' (primer 4) (SEQ ID NO:5).With the full-length cDNA is template, carries out pcr amplification as mentioned above.Amplified production EcoRI/XhoI enzyme is cut rear clone in the EcoRI/XhoI site of pET-28a (+), the positive colony that enzyme is cut through order-checking guarantee errorless after, plasmid transforms in bacterial strain BL21 (DE3).Treat the OD of bacterium
600The expression that adds IPTG to 1m mol/L induced gene to 0.6 back.2.5 centrifugal after hour, collect thalline and carry out SDS-PAGE, Xylene Brilliant Cyanine G R-250 dyeing.
(2) Western trace
After SDS-PAGE finishes, take off running gel 100V electricity under the condition of ice bath and change 2h to nylon membrane.Film is put into hybridization bag, add 5mL confining liquid (phosphate buffered saline buffer of 5% skim-milk), on oscillating platform, shake 1h..With confining liquid with 1: 1000 the dilution first antibody (the anti-earthworm fibrinolysin Z of the rabbit that makes among the embodiment 7 antibody).Open hybridization bag, outwell confining liquid, add the good first antibody of dilution, shake 1h..Wash nylon membrane 3 times with phosphate buffered saline buffer, each 15min.Film that washing is good and confining liquid dilute good goat-anti rabbit alkaline phosphatase (dilution in 1: 3000) hybridization 1h..(100mmol/L Tris-HCl, pH 9.5,5mmol/L MgCl with the alkaline phosphatase damping fluid for film
2, 100mmol/L NaCl) washing after, with BCIP/NBT (5-bromo-4-chloro-3-one indoles phosphoric acid/nitroblue tetrazolium(NBT)) colour developing.
Results of hybridization shows, combines (see figure 4) expressed protein and earthworm fibrinolysin Z antibody specificity.
Embodiment 10
The determination of activity of different sources earthworm fibrinolysin
Press the described fibrin plate methods of people such as Deogny (Clinica ChimicaActa, 1975,60,85), calculate the activity of earthworm fibrinolysin according to the area size of solusphere.The sample that is adopted is Eisenia foetida plasmin and earthworm fibrinolysin Z, and the result of vitality test is respectively: the Eisenia foetida plasmin is 21,000mm
2/ mg protein, earthworm fibrinolysin are Z 33,000mm
2/ mg protein.
All quote in this application as a reference at all documents that the present invention mentions, just quoted as a reference separately as each piece document.Should be understood that in addition those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims institute restricted portion equally.
Sequence table (1) general information: (ii) denomination of invention: new plasmin, its encoding sequence and purposes be the sequence number (iii): the information of 6 (2) SEQ ID NO:1: (i) sequence signature:
(A) length: 979bp
(B) type: nucleic acid
(C) chain: two strands
( D ) ： ( ii ) ：cDNA ( xi ) ：SEQ ID NO：1：ATCCTGGGAG GGACGAAAGC CAGAGTTGGA GAGATCCCAT GGCAGCTGTC GCAGCAGAGA 60GGCGGAAGTC ACAGCTGCGG AGCGTCTCTT CTCAGGCCCG GTTCGGCCCT CAGCGCCGCT 120CACTGCGTTG ACGGAGCACC GCCAGCAGAT GTGCGAATTG TCGCTGGACT TCATTTGCGC 180TCAGATGAAT CCACTGCAGT GGCTTCCCTT GCTGAGAGTT TCCTAATTCA CCCGAGTTAC 240AACGTTGGAG AAGGAACTTT CCCCAACGAC ATCGCCATCA TCTACCTATT AACAAATATC 300AACTCTGCTC CAGTAGAAAA CATCGATTTT GCTCTTCTAC CTCCAGACAA CGTCGAGCAA 360TTCGTCGGAT TTACTTGCGT GCTCAGTGGA TGGGGACGCA CATCGGCCAG CAATGTACTT 420CCCGATGCCC TGCAGAAGGT CAGCATCGAC GTCATCACCA CAGCCGAATG CGACTCACGC 480ATGGCCGCTG TTGCTGGAGC CGACTGCACT GATGCTCACA TCGCCGTCTT CGATCCCGCT 540TTGCAGAAAG GATCGTGCAA CGGTGATAGC GGTGGCCCAA TGAACTGCCC TCTGAGCGGT 600GAATTTGTGG TTGCTGGTGT GACGTCATGG GGAATTTCGG GAGGCGGTGC CTGTCTGCCA 660GAATACCCAT CAGTCTACAC CAGAACAGGA TTCTACCGTC AATGGATCCT TGACAACATT 720CGCTAGACTG ACTCAGTCGT CCATTCGTCT ATGCCGGAAC CATGTTCTAC AGCGGACGGA 780TCACGGACAC CGTCCTTCAA ATTATAAAGA AATTACTGAA GAGCTTTGAA TAATAATGCA 840GACTTTAACT TCAAGTGCCC CCAACTTAGC AAGCTCCCTG TTTATCCATT GTGAATAAAT 900CAGAATAAAG ACGGCAAAAA AAAAAAAAAA GTCGACATCG ATACGCGTGG TCAATCAAGC 960TTATCGATAC CGGCGACCT 979 ( 2 ) SEQ ID NO：2： ( i ) ：
(A) length: 241 amino acid
(B) type: amino acid
(D) topological structure: linear (ii) molecule type: protein (xi) sequence description: information (i) sequence signature of SEQ ID NO:2:ILGGTKARVG EIPWQLSQQR GGSHSCGASL LRPGSALSAA HCVDGAPPAD 50VRIVAGLHLR SDESTAVASL AESFLIHPSY NVGEGTFPND IAIIYLLTNI 100NSAPVENIDF ALLPPDNVEQ FVGFTCVLSG WGRTSASNVL PDALQKVSID 150VITTAECDSR MAAVAGADCT DAHIAVFDPA LQKGSCNGDS GGPMNCPLSG 200EFVVAGVTSW GISGGGACLP EYPSVYTRTG FYRQWILDNI R 241 (2) SEQ ID NO:3
(A) length: 22 bases
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linearity is molecule type (ii): oligonucleotide (xi) sequence description: information (i) sequence signature of SEQ ID NO 3::GACCACGCGT ATCGATGTCG AC 22 (2) SEQ ID NO:4
(A) length: 26 bases
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linearity is molecule type (ii): oligonucleotide (xi) sequence description: information (i) sequence signature of SEQ ID NO:4:GCGAATTCAT CCTGGGAGGG ACGAAA 26 (2) SEQ ID NO:5
(A) length: 26 bases
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linearity is molecule type (ii): oligonucleotide (xi) sequence description: information (i) sequence signature of SEQ ID NO:5:CACTCGAGTT AGTGCAGTCG GCTCCA 26 (2) SEQ ID NO:6
(A) length: 28 bases
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linearity is molecule type (ii): oligonucleotide (xi) sequence description: SEQ ID NO:6:ATGAATCCAT GATCCTGGGA G (T) GG (ATC) ACG (ACT) A (GC) A 28
Claims (10)
1. an isolating earthworm fibrinolysin Z protein is characterized in that it comprises: protein or its conservative property variant protein matter or its active fragments or its reactive derivative with SEQ ID NO:2 aminoacid sequence.
2. protein as claimed in claim 1 is characterized in that, this protein is the protein with SEQ ID NO:2 aminoacid sequence.
3. isolating polynucleotide is characterized in that, the described earthworm fibrinolysin Z of its coding claim 1.
4. polynucleotide as claimed in claim 3 is characterized in that, this polynucleotide encoding has the protein of aminoacid sequence shown in the SEQ ID NO:2.
5. polynucleotide as claimed in claim 3 is characterized in that, these polynucleotide contain the sequence of 1-723 position among the SEQ ID NO:1.
6. a carrier is characterized in that, it contains the described polynucleotide of claim 3.
7. a genetically engineered host cell is characterized in that, it contains the described carrier of claim 6.
8. proteinic preparation method with earthworm fibrinolysin Z protein active is characterized in that this method comprises:
(a) being fit to express under the condition of earthworm fibrinolysin Z, cultivate the described host cell of claim 7;
(b) from culture, isolate protein with earthworm fibrinolysin Z protein active.
9. energy and the described earthworm fibrinolysin Z of claim 1 specificity bonded antibody.
10. a pharmaceutical composition is characterized in that, it contains the described protein of claim 1 and the pharmaceutically acceptable carrier of safe and effective amount.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB001377825A CN1194087C (en) | 2000-12-29 | 2000-12-29 | New plasmin and its coding sequence and use |
| PCT/CN2001/001631 WO2002053590A1 (en) | 2000-12-29 | 2001-12-14 | A novel fibrinolytic enzyme the polynucleotide encoding said polypeptide and the use thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB001377825A CN1194087C (en) | 2000-12-29 | 2000-12-29 | New plasmin and its coding sequence and use |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1361280A true CN1361280A (en) | 2002-07-31 |
| CN1194087C CN1194087C (en) | 2005-03-23 |
Family
ID=4597818
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNB001377825A Expired - Fee Related CN1194087C (en) | 2000-12-29 | 2000-12-29 | New plasmin and its coding sequence and use |
Country Status (2)
| Country | Link |
|---|---|
| CN (1) | CN1194087C (en) |
| WO (1) | WO2002053590A1 (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN100355884C (en) * | 2005-01-12 | 2007-12-19 | 华东理工大学 | Novel earthworm fibrinolytic enzyme, its encoding sequence and uses |
| CN101134951B (en) * | 2006-12-04 | 2010-05-19 | 齐齐哈尔大学 | Plasmin cultivation method |
| CN109260231A (en) * | 2017-07-18 | 2019-01-25 | 首都儿科研究所 | The preparation method of the anti-inflammatory antimicrobial extract of cough-relieving apophlegmatic in a kind of earthworm |
| CN113234708A (en) * | 2021-05-10 | 2021-08-10 | 北京中医药大学 | Fibrinolysis active protein, preparation method and application thereof, pharmaceutical composition and nucleic acid for coding protein |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1057565C (en) * | 1998-06-11 | 2000-10-18 | 中国预防医学科学院病毒学研究所 | Lumbrical fibrinolysin gene nucleotide series, and method for clone of same |
-
2000
- 2000-12-29 CN CNB001377825A patent/CN1194087C/en not_active Expired - Fee Related
-
2001
- 2001-12-14 WO PCT/CN2001/001631 patent/WO2002053590A1/en not_active Application Discontinuation
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN100355884C (en) * | 2005-01-12 | 2007-12-19 | 华东理工大学 | Novel earthworm fibrinolytic enzyme, its encoding sequence and uses |
| CN101134951B (en) * | 2006-12-04 | 2010-05-19 | 齐齐哈尔大学 | Plasmin cultivation method |
| CN109260231A (en) * | 2017-07-18 | 2019-01-25 | 首都儿科研究所 | The preparation method of the anti-inflammatory antimicrobial extract of cough-relieving apophlegmatic in a kind of earthworm |
| CN109260231B (en) * | 2017-07-18 | 2021-09-03 | 首都儿科研究所 | Preparation method of earthworm extract with cough stopping, phlegm eliminating, anti-inflammatory and antimicrobial functions |
| CN113234708A (en) * | 2021-05-10 | 2021-08-10 | 北京中医药大学 | Fibrinolysis active protein, preparation method and application thereof, pharmaceutical composition and nucleic acid for coding protein |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2002053590A1 (en) | 2002-07-11 |
| CN1194087C (en) | 2005-03-23 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN1194087C (en) | New plasmin and its coding sequence and use | |
| CN1477117A (en) | Novel human phosphotidylethanolamine binding protein, its coding sequence and application | |
| CN1223607C (en) | Human calcium ion/calmodulin dependent protein kinase II inhibitory protein and its application | |
| CN1385441A (en) | Novel human lymphokine, its coding sequence and use | |
| CN1367179A (en) | Novel liver regeneration related protein, its code sequence and application | |
| CN1618808A (en) | Liver cancer related protein and its coding sedquence and use | |
| CN1297922A (en) | Human calcium binding S100 protein 21 as one kind of polypeptide and polynucleotides encoding this polypeptide | |
| CN1238379C (en) | New osteoclast formation inhibiting factor and its coding sequence and use | |
| CN1171901C (en) | New interferon-like protein and its code sequence and use | |
| CN1990504A (en) | Earthworm protein suppressing cancer cell accretion by road spectrum | |
| CN1299827A (en) | New human CD20 homolgous molecule and its code sequence and use | |
| CN1477119A (en) | Novel Human cysteine proteinase inhibitor sample molecule, its coding sequence and application | |
| CN1292420A (en) | New human NADH oxido-reductase composite I subunit and its code sequence | |
| CN1299830A (en) | New human heat shock protein and its code sequence and use | |
| CN1477193A (en) | Novel human Rab GTP enzyme, its coding sequence and application | |
| CN1325874A (en) | Human C-type lectin-like receptor and its coding sequence and application | |
| CN1298945A (en) | Human ribonuclease PH and its coding sequence | |
| CN1303944A (en) | Novel polypeptide-threonine synthetase 71 and polynucleotide coding said polypeptide | |
| CN1299824A (en) | New human coupling acceptor and its code sequence | |
| CN1302886A (en) | Polypeptide-human cell wither correlated protein 12 and polynucleotide for coding it | |
| CN1475503A (en) | New type human bone marrow substrate cell source growth inhibiting factor, its coded sequence and use | |
| CN1292385A (en) | New polypeptide-human DNA-PK interaction protein 75 and polynucleotide coding this polypeptide | |
| CN1293247A (en) | Human zinc finger protein and its coding sequence | |
| CN1303946A (en) | Novel human ATP synthase and its code sequence | |
| CN1303866A (en) | Novel polypeptide-zinc finger protein 36 and polynucleotide for coding this polypeptide |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C06 | Publication | ||
| PB01 | Publication | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C56 | Change in the name or address of the patentee |
Owner name: SHANGHAI INST. OF LIFE SCIENCE, CAS Free format text: FORMER NAME OR ADDRESS: SHANGHAI INST. OF BIOCHEMISTRY, CHINESE ACADEMY OF SCIENCES |
|
| CP01 | Change in the name or title of a patent holder |
Address after: 200031 No. 320, Yueyang Road, Shanghai Patentee after: Shanghai Institute of life Sciences, Chinese Academy of Sciences Address before: 200031 No. 320, Yueyang Road, Shanghai Patentee before: Shanghai Research Institute of Biochemistry Chinese Academy of Sciences |
|
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20050323 Termination date: 20161229 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |