CN1297922A - Human calcium binding S100 protein 21 as one kind of polypeptide and polynucleotides encoding this polypeptide - Google Patents
Human calcium binding S100 protein 21 as one kind of polypeptide and polynucleotides encoding this polypeptide Download PDFInfo
- Publication number
- CN1297922A CN1297922A CN 99124131 CN99124131A CN1297922A CN 1297922 A CN1297922 A CN 1297922A CN 99124131 CN99124131 CN 99124131 CN 99124131 A CN99124131 A CN 99124131A CN 1297922 A CN1297922 A CN 1297922A
- Authority
- CN
- China
- Prior art keywords
- polypeptide
- polynucleotide
- protein
- calcium binding
- human calcium
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
- C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
- C07K14/4728—Calcium binding proteins, e.g. calmodulin
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
Abstract
The present invention discloses a novel polypeptide, human calcium binding S100 protein 21, polynucleotides encoding this polypeptide and DNA recombination process to produce the polypeptide. The present invention also discloses the method of applying the polypeptide in treating various diseases, such as malignant tumor, nosohemia, HIV infection, immunological diseases and inflammations. The present invention also discloses the antagonist resisting the polypeptide and its treatment effect. The present invention also discloses the application of the polynucleotides encoding this polypeptide.
Description
The invention belongs to biological technical field, relate to a kind of people's calcium in conjunction with S100 albumen, and the polynucleotide sequence of coded polypeptide and its production and application.
Many calcium binding proteins belong to identical evolution family, have a structural domain that is called as EF-hand.Such structural domain comprises the ring that 12 amino-acid residue is formed, and this ring stretches to both sides by the alpha helical region territory of 12 amino-acid residues, becomes an angle of 90 degrees approximately.In the EF-hand ring, calcium ion is incorporated in the conformation of a pentagonal bipyramid shape.Relate to 6 residues of bonded 1,3,5,7,9 and 12.Going up conservative Glu or Asp for 12 provides and two Sauerstoffatoms of Ca coordinate (bidentate part).
The variation of calcium ion concn has caused cell response widely in the enchylema.Intracellular calcium binding protein is to regulate the key molecule that conducts in the calcium signal by enzyme reaction or albumen one protein-interacting.In them some acted in the cell cycle, or acted on cytodifferentiation.After second signal molecule (as inositoltriphosphoric acid) stimulation, they are discharged into the tenuigenin on every side from endoplasmic reticulum momently.Similar process is broken and is taken place during the chromatid of mitosis anaphase separates at nuclear membrane.
S100 albumen is that the acid calcium of dimerization of a group small molecular weight (about 10-12KD) is conjugated protein, and is very abundant in brain.Owing to first isolating albumen solvable gaining the name in 100% ammonium sulfate.The most outstanding feature of these albumen is the existence of EF-hand.S100 albumen has 2 calcium calmodulin binding domain CaMs: there is low-affinity in--ring--the spiral zone that is basic spiral, another is the tart spiral--ring--spiral EF-hand zone.The EF-hand zone has also comprised the part in the zone of specificity discriminating S100 family, and it and calcium ion have high-affinity.
So far, do not find any special enzymic activity matter in these albumen.In S100 albumen, the combination of calcium has caused the change of conformation, thereby has influenced the secondary action protein.S100 albumen participates in the signal conduction that the intracellular Ca2+ in the narrow spectrum pattern of type increases.
S100 albumen is produced and secretion by spongiocyte in central authorities and peripheral nervous system.The accumulation of S100 is relevant with the microtubule effect in ripe spongiocyte.S100 has promoted Neural Differentiation and existence, if but overexpression, possible pair cell is harmful.Optionally excessive generation is relevant with the variation progress of senile dementia, may relate to the mitotic division protein kinase.
Adult T cell leukemia (ATL) is the mature T cells malignant tumour that is caused by human T lymphotropic virus I type.It is the special feature of ATL patient that TXi Baoshouti α β complex body (TCR. α .. β+) surface expression reduces.S100 albumen is at CD4+, and TCR. α .. β+ATL middle part of cell is expressed, but the CD4-in four ATL patients, CD8-expresses in TCR. α .. β+white corpuscle.This increase that shows S100 and ATL TCR. α .. β+the complex surfaces expression decreased is relevant.
The raising of S100 serum level is shifted relevant with the dispersive malignant melanoma.This shows that the amount of serum S100 can be used as the diagnostic markers that shifts the melanoma process.In addition, the mRNA of coding people calgizzarin (a kind of S100 albuminoid) and the mRNA of those coding phosphor esterases increase in colorectal carcinoma, show that S100 is relevant with the mechanism of these cancers.
It is neural that people S100 albumen and its Nucleotide of coding can be used for diagnosis, prevention and treatment, the transportation of film bubble, the illness of immunity and knurl.
One of purpose of the present invention provides a kind of isolating new polypeptide--human calcium binding S100 protein 21 and fragment thereof, analogue and derivative.
Two of purpose of the present invention provides the polynucleotide of this polypeptide of coding.
Three of purpose of the present invention provides the recombinant vectors of the polynucleotide that contain the human calcium binding S100 protein 21 of encoding.
Four of purpose of the present invention provides the genetically engineered host cell of the polynucleotide that contain the human calcium binding S100 protein 21 of encoding.
Five of purpose of the present invention provides the method for producing human calcium binding S100 protein 21.
Six of purpose of the present invention provides at polypeptide of the present invention--the antibody of human calcium binding S100 protein 21.
Seven of purpose of the present invention has provided at polypeptide of the present invention--the simulated compound of human calcium binding S100 protein 21, antagonist, agonist, inhibitor.
Eight of purpose of the present invention provides the method for the diagnoses and treatment disease relevant unusually with human calcium binding S100 protein 21.
The said human calcium binding S100 protein 21 of the present invention is the people source, and it comprises: have the polypeptide of SEQ IDNO:2 aminoacid sequence or its conservative property variation polypeptide or its active fragments or its reactive derivative, analogue.Preferably, this polypeptide is the polypeptide with SEQ ID NO:2 aminoacid sequence.
Relatively find according to amino acid sequence homologous, polypeptide of the present invention has the characteristic sequence of S100 gene family, the characteristic sequence of EF-hand particularly, deducibility goes out polypeptide of the present invention and belongs to the S100 gene family, therefore, the called after human calcium binding S100 protein 21 has the similar 26S Proteasome Structure and Function of S100 gene family.
Said " isolating " is meant that material separates (if natural substance, primal environment promptly is a natural surroundings) from its primal environment.The polynucleotide and the polypeptide that are present under the native state in the active somatic cell do not have separation and purification, it separate with other materials from native state, then are separation and purification.
Said " isolating human calcium binding S100 protein 21 " is meant that human calcium binding S100 protein 21 is substantially free of other albumen, lipid, carbohydrate or other material.Those skilled in the art can use the purified technology of protein purifying human calcium binding S100 protein 21 of standard.Basically pure polypeptide can produce single master tape on non-reduced polyacrylamide gel.The purity of human calcium binding S100 protein 21 polypeptide can be used amino acid sequence analysis.
Said new polypeptide--human calcium binding S100 protein 21, it is made up of the aminoacid sequence shown in the SEQ ID NO:2 basically.Polypeptide of the present invention can be recombinant polypeptide, natural polypeptides, synthetic polypeptide, preferred recombinant polypeptide.Polypeptide of the present invention can be the product of natural purifying, or the product of chemosynthesis, or uses recombinant technology to produce from protokaryon or eucaryon host (for example, bacterium, yeast, higher plant, insect and mammalian cell).The host used according to the recombinant production scheme, polypeptide of the present invention can be glycosylated, maybe can be nonglycosylated.Polypeptide of the present invention also can comprise or not comprise initial methionine residues.
The present invention also comprises fragment, derivative and the analogue of human calcium binding S100 protein 21.Term " fragment ", " derivative " are meant with " analogue " and keep identical biological function of human calcium binding S100 protein 21 of the present invention or active polypeptide basically.The fragment of polypeptide of the present invention, derivative or analogue can be: (I) is a kind of like this, wherein one or more amino-acid residues are replaced by conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the amino acid that replaces can be also can not encoded by genetic codon; Perhaps (II) is a kind of like this, and certain group on wherein one or more amino-acid residues is replaced by other group and comprises substituting group; Perhaps (III) is a kind of like this, and wherein mature polypeptide and another kind of compound (such as the compound that prolongs the polypeptide transformation period, for example polyoxyethylene glycol) merge; Perhaps (IV) is a kind of like this, wherein additional aminoacid sequence is integrated into mature polypeptide and the peptide sequence that forms (as leader sequence or secretion sequence or be used for the sequence or the proteinogen sequence of this polypeptide of purifying) by the elaboration of this paper, such fragment, derivative and analogue are considered within those skilled in the art's ken.
The polynucleotide of said these polypeptide of coding of the present invention comprise a nucleotide sequence, and this nucleotide sequence is shown at least 70% homogeny with a kind of nucleotides sequence that is selected from down group: (a) polynucleotide of the above-mentioned human calcium binding S100 protein 21 of coding; (b) with polynucleotide (a) complementary polynucleotide.Preferably, this polynucleotide encoding has the polypeptide of aminoacid sequence shown in the SEQ ID NO:2.More preferably, the sequence of these polynucleotide is be selected from down group a kind of: the sequence that (a) has 365-946 position among the SEQ ID NO:1; (b) has the sequence of 1-3507 position among the SEQ ID NO:1.
Said isolating nucleic acid (polynucleotide) substantially is made up of the polynucleotide that coding has a polypeptide of SEQ ID NO:2 aminoacid sequence.Polynucleotide sequence of the present invention comprises the nucleotide sequence of SEQ ID NO:1.Polynucleotide of the present invention are to find from the cDNA library of people's fetal brain tissue.The polynucleotide sequence total length that it comprises is 3507 bases, its open reading frame (365-946) 193 amino acid of having encoded.Find relatively that according to amino acid sequence homologous this polypeptide and homologous protein neurocalcin have 99% homology, deducibility goes out this human calcium binding S100 protein 21 and has the similar 26S Proteasome Structure and Function of homologous protein neurocalcin.
Polynucleotide of the present invention can be dna form or rna form.Dna form comprises the DNA of cDNA, genomic dna or synthetic.DNA can be strand or double-stranded.DNA can be coding strand or noncoding strand.The coding region sequence of encoding mature polypeptide can be identical with the coding region sequence shown in the SEQ ID NO:1 or the varient of degeneracy.Said " varient of degeneracy " is meant that coding has protein or the polypeptide of SEQID NO:2, but with the differentiated nucleotide sequence of coding region sequence shown in the SEQ ID NO:1.
The polynucleotide of the mature polypeptide of coding SEQ ID NO:2 comprise: the encoding sequence that has only mature polypeptide; The encoding sequence of mature polypeptide and various additional code sequence; Encoding sequence of mature polypeptide (with optional additional code sequence) and non-coding sequence.
Term " polynucleotide of coded polypeptide " is meant polynucleotide that comprise this polypeptide of encoding and the polynucleotide that comprise additional code and/or non-coding sequence.
The invention still further relates to the varient of foregoing description polynucleotide, its coding has the polypeptide of identical aminoacid sequence or segment, analogue and the derivative of polypeptide with the present invention.The varient of these polynucleotide can be the allelic variant of natural generation or the varient that non-natural takes place.These nucleotide diversity bodies comprise and replace varient, deletion mutation body and insert varient.As known in the art, allelic variant is the replacement form of polynucleotide, and it may be replacement, disappearance or the insertion of one or more Nucleotide, but can be from not changing the function of its encoded polypeptides in fact.
The invention still further relates to and the polynucleotide (have at least 50% between two sequences, preferably have 70% homogeny) of sequence hybridization described above.The present invention be more particularly directed under stringent condition and the interfertile polynucleotide of polynucleotide of the present invention.In the present invention, " stringent condition " is meant: (1) than hybridization under low ionic strength and the comparatively high temps and wash-out, as 0.2 * SSC, and 0.1%SDS, 60 ℃; Or (2) hybridization the time adds and to use denaturing agent, as 50% (v/v) methane amide, 0.1% calf serum/0.1%Ficoll, 42 ℃ etc.; Or (3) only at the homogeny between the two sequences at least more than 95%, be more preferably 97% and just hybridize when above.And the polypeptide of interfertile polynucleotide encoding has identical biological function and activity with the mature polypeptide shown in the SEQ ID NO:2.
The invention still further relates to nucleic acid fragment with sequence hybridization described above.The length of said " nucleic acid fragment " contains 10 Nucleotide at least, better is 20-30 Nucleotide at least, is more preferably 50-60 Nucleotide at least, preferably more than at least 100 Nucleotide.Nucleic acid fragment also can be used for the amplification technique (as PCR) of nucleic acid to determine and/or to separate the polynucleotide of coding human calcium binding S100 protein 21.
Polypeptide among the present invention and polynucleotide preferably provide with isolating form, more preferably are purified to homogeneous.
The special polynucleotide sequence of coding human calcium binding S100 protein 21 of the present invention can obtain with several different methods.For example, separate polynucleotide with hybridization technique well known in the art.These technology including, but not limited to: 1) with probe and genome or the hybridization of cDNA library to detect homologous polynucleotide sequence and 2) antibody screening of expression library to be to detect the polynucleotide passage of the clone with common structure feature.
Sequence dna fragment of the present invention also can obtain with following method: 1) separate double chain DNA sequence from genomic dna; 2) the chemical synthesising DNA sequence is to obtain the double-stranded DNA of described polypeptide.
In the above-mentioned method of mentioning, isolation of genomic DNA is least commonly used.The direct chemical of dna sequence dna is synthetic to be the method for often selecting for use.The more frequent method of selecting for use is the separation of cDNA sequence.The standard method that separates interested cDNA is from the donorcells separating mRNA of this gene of high expression level and carries out reverse transcription, forms plasmid or phage cDNA library.Extract the existing multiple proven technique of method of mRNA, test kit also can obtain (Qiagene) from commercial channels.And the construction cDNA library also is usual method (Sambrook, etal., Molecular Cloning, A Laboratory Manual, Cold Spring HarborLaboratory.New York, 1989).Also can obtain the cDNA library of commercial offers, as the different cDNA library of Clontech company.When being used in combination the polymeric enzyme reaction technology, even few expression product also can be cloned.
Available ordinary method is screened gene of the present invention from these cDNA libraries.These methods include, but is not limited to: (1) DNA-DNA or DNA-RNA hybridization; (2) appearance of marker gene function or forfeiture; (3) level of the transcript of mensuration human calcium binding S100 protein 21; (4), detect the protein product of genetic expression by immunological technique or mensuration biologic activity.Aforesaid method can singly be used, but also several different methods combined utilization.
In (1) kind method, hybridizing used probe is and any a part of homology of polynucleotide of the present invention that at least 10 Nucleotide of its length better are at least 30 Nucleotide, are more preferably at least 50 Nucleotide, preferably at least 100 Nucleotide.In addition, within 2000 Nucleotide, preferable is within 1000 Nucleotide to the length of probe usually.Probe used herein is the dna sequence dna of chemosynthesis on the basis of gene order information of the present invention normally.Gene of the present invention itself or fragment are certainly as probe.The mark of dna probe can be used radio isotope, fluorescein or enzyme (as alkaline phosphatase) etc.
In (4) kind method, detect the protein product of human calcium binding S100 protein 21 genetic expression and can use immunological technique such as Western blotting, radioimmunoprecipitation, enzyme-linked immunosorbent assay (ELISA) etc.
Use method (Saiki, the et al.Science1985 of round pcr DNA amplification/RNA; 230:1350-1354) be optimized for acquisition gene of the present invention.When particularly being difficult to from the library, obtain the cDNA of total length, can preferably use RACE method (the terminal rapid amplifying method of RACE-cDNA), the primer that is used for PCR can suitably be selected according to polynucleotide sequence information of the present invention disclosed herein, and available ordinary method is synthetic, as the DNA/RNA fragment by gel electrophoresis separation and purifying amplification.
The gene of the present invention that obtains as mentioned above, perhaps the polynucleotide sequence of various dna fragmentations etc. can with ordinary method such as dideoxy chain termination (Sanger et al.PNAS, 1977,74:5463-5467) measure.This class polynucleotide sequence is measured also available commercial sequencing kit etc.In order to obtain the cDNA sequence of total length, order-checking need be carried out repeatedly.Sometimes need to measure a plurality of clones' cDNA sequence, just can be spliced into the cDNA sequence of total length.
The present invention also relates to comprise the carrier of said polynucleotide, and transforming with carrier of the present invention or the host cell that directly produces through genetically engineered, by this carrier or the host cell of transduceing or directly transformed by above-mentioned polynucleotide or the host cell of transduction, and the method that produces polypeptide of the present invention through recombinant technology with the human calcium binding S100 protein 21 encoding sequence.
Among the present invention, the polynucleotide sequence of coding human calcium binding S100 protein 21 can be inserted in the carrier, contains the recombinant vectors of polynucleotide of the present invention with formation.Term " carrier " refers to that bacterial plasmid well known in the art, phage, yeast plasmid, vegetable cell virus, mammalian cell virus are as adenovirus, retrovirus or other carrier.The carrier of Shi Yonging includes but not limited in the present invention: and the expression vector based on the T7 promotor of in bacterium, expressing (Rosenberg, et al.Gene, 1987,56:125); The pMSXND expression vector of in mammalian cell, expressing (Lee and Nathans, J Bio Chem.263:3521,1988) and at the carrier that derives from baculovirus of expressed in insect cells.In a word, as long as can duplicate in host and stablize, any plasmid and carrier may be used to make up recombinant expression vector.A key character of expression vector is to contain replication origin, promotor, marker gene and translational control element usually.
Method well-known to those having ordinary skill in the art can be used to make up the dna sequence dna that contains the human calcium binding S100 protein 21 of encoding and the expression vector of suitable transcribing/translational control element.These methods comprise (Sambroook, et al.MolecularCloning, a Laboratory Manual, cold Spring Harbor Laboratory.NewYork, 1989) such as extracorporeal recombinant DNA technology, DNA synthetic technology, the interior recombinant technologys of body.Described dna sequence dna can effectively be connected on the suitable promotor in the expression vector, and is synthetic to instruct mRNA.The representative example of these promotors has: colibacillary lac or trp promotor; The PL promotor of lambda particles phage; Eukaryotic promoter comprises LTRs and some other known may command gene expression promoter in prokaryotic cell prokaryocyte or eukaryotic cell or its virus of CMV immediate early promoter, HSV thymidine kinase promoter, early stage and late period SV40 promotor, retrovirus.Expression vector also comprises ribosome bind site that translation initiation is used and transcription terminator etc.Inserting enhancer sequence in carrier will make its transcribing in higher eucaryotic cells be enhanced.Enhanser is the cis acting factor that DNA expresses, and nearly 10 to 300 base pairs act on promotor transcribing with enhancing gene usually.Can for example be included in the SV40 enhanser of 100 to 270 base pairs of replication origin side in late period one, at the polyoma enhanser of replication origin side in late period one and adenovirus enhanser etc.
In addition, expression vector preferably comprises one or more selected markers, to be provided for selecting the phenotypic character of transformed host cells, cultivate Tetrahydrofolate dehydrogenase, neomycin resistance and the green fluorescent protein (GFP) of usefulness as eukaryotic cell, or be used for colibacillary tsiklomitsin or amicillin resistance etc.
Persons skilled in the art all know how to select appropriate carriers/transcriptional regulatory element (as promotor, enhanser etc.) and selected marker.
Among the present invention, the polynucleotide of coding human calcium binding S100 protein 21 or the recombinant vectors that contains these polynucleotide can transform or transduce into host cell, contain the genetically engineered host cell of these polynucleotide or recombinant vectors with formation.Term " host cell " refers to prokaryotic cell prokaryocyte, as bacterial cell; Or eukaryotic cell such as low, as yeast cell; Or higher eucaryotic cells, as mammalian cell.Representative example has: intestinal bacteria, streptomyces; Bacterial cell such as Salmonella typhimurium; Fungal cell such as yeast; Vegetable cell; Insect cell such as fruit bat S2 or Sf9; Zooblast such as CHO, COS or Bowes melanoma cells etc.
Can carry out with routine techniques well known to those skilled in the art with dna sequence dna of the present invention or the recombinant vectors transformed host cell that contains described dna sequence dna.When the host was prokaryotic organism such as intestinal bacteria, the competent cell that can absorb DNA can be used CaCl in exponential growth after date results
2Method is handled, and used step is well-known in this area.Alternative is to use MgCl
2If desired, transforming also the method for available electroporation carries out.When the host is an eukaryote, can select following DNA transfection method for use: coprecipitation of calcium phosphate method, perhaps conventional mechanical method such as microinjection, electroporation, liposome packing etc.
By the recombinant DNA technology of routine, utilize polynucleotide sequence of the present invention to can be used to express or produce human calcium binding S100 protein 21 (Science, 1984 of reorganization; 224:1431).In general following steps are arranged:
(1), or uses with the polynucleotide (or varient) of coding human calcium binding S100 protein 21 of the present invention
The recombinant expression vector that contains these polynucleotide transforms or the transduction proper host cell;
(2) in suitable medium, cultivate host cell;
(3) separation, protein purification from substratum or cell.
In step (2), according to used host cell, used substratum can be selected from various conventional substratum in the cultivation.Under the condition that is suitable for the host cell growth, cultivate.After host cell grows into suitable cell density, induce the promotor of selection with suitable method (as temperature transition or chemical induction), cell is cultivated for some time again.
In step (3), recombinant polypeptide can wrap and be expressed or be secreted into the extracellular in cell or on cytolemma.If desired, can utilize its physics, the separating by various separation methods with other characteristic and the albumen of purification of Recombinant of chemistry.These methods are well-known to those skilled in the art.These methods include, but are not limited to: conventional renaturation is handled, protein precipitant is handled (salt analysis method), centrifugal, the broken bacterium of infiltration, the combination of ultrasonication, super centrifugal, sieve chromatography (gel-filtration), adsorption chromatography, ion exchange chromatography, high performance liquid chromatography (HPLC) and other various liquid chromatography (LC) technology and these methods.
S100 relates to neurological illness.Such illness includes but not limited to cathisophobia, senile dementia, amnesia, myatrophy sclerosis, bipolar cell disorder, catatonia, brain vegetation, dementia, dysthymia disorders, Down's syndrome, tardy property dyskinesia, dystonia, epilepsy, Huntington Chorea, plyability sclerosis, neurofibroma, Parkinson's disease, paranoea, psychotic disorder, tourette's disease etc.On the one hand, with the antibody of S100 specific combination directly as antagonist, or indirectly as the target material or participate in the mechanism of transportation medicine to the cell or tissue of expressing S100.
S100 relates to the illness about the disorderly aspect of film bubble transportation.Such illness includes but not limited to vesical fibrosis, glucose--semi-lactosi malabsorption syndromes, hypercholesterolemia, diabetes, hypoglycemia, Graves disease, thyrocele, Cushing disease and pernicious anemia; The illness of stomach comprises ulcerative colitis, gastric duodenal ulcer, and other and the relevant illness of undesired film bubble transportation comprise AIDS; Anaphylaxis comprises asthma and rubella, autoimmunization haemolysis anaemia; The diffustivity glomerulonephritis; Enteritis, the multiplicity sclerosis, rheumatism, osteoarthritis, myasthenia gravis, scleroderma is cut ground Acker-Dong syndromes; Systemic lupus erythematous, toxic shock syndrome is organized wound, bacterium, fungi, parasite and protozoal infections.On the one hand, specificity and S100 bonded antibody can indirectly as the target material, participate in carrying the transport mechanism of medicine to the cell or tissue of expressing S100 directly as antagonist.
S100 relates to the illness that autoimmune disorder causes.Such illness includes but are not limited to AIDS, pernicious anemia, adult's Respiratory distress syndrome, anaphylaxis, anaemia, asthma, the sample sclerosis of artery week, bronchitis, cholecystitis, interim ileitis, ulcerative colitis, specific skin inflammation, dermatomyositis, diabetes, pulmonary emphysema, atrophic gastritis, glomerulonephritis, gout, Graves disease, eosinophilia, irritable bowel syndrome, lupus erythematosus, plyability sclerosis, myasthenia gravis, myocarditis, osteoarthritis, osteoporosis, pancreatitis, polymyositis, rheumatic arthritis, scleroderma, Si Yegelun syndromes and autoimmunization thyroiditis, cancer complication, hemodialysis and extracorporeal circulation, bacterium, fungi, parasite and protozoal infections and wound.On the one hand, specificity and S100 bonded antibody can indirectly as the target material, participate in carrying the transport mechanism of medicine to the cell or tissue of expressing S100 directly as antagonist.
S100 relates to the mechanism of tumour.These diseases include but are not limited to gland cancer, leukemia, lymphatic cancer, melanotic cancer, bone marrow cancer, sarcoma, the cancer in teratoma, particularly uterine cervix, suprarenal gland, bladder, bone, marrow, brain, chest, gall-bladder, neuroganglion, intestines and stomach, the heart, kidney, liver, lung, muscle, ovary, pancreas, parathyroid gland, penis, prostate gland, sialisterium, skin, spleen, testis, thymus gland, Tiroidina and uterus.On the one hand, specificity and S100 bonded antibody can indirectly as the target material, participate in carrying the transport mechanism of medicine to the cell or tissue of expressing S100 directly as antagonist.
The antagonist of polypeptide of the present invention and this polypeptide, agonist and inhibitor can be directly used in disease treatment, for example, can treat malignant tumour, adrenal gland defect, tetter, all kinds of inflammation, HIV infection and immunological disease etc.
The present invention also provides SCREENED COMPOUND to identify the method that improves (agonist) or check the medicament of (antagonist) human calcium binding S100 protein 21.Agonist improves human calcium binding S100 protein 21 biological function such as stimulate cellular proliferation, and antagonist prevention disorder such as the various cancer relevant with cell hyperproliferation with treatment.For example, can in the presence of medicine, the film preparation of mammalian cell or expressing human calcium binding S 100 protein 21 as one kind be cultivated with the human calcium binding S100 protein 21 of mark.Measure the medicine raising then or check this interactional ability.
The antagonist of human calcium binding S100 protein 21 comprises antibody, compound, acceptor disappearance thing and the analogue etc. that filter out.The antagonist of human calcium binding S100 protein 21 can combine and eliminate its function with human calcium binding S100 protein 21, or suppresses the generation of this polypeptide, or combines with the avtive spot of this polypeptide and to make this polypeptide can not bring into play biological function.
In screening during as the compound of antagonist, human calcium binding S100 protein 21 can be added during bioanalysis measures, by measuring compound interactional influence between human calcium binding S100 protein 21 and its acceptor is determined whether compound is antagonist.With the same quadrat method of above-mentioned SCREENED COMPOUND, can filter out the acceptor disappearance thing and the analogue of antagonist action.Can be incorporated into the rondom polypeptide storehouse that solid formation forms by the various amino acid that may make up by screening with human calcium binding S100 protein 21 bonded peptide molecule obtains.During screening, generally tackle the human calcium binding S100 protein 21 molecule and carry out mark.
The invention provides and use polypeptide, and fragment, derivative, analogue or their cell are as the method for antigen with production antibody.These antibody can be polyclonal antibody or monoclonal antibody.The present invention also provides the antibody at the human calcium binding S100 protein 21 antigenic determinant.These antibody include, but is not limited to: the fragment that polyclonal antibody, monoclonal antibody, chimeric antibody, single-chain antibody, Fab fragment and Fab expression library produce.
The method of the available human calcium binding S100 protein 21 direct injection of the production of polyclonal antibody immune animal (as rabbit, mouse, rat etc.) obtains, and multiple adjuvant can be used for the enhancing immunity reaction, includes but not limited to freund's adjuvant etc.The technology of monoclonal antibody of preparation human calcium binding S100 protein 21 include but not limited to hybridoma technology (Kohler and Milstein.Nature, 1975,256:495-497), three knurl technology, people B-quadroma technology, EBV-hybridoma technology etc.With the variable region bonded chimeric antibody in human constant region and inhuman source can with existing technology production (Morrison et alPNAS, 1985,81:6851).And the technology of existing manufacture order chain antibody (U.S.PatNo.4946778) also can be used for producing the single-chain antibody of anti-human calcium binding S100 protein 21.
The antibody of anti-human calcium binding S100 protein 21 can be used in the immunohistochemistry technology, detects the human calcium binding S100 protein 21 in the biopsy specimen.
With the also available labelled with radioisotope of human calcium binding S100 protein 21 bonded monoclonal antibody, inject in the body and can follow the tracks of its position and distribution.This radiolabeled antibody can be used as a kind of atraumatic diagnostic method and is used for the location of tumour cell and has judged whether transfer.
Antibody also can be used for designing the immunotoxin at a certain privileged sites in the body.As the monoclonal antibody of human calcium binding S100 protein 21 high-affinity can with bacterium or plant poison (as diphtheria toxin, ricin, abrine etc.) covalent attachment.A kind of usual method is with sulfydryl linking agent such as SPDP, attacks the amino of antibody, by the exchange of disulfide linkage, toxin is incorporated on the antibody, and this hybrid antibody can be used for killing the human calcium binding S100 protein 21 positive cells.
The disease that antibody among the present invention can be used for treating or prevention is relevant with human calcium binding S100 protein 21.The antibody that gives suitable dosage can stimulate or block the generation or the activity of human calcium binding S100 protein 21.
The invention still further relates to the diagnostic testing process of quantitative and detection and localization human calcium binding S100 protein 21 level.These tests are known in the art, and comprise that FISH measures and radioimmunoassay.The human calcium binding S100 protein 21 level that is detected in the test can be with laying down a definition the importance of human calcium binding S100 protein 21 in various diseases and be used to the disease of diagnosing human calcium binding S100 protein 21 to work.
Polypeptide of the present invention also can be used as the peptide spectrum analysis, for example, the polypeptide available physical, chemistry or enzyme carry out the specificity cutting, and carries out the two-dimentional or three-dimensional gel electrophoresis analysis of one dimension, be more preferably and carry out mass spectroscopy.
The polynucleotide of coding human calcium binding S100 protein 21 also can be used for multiple therapeutic purpose.Gene therapy technology can be used for treating because cell proliferation, growth or the metabolic disturbance due to the nothing expression of human calcium binding S100 protein 21 or the unusual/non-activity expression.The gene therapy vector (as virus vector) of reorganization can be designed for the human calcium binding S100 protein 21 of expressing variation, to suppress endogenic human calcium binding S100 protein 21 activity.For example, a kind of human calcium binding S100 protein 21 of variation can be the human calcium binding S100 protein 21 that shortens, lacked signal conduction function territory, though can combine with the substrate in downstream, lacks signaling activity.Therefore the gene therapy vector of reorganization can be used for treating the disease of human calcium binding S100 protein 21 expression or active caused by abnormal.Deriving from viral expression vector such as retrovirus, adenovirus, adeno-associated virus (AAV), hsv, parvovirus etc. can be used for the polynucleotide of coding human calcium binding S100 protein 21 are transferred in the cell.The method of recombinant viral vector that structure carries the polynucleotide of coding human calcium binding S100 protein 21 is found in existing document (Sambrook, et al.).The polynucleotide of reorganization coding human calcium binding S100 protein 21 can be packaged in the liposome and be transferred in the cell in addition.
Polynucleotide import tissue or intracellular method comprises: directly be injected into polynucleotide in the in-vivo tissue; Or external by carrier (as virus, phage or plasmid etc.) earlier with the polynucleotide transfered cell in, again cell is transplanted in the body etc.
Suppress the oligonucleotide (comprising sense-rna and DNA) of { polypeptide title } mRNA and ribozyme also within the scope of the invention.Ribozyme is the enzyme sample RNA molecule that a kind of energy specificity is decomposed specific RNA, and its mechanism of action is to carry out the endonuclease effect after ribozyme molecule and the hybridization of complementary target RNA-specific.The RNA of antisense and DNA and ribozyme can obtain with existing any RNA or DNA synthetic technology, as the technology widespread use of solid phase phosphoamide chemical synthesis synthetic oligonucleotide.Antisense rna molecule can be transcribed acquisition by the dna sequence dna of this RNA that encodes in external or body.This dna sequence dna has been incorporated into the downstream of rna polymerase promoter of carrier.In order to increase the stability of nucleic acid molecule, available several different methods is modified it, and as increasing the sequence length of both sides, the connection between the ribonucleoside is used phosphoric acid thioester bond or peptide bond but not phosphodiester bond.
The polynucleotide of coding human calcium binding S100 protein 21 can be used for the diagnosis with the relative disease of human calcium binding S100 protein 21.The unconventionality expression of the expression that the polynucleotide of coding human calcium binding S100 protein 21 can be used for detecting human calcium binding S100 protein 21 human calcium binding S100 protein 21 whether or under morbid state.As the dna sequence dna of the human calcium binding S100 protein 21 of encoding can be used for biopsy specimen is hybridized to judge the expression situation of human calcium binding S100 protein 21.Hybridization technique comprises the Southern blotting, Northern blotting, in situ hybridization etc.These technological methods all are disclosed mature technologies, and relevant test kit all can obtain from commercial channels.Part or all of polynucleotide of the present invention can be used as probe stationary on microarray (Microarray) or DNA chip (being called " gene chip " again), is used for analyzing the differential expression analysis and the gene diagnosis of tissue gene.Carry out the transcription product that RNA-polymerase chain reaction (RT-PCR) amplification in vitro also can detect human calcium binding S100 protein 21 with the special primer of human calcium binding S100 protein 21.
The sudden change that detects the human calcium binding S100 protein 21 gene also can be used for the disease of diagnosing human calcium binding S100 protein 21 relevant.The form of human calcium binding S100 protein 21 sudden change comprises that the point mutation compared with normal wild type human calcium binding S100 protein 21 dna sequence dna, transposition, disappearance, reorganization and other are any unusual etc.Available existing technology such as Southern blotting, dna sequence analysis, PCR and in situ hybridization detect sudden change.In addition, sudden change might influence proteic expression, therefore can judge indirectly that with Northern blotting, Western blotting gene has or not sudden change.
Sequence of the present invention identifies it also is valuable to karyomit(e).This sequence can be specifically at certain bar human chromosome particular location and can with its hybridization.At present, need to identify the concrete site of each gene on the karyomit(e).Now, have only chromosomal marker thing seldom to can be used for the marker chromosomes position based on actual sequence data (repetition polymorphism).According to the present invention, for these sequences are associated with disease related gene, its important the first step is positioned these dna sequence dnas on the karyomit(e) exactly.
In brief, prepare PCR primer (preferred 15-35bp), sequence can be positioned on the karyomit(e) according to cDNA.Then, these primers are used for the somatocyte hybrid cell that the PCR screening contains each bar human chromosome.Have only those hybrid cells that contain corresponding to the people's gene of primer can produce the fragment of amplification.
The PCR localization method of somatocyte hybrid cell is that DNA is navigated to concrete chromosomal quick method.Use Oligonucleolide primers of the present invention,, can utilize one group to realize inferior location from specific chromosomal fragment or a large amount of genomic clone by similar approach.Other the similar strategy that can be used for chromosomal localization comprises in situ hybridization, uses the karyomit(e) prescreen and the hybridization preliminary election of the airflow classification of mark, thereby makes up the special cDNA storehouse of karyomit(e).
The cDNA clone is carried out fluorescence in situ hybridization (FISH) with Metaphase Chromosome, can in a step, accurately carry out chromosomal localization.The summary of this technology is referring to Verma etc., HumanChromosomes:a Manual of Basic Techniques, Pergamon Press, NewYork (1988).
In case sequence is positioned to chromosome position accurately, the physical location of this sequence on karyomit(e) just can be associated with the gene map data.These data for example are found in, V.Mckusick, MendelianInheritance in Man (can by with the online acquisition of Johns Hopkins University Welch MedicalLibrary).Can pass through linkage analysis then, determine gene and navigated to relation between the disease on the chromosomal region already.
Then, need to measure ill and not cDNA between diseased individuals or genome sequence difference.If observe certain sudden change in some or all of diseased individuals, and this sudden change is not observed in any normal individual, then this sudden change may be the cause of disease of disease.More ill and diseased individuals not is usually directed at first seek the variation of structure in the karyomit(e), as from the horizontal visible of karyomit(e) or use based on detectable disappearance of the PCR of cDNA sequence or transposition.Resolving power according to present physical mapping and assignment of genes gene mapping technology, being accurately positioned to the cDNA of the chromosomal region relevant with disease, can be a kind of (the supposing that 1 megabasse mapping resolving power and every 20kb are corresponding to a gene) between 50 to 500 potential Disease-causing genes.
Polypeptide of the present invention, polynucleotide and stand-in thereof, agonist, antagonist and inhibitor and suitable pharmaceutical carrier combination back can be used.These carriers can be water, glucose, ethanol, salt, damping fluid, glycerine and their combination.Composition comprises the polypeptide or the antagonist of safe and effective amount and carrier and the vehicle that does not influence effect of drugs.These compositions can be used as medicine and are used for disease treatment.
The present invention also provides medicine box or the test kit that contains one or more containers, and one or more medicinal compositions compositions of the present invention are housed in the container.With these containers, can have by the given indicative prompting of government authorities of making, using or selling medicine or biological products, the government authorities that this prompting reflects production, uses or sells permits it to use on human body.In addition, polypeptide of the present invention can be used in combination with other treatment compound.
Pharmaceutical composition can be with mode administration easily, as by in part, intravenously, intraperitoneal, intramuscular, subcutaneous, the nose or the route of administration of intracutaneous.Human calcium binding S100 protein 21 comes administration with the amount that treats and/or prevents concrete indication effectively.The amount and the dosage range that are applied to patient's human calcium binding S100 protein 21 will depend on many factors, as administering mode, person's to be treated healthiness condition and diagnostician's judgement.
Following accompanying drawing is used to illustrate specific embodiments of the present invention, and is not used in qualification by the scope of the invention that claims defined.
Fig. 1 is the amino acid sequence homology comparison diagram of inventor's calcium binding S 100 protein 21 as one kind and homologous protein neurocalcin.The top sequence is a human calcium binding S100 protein 21, and the below sequence is the homologous protein neurocalcin.Same amino acid is represented with monocase amino acid between two sequences.As seen from Figure 1, its homogeny and similar figures are 192/193 (99%).
Fig. 2 is the polyacrylamide gel electrophoresis figure (SDS-PAGE) of isolating human calcium binding S100 protein 21.2lkDa is proteinic molecular weight.The arrow indication is isolated protein band.
Others of the present invention are because disclosing of the technology of this paper is conspicuous to those skilled in the art.
Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to normal condition, show as people such as Sambrook, [molecular cloning: laboratory manual (New York:Cold Spring Harbor Laboratory Press, 1989) condition], or the condition of advising according to manufacturer.
Embodiment 1: the clone of human calcium binding S100 protein 21
Extract the total RNA of people's tire brain with guanidinium isothiocyanate/phenol/chloroform single stage method.From total RNA, separate poly (A) mRNA with Quik mRNAIsolation Kit (Qiegene company product).2ugpoly (A) mRNA forms cDNA through reverse transcription.CDNA fragment orientation is inserted on the multiple clone site of pBSK (+) carrier (clontech company product) with Smart cDNA clone's test kit (available from Clontech), transforms DH5 α, bacterium forms the cDNA library.Measure all clones' 5 ' and 3 ' terminal sequence with Dye terminate cyclereaction sequencing Kit (Perkin-Elmer company product) and ABI 377 automatic sequencers (Perkin-Elmer company).CDNA sequence and the existing public dna sequence data storehouse (Genebank) measured are compared, found that one of them clone's 0589 cDNA sequence is new DNA.By synthetic a series of primers the contained insertion cDNA fragment of this clone is carried out two-way mensuration.The result shows, the contained full-length cDNA of 0589 clone is 3507bp (shown in Seq ID NO:1), from 365bp to 946bp the open reading frame (ORF) of a 193bp, the new protein (shown in Seq ID NO:2) of encoding arranged.We are with this clone's called after pBS-0589, encoded protein matter called after human calcium binding S100 protein 21.
Embodiment 2:cDNA clone's homology retrieval
With the sequence and the encoded protein sequence thereof of human calcium binding S100 protein 21 of the present invention, with Blast program (Basiclocal Alignment search tool) [Altschul, SF et al.J.Mol.Biol.1990; 215:403-10], carry out the homology retrieval at databases such as Genbank, Swissport.The gene the highest with human calcium binding S100 protein 21 homology of the present invention is a kind of known homologous protein neurocalcin, and its encoded protein number is D10884 in the access of Genbank.Protein homology the results are shown in Fig. 1, both height homologies, and its homogeny is 99%; Similarity is 99%.
Embodiment 3: with the gene of RT-PCR method clones coding human calcium binding S100 protein 21
Total RNA is a template with fetus brain cell, is that primer carries out the synthetic cDNA of reverse transcription reaction with oligo-dT, with behind the test kit purifying of Qiagene, carries out pcr amplification with following primer:
Primer1:5’-ACGGCTGCGAGAAGACGAAGCTT-3’(SEQ?ID?NO:3)
Primer2:5’-AAGCCACTTTATTCCAGTCCCTT-3’(SEQ?ID?NO:4)
Primer1 is the forward sequence that begins of 1bp that is positioned at the 5 ' end of SEQ ID NO:1;
Primer2 be SEQ ID NO:1 in 3 ' end reverse sequence.
The condition of amplified reaction: in the reaction volume of 50 μ l, contain 50mmol/L KCl, 10mmol/LTris-Cl, (pH8.5), 1.5mmol/L MgCl
2, 200 μ mol/L dNTP, 10pmol primer, the Taq archaeal dna polymerase of 1U (Clontech company product).Go up by 25 cycles of following conditioned response at PE9600 type DNA thermal cycler (Perkin-Elmer company): 94 ℃ of 30sec; 55 ℃ of 30sec; 72 ℃ of 2min.When RT-PCR, establish the blank negative contrast of positive contrast of β-actin and template simultaneously.Amplified production is connected to (Invitrogen company product) on the pCR carrier with the test kit purifying of QIAGEN company with TA clone test kit.The dna sequence analysis result shows that the dna sequence dna of PCR product and the 1-3507bp shown in the SEQID NO:1 are identical.
Embodiment 4:Northern blotting analyst calcium binding S 100 protein 21 as one kind expression of gene:
Extract total RNA[Anal.Biochem 1987,162,156-159 with single stage method].This method comprises acid guanidine thiocyanate phenol-chloroform extracting.Promptly use 4M guanidinium isothiocyanate-25mM Trisodium Citrate, 0.2M sodium acetate (pH4.0) carries out homogenate to tissue, adds the phenol of 1 times of volume and the chloroform-primary isoamyl alcohol (49: 1) of 1/5 volume, and is centrifugal after mixing.The sucking-off aqueous phase layer adds Virahol (0.8 volume) and with the centrifugal RNA precipitation that obtains of mixture.With RNA precipitation 70% washing with alcohol that obtains, dry and soluble in water.With 20 μ g RNA, on 1.2% sepharose that contains 20mM 3-(N-morpholino) propanesulfonic acid (pH7.0)-SmM sodium acetate-1mMEDTA-2.2M formaldehyde, carry out electrophoresis.Be transferred on the nitrocellulose filter then.With α-
32P dATP prepares by random priming
32The dna probe of P-mark.Used dna probe is the human calcium binding S100 protein 21 coding region sequence (365bp to 946bp) of pcr amplification shown in Figure 1.Will
32The probe of p-mark (about 2 * 10
6Cpm/ml) spend the night in 42 ℃ of hybridization in a solution with the nitrocellulose filter that has shifted RNA, this solution comprises 50% methane amide-25mM KH
2PO
4(pH7.4)-5 * SSC-5 * Denhardt ' s solution and 200 μ g/ml salmon sperm DNAs.After the hybridization, filter membrane is washed 30min in 55 ℃ in 1 * SSC-0.1%SDS.Then, analyze with quantitative with Phosphor Imager.
Embodiment 5: the vivoexpression of recombinant human calcium binding S 100 protein 21 as one kind, separation and purifying
According to SEQ ID NO:1 and coding region sequence shown in Figure 1, design a pair of specificity amplification primer, sequence is as follows:
Primer3:5’-CCCCATATGATGGGGAAACAGAACAGCAAGCTG-3’(Seq?ID?No:5)
Primer4:5’-CCCGGATCCAATTCGATTGGTGGGCGCAGGGCT-3’(Seq?ID?No:6)
5 ' end of these two sections primers contains Nde I and BamH I restriction enzyme site respectively, be respectively the encoding sequence of target gene 5 ' end and 3 ' end thereafter, Nde I and BamH I restriction enzyme site are corresponding to expression vector plasmid pET-28b (+) (Novagen company product, Cat.No.69865.3) the selectivity restriction enzyme site on.With the pBS-0589 plasmid that contains the total length goal gene is template, carries out the PCR reaction.The PCR reaction conditions is: contain pBS-0589 plasmid 10pg, primer Primer-3 and Primer-4 among the cumulative volume 50 μ l and be respectively 10pmol, Advantage polymerase Mix (Clontech company product) 1 μ l.Loop parameter: 94 ℃ of 20s, 60 ℃ of 30s, 68 ℃ of 2min, totally 25 circulations.Respectively amplified production and plasmid pET-28 (+) are carried out double digestion with Nde I and BamH I, reclaim big fragment respectively, and connect with the T4 ligase enzyme.Connect product and transform, after the dull and stereotyped overnight incubation of the LB that contains kantlex (final concentration 30 μ g/ml), use the colony polymerase chain reaction (PCR) method screening positive clone, and check order with the big enterobacterial DH5 of Calcium Chloride Method α.Select the correct positive colony of sequence (pET-0589) with Calcium Chloride Method with recombinant plasmid transformed e. coli bl21 (DE3) plySs (Novagen company product).In the LB liquid nutrient medium that contains kantlex (final concentration 30 μ g/ml), host bacterium BL21 (pET-0589) is cultured to logarithmic phase at 37 ℃, adds IPTG to final concentration 1mmol/L, continues to cultivate 5 hours.Centrifugal collection thalline, through the broken bacterium of ultrasonic wave, centrifugal collection supernatant with carrying out chromatography with 6 Histidines (6His-Tag) bonded affinity column His.BindQuick Cartridge (Novagen company product), has obtained the target protein human calcium binding S100 protein 21 of purifying.Through the SDS-PAGE electrophoresis, obtain a single band (Fig. 2) at the 21kDa place.This band is transferred on the pvdf membrane carries out the n terminal amino acid sequential analysis with the Edams hydrolysis method, 15 amino acid of N-end hold 15 amino-acid residues identical with the N-shown in the SEQ ID NO:2 as a result.
Embodiment 6 anti-human calcium binding S100 protein 21 production of antibodies
With the synthetic specific polypeptide of following human calcium binding S100 protein 21: the NH of Peptide synthesizer (PE company product)
2-Met-Gly-Lys-Gln-Asn-Ser-Lys-Leu-Arg-Pro-Glu-Val-Met-Gln-Asp-COOH (SEQ ID NO:7).Form compoundly with hemocyanin and bovine serum albumin coupling this polypeptide respectively, method is referring to Avrameas, et al.Immunochemistry, 1969; 6:43.Add the complete Freund's adjuvant immunizing rabbit with the above-mentioned hemocyanin polypeptide complex of 4mg, add the incomplete Freund's adjuvant booster immunization once with the hemocyanin polypeptide complex again after 15 days.Employing is done the titre that ELISA measures antibody in the rabbit anteserum through the titer plate of 15 μ g/ml bovine serum albumin polypeptide complex bag quilts.From the rabbit anteserum of antibody positive, separate total IgG with albumin A-Sepharose.Polypeptide is incorporated on the Sepharose4B post of cyanogen bromide-activated, from total IgG, separates anti-peptide antibody with affinity chromatography.Immuno-precipitation proof antibody purified can combine with human calcium binding S100 protein 21 specifically.
Sequence table (1) general information:
(ⅱ) denomination of invention: human calcium binding S100 protein 21 and encoding sequence thereof
(ⅲ) sequence number: the information of 7 (2) SEQ ID NO:1:
(ⅰ) sequence signature:
(A) length: 3507bp
(B) type: nucleic acid
(C) chain: two strands
(D) topological framework: linearity
(ⅱ) molecule type: cDNA
( ⅹⅰ ) :SEQ ID NO:1: 1 ACGGCTGCGAGAAGACGAAGCTTAGGGACGGCTGCGAGAAGACGAAGCTTAGGGACGGCT 61 GCGAGAAGACGAAGCTTAGGGACGGCTGCGAGAAGACGAAGCTTAGGGACGGCTGCGAGA121 AGACGAAGCTTAGGGACGGCTGCGAGAAGACGAAGCTTAGGGACGGCTGCGAGAAGACGA181 AGCTTAGGGACGGCTGCGAGAAGACGAAGCTTAGGGGACAGACGCTGGGAGCGGCCGAGG241 CGAGTGATTTCTTCTGACTTGAGCCTGCAGTGTGCTGTGAGAGATCTACCACTAGATTAT301 CTCAACTTTGGTCTCCTGGGACCACTCGTTGCTGACAGTCAGAAACTGAATTCTTGCCGC361 CAGGATGGGGAAACAGAACAGCAAGCTGCGCCCGGAGGTCATGCAGGACTTGCTGGAAAG421 CACAGACTTTACAGAGCATGAGATCCAGGAATGGTATAAAGGCTTCTTGAGAGACTGCCC481 CAGTGGACATTTGTCAATGGAAGAGTTTAAGAAAATATATGGGAACTTTTTCCCTTATGG541 GGATGCTTCCAAATTTGCAGAGCATGTCTTCCGCACCTTCGATGCAAATGGAGATGGGAC601 AATAGACTTTAGAGAATTCATCATCGCCTTGAGTGTAACTTCGAGGGGGAAGCTGGAGCA661 GAAGCTGAAATGGGCCTTCAGCATGTACGACCTGGACGGAAATGGCTATATCAGCAAGGC721 AGAGATGCTAGAGATCGTGCAGGCAATCTATAAGATGGCTTCCTCTGTAATGAAAATGCC781 TGAAGATGAGTCAACCCCAGAGAAAAGAACAGAAAAGATCTTCCGCCAGATGGACACCAA841 TAGAGACGGAAAACTCTCCCTGGAAGAGTTCATCCGAGGAGCCAAAAGCGACCCGTCCAT901 TGTGCGCCTCCTGCAGTGCGACCCGAGCAGTGCCGGCCAGTTCTGAGCCCTGCGCCCACC 961 AATCGAATTGTAGAGCTGCTTGTGTTCCCTTTTGATTCTTCTTTTTAACAATTTTTTTTT1021 TTTGCCAAACAATATCAATGGTGATGCCGTCCCCTGTGCGGTCTGATGCGCCTTCCTCCG1081 TGACGCCTTCAGCTTCTTTTGTCGTGGATGCTTCGTGGGAATGCCCAGAGCCCCAGTGTG1141 CTTGTGGAGAGCATGGACAGACTTCGTGGTGTTCATTGTTTGATGATTTTTAATCGTTAC1201 TATTATTTTTTTTTATTCTAATGTCTCTGTTCTAAAACGTAAGACTCGGGGGTTGGGGCA1261 AAAGAAGGGAAACCCATCCAGTCCTGTGATTCTATTGCAAGCTTCAAGGGGCTTTTGTTT1321 GAAAGACAAAACTCCCCACCTGAATCTGTTGTCACACGTGCCGTAGGGGTGATGGATGGC1381 ACCGGATGCTGGATTCCCCAAGAACAAGTTACCCTCTGGGGTGAGGCTATTCCAGCGAGC1441 TGGGACATTTCCCCATGGGGGCCCACTCCCCTCTCTTCCCCAGCAGGCTGTAGTTTCTAA1501 GCTGTGAACATTTCAAGATAAATTAACAGAGGAGAGGAAAAAGATGGCTCAGCTATTTTT1561 TCACAGGTTTACACTAGTTGAGCTAATATGCGTGTCTTTGGAAATTAAACACAAATGGTA1621 ACATATTCCAAAACCAGACCCATCTTGTTGCCTATTGTGATAAAATAAAAAGACGGCTGT1681 ATATAACATATTGGGTAATGCAGACCAAATTAAGTGTTTTGCCTTGTTTAAATGAAATGC1741 ATGTTTAGTGAGCACTAATACAATCTTATTCCAGAAGACTGTTTTTAGTAGCTTATTGTG1801 AAGTAAGACAACTATAATGAATGTCTGTCTTGTTTGGAAGTCATATCTGTCTTTGCACAA1861 ATGTACCAATCGACAAGTATATTTTATATATTCCATAAAAATACAAAGTAACCCTGACTA1921 GGGCCCAACTTTAATTTTGAATGCATTTCCAGAGTGGCCATGCCTAGAGGGCAGATGCAG1981 AGCAGGTGGTAGTGGGACAGGACAATTGGAGCACAGGAATGTTAACATGTATGACAGGGG2041 ACCAGTAGGGTGGTTTCCCTCTCAGGCCCAGCAGCCCATTGACAGCATTAGACTGGCGGC2101 ATGGTGCTTTTCTGAGCAGATCAATACTCTGCAGACTCGAAAAAACATCACATACATTCT2161 TGGAACTTCCCAGTGGTTTAATCTATGTGCATGGTTAGGGAGCCAGGTCTGGAATATTCA2221 GTTTCCCTGCCCCTGTTAAAGAATCAGAGGTTGGGCAGTCATCAAATTCATCATAAAGAC2281 ATGGGCAAGTGTGTCTGTGGTTTCCAAGGCCCCCCTATGGAGAATCCAAAAGTATTTTCC2341 ATTGCCGTGCTCTTTGAATGCAGACTTCTATTTCCAGAAGTGACAGCACAAGTCTGAGTT2401 GCTGTTTGGTCTGGTGACCTCAGACACACTAATTTGAATTGAAAGCTAAGAGTAAAAATT2461 TGCTGGTTACAGGCGAGTCATACTCTTGCAAGTAGTTAGCAAAGGGAGGCCCAAATTCTC2521 AAGGTTGTTGATGGGGAACTTGCCACTAAGAGAAGGCAGAGAGGTCCCTAGTGGGTATAT2581 TTGCTGCCAAGCCACTTGCCAAAGAAGAGGAACCACAGAAAGAGAGACATCATGACCAGG2641 AGAAAAATGTGACTAGACATGCTAACCTCCAGGTTTTTATATATGACTTGAGTCTGCTGT2701 AATTGGCAGCAGAAATCCAAATTTGTATGGTAGACCAAAAAGAACCAAATCCATAGGGTG2761 AAATTTTGAGACCTAGACTCTGTAAAAATAATCCTAGTCTTCCTCCAGGGGTCAGTTCCT2821 CACAGTGGTTCTGTACCAAAACTTGCCAAATTCCTCCATGGCCAAGTGTTAAAATCTGTG2881 TTTGGAAAATAGCGAATTAACCTAAGACACAGAAGGCAGACTGGGTGAGGAGACCTAGCA2941 TGCCCTATTGGCAGTGCTCAGGAGCTGCATCCCACTTTTCCCTGCTCTGAATCGAAGTCC3001 TAGTTCCTTCCTTTGATTCTCCTTTGGTAGGTGGAATCAGTTAATGTTTTGAGAAACCTG3061 CCTGGGCTCTGCCCTTAGTCATGACATCTCGCTGAGCCAGACCCACTCTGTTCCTTGGAA3121 CCTAGAGCTGGAGTGAGGAGTAGAGGTCTCCGGCTATTCCAGAAAGAAAAGTGAGCCACA3181 TGCAGGCTGATGAATGCCGACACTTCCAGAATGTATAGAAATAGTCCCTGTCCTGGCCTG3241 CCACTGACCCTGTCTGTATTTTCTCGGAGGTTGTTTTTCTCCTTCTCCTTCCCAGGAAGG3301 TCTTTGTATGTCGAATCCAGTGCACTCAAGTTTGGCCAAGGGACTCCACAGCACCCAGAA3361 GACTGCATGCCTCAAGGTTTATGTCACTCCTCTGCTGGGCTGTTCATTGTCATTGCTGTG3421 TTCAGGGACCTTTGGAAATAAAACCTGTTCTGTCCCAAATAAAACCAGCCTGTGATGTTC3481 AAGGGACTGGAATAAAGTGGCTTACGA ( 3 ) SEQ ID NO:2:
(ⅰ) sequence signature:
(A) length: 193 amino acid
(B) type: amino acid
(D) topological framework: linearity
(ⅱ) molecule type: polypeptide
( ⅹⅰ ) :SEQ ID NO:2: 1 Met Gly Lys Gln Asn Ser Lys Leu Arg Pro Glu Val Met Gln Asp 16 Leu Leu Glu Ser Thr Asp Phe Thr Glu His Glu Ile Gln Glu Trp 31 Tyr Lys Gly Phe Leu Arg Asp Cys Pro Ser Gly His Leu Ser Met 46 Glu Glu Phe Lys Lys Ile Tyr Gly Asn Phe Phe Pro Tyr Gly Asp 61 Ala Ser Lys Phe Ala Glu His Val Phe Arg Thr Phe Asp Ala Asn 76 Gly Asp Gly Thr Ile Asp Phe Arg Glu Phe Ile Ile Ala Leu Ser 91 Val Thr Ser Arg Gly Lys Leu Glu Gln Lys Leu Lys Trp Ala Phe106 Ser Met Tyr Asp Leu Asp Gly Asn Gly Tyr Ile Ser Lys Ala Glu121 Met Leu Glu Ile Val Gln Ala Ile Tyr Lys Met Ala Ser Ser Val136 Met Lys Met Pro Glu Asp Glu Ser Thr Pro Glu Lys Arg Thr Glu151 Lys Ile Phe Arg Gln Met Asp Thr Asn Arg Asp Gly Lys Leu Ser166 Leu Glu Glu Phe Ile Arg Gly Ala Lys Ser Asp Pro Ser Ile Val181 Arg Leu Leu Gln Cys Asp Pro Ser Ser Ala Gly Gln Phe ( 4 ) SEQ ID NO:3
(ⅰ) sequence signature
(A) length: 23 bases
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linearity
(ⅱ) molecule type: oligonucleotide
(ⅹ ⅰ) sequence description: the information of SEQ ID NO:3:ACGGCTGCGAGAAGACGAAGCTT 23 (5) SEQ ID NO:4
(ⅰ) sequence signature
(A) length: 23 bases
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linearity
(ⅱ) molecule type: oligonucleotide
(ⅹ ⅰ) sequence description: the information of SEQ ID NO:4:AAGCCACTTTATTCCAGTCCCTT 23 (6) SEQ ID NO:5
(ⅰ) sequence signature
(A) length: 33 bases
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linearity
(ⅱ) molecule type: oligonucleotide
(ⅹ ⅰ) sequence description: the information of SEQ ID NO:5:CCCCATATGATGGGGAAACAGAACAGCAAGCTG 33 (7) SEQ ID NO:6
(ⅰ) sequence signature
(A) length: 33 bases
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linearity
(ⅱ) molecule type: oligonucleotide
(ⅹ ⅰ) sequence description: the information of SEQ ID NO:6:CCCGGATCCAATTCGATTGGTGGGCGCAGGGCT 33 (8) SEQ ID NO:7:
(ⅰ) sequence signature:
(A) length: 15 amino acid
(B) type: amino acid
(D) topological framework: linearity
(ⅱ) molecule type: polypeptide
(ⅹ ⅰ) sequence description: SEQ ID NO:7:Met-Gly-Lys-Gln-Asn-Ser-Lys-Leu-Arg-Pro-Glu-Val-Met-Gln-Asp 15
Claims (18)
1. an isolated polypeptide-human calcium binding S100 protein 21 is characterized in that it includes: the polypeptide of the aminoacid sequence shown in the SEQID NO:2 or the active fragments of its polypeptide, analogue or derivative.
2. polypeptide as claimed in claim 1, the aminoacid sequence that it is characterized in that described polypeptide, analogue or derivative has the homogeny with the aminoacid sequence at least 95% shown in the SEQ ID NO:2.
3. polypeptide as claimed in claim 2 is characterized in that it comprises the polypeptide with the aminoacid sequence shown in the SEQ ID NO:2.
4. isolating polynucleotide is characterized in that described polynucleotide comprise to be selected from down a kind of in the group:
(a) coding has the polynucleotide of the polypeptide of aminoacid sequence shown in the SEQ ID NO:2 or its fragment, analogue, derivative;
(b) with polynucleotide (a) complementary polynucleotide; Or
(c) with (a) or the polynucleotide of at least 99% homogeny (b) are arranged.
5. polynucleotide as claimed in claim 4 is characterized in that described polynucleotide comprise the polynucleotide that coding has aminoacid sequence shown in the SEQ ID NO:2.
6. polynucleotide as claimed in claim 4, the sequence that it is characterized in that described polynucleotide include the sequence of 1-3507 position among the sequence of 365-946 position among the SEQ ID NO:1 or the SEQ ID NO:1.
7. a recombinant vectors that contains exogenous polynucleotide is characterized in that it is the recombinant vectors that is formed by the described polynucleotide of arbitrary claim among the claim 4-6 and plasmid, virus or vehicle expression vector establishment.
8. genetically engineered host cell that contains exogenous polynucleotide is characterized in that it is to be selected from following a kind of host cell:
(a) host cell that transforms or transduce with the described recombinant vectors of claim 7; Or
(b) host cell that transforms or transduce with the described polynucleotide of the arbitrary claim among the claim 4-6.
9. preparation method with the active polypeptide of human calcium binding S100 protein 21 is characterized in that described method comprises:
(a) under expressing human calcium binding S 100 protein 21 as one kind condition, cultivate the described through engineering approaches host cell of claim 8;
(b) from culture, isolate and have the active polypeptide of human calcium binding S100 protein 21.
10. energy and polypeptide bonded antibody, it is characterized in that described antibody be can with human calcium binding S100 protein 21 specificity bonded antibody.
11. the compound of an analoglike or adjusting polypeptide active or expression is characterized in that they are simulation, promotion, antagonism or the active compound that suppresses human calcium binding S100 protein 21.
12. compound as claimed in claim 11 is characterized in that it is the polynucleotide sequence shown in the SEQ ID NO:1 or its segmental antisense sequences.
13. the described application of compound of claim 11, it is characterized in that described compound be used for mediator's calcium binding S 100 protein 21 as one kind in vivo, the method for external activity.
14. the disease that a detection is relevant with the described polypeptide of arbitrary claim among the claim 1-3 or the method for disease susceptibility, it is characterized in that it comprises the described polypeptide expression amount that detects, perhaps detect the activity of described polypeptide, perhaps detect and cause described expression of polypeptides amount or active unusual nucleotide diversity in the polynucleotide.
15. the application as polypeptide as described in the arbitrary claim among the claim 1-3 is characterized in that it is applied to screen the stand-in of human calcium binding S100 protein 21, agonist, antagonist or inhibitor; Perhaps be used for the peptide finger print identification.
16. the application as the described nucleic acid molecule of arbitrary claim among the claim 4-6 is characterized in that it is used for nucleic acid amplification reaction as primer, perhaps is used for hybridization as probe, perhaps is used to make gene chip or microarray.
17., it is characterized in that forming pharmaceutical composition with safe and effective dosage and pharmaceutically acceptable carrier as diagnosis or the treatment disease relevant unusually with human calcium binding S100 protein 21 with described polypeptide, polynucleotide or its stand-in, agonist, antagonist or inhibitor as the described polypeptide of arbitrary claim, polynucleotide or the application of compound in claim 1-6 and 11.
18. the described polypeptide of arbitrary claim, polynucleotide or application of compound in claim 1-6 and 11 is characterized in that being used for the treatment of medicine as malignant tumour, hemopathy, HIV infection and immunological disease and all kinds of inflammation with described polypeptide, polynucleotide or compound.
Priority Applications (3)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN 99124131 CN1297922A (en) | 1999-11-26 | 1999-11-26 | Human calcium binding S100 protein 21 as one kind of polypeptide and polynucleotides encoding this polypeptide |
AU15108/01A AU1510801A (en) | 1999-11-26 | 2000-11-20 | A novel polypeptide, a human s100 calcium binding protein 21 and the polynucleotide encoding the polypeptide |
PCT/CN2000/000462 WO2001038524A1 (en) | 1999-11-26 | 2000-11-20 | A novel polypeptide, a human s100 calcium binding protein 21 and the polynucleotide encoding the polypeptide |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN 99124131 CN1297922A (en) | 1999-11-26 | 1999-11-26 | Human calcium binding S100 protein 21 as one kind of polypeptide and polynucleotides encoding this polypeptide |
Publications (1)
Publication Number | Publication Date |
---|---|
CN1297922A true CN1297922A (en) | 2001-06-06 |
Family
ID=5283224
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN 99124131 Pending CN1297922A (en) | 1999-11-26 | 1999-11-26 | Human calcium binding S100 protein 21 as one kind of polypeptide and polynucleotides encoding this polypeptide |
Country Status (3)
Country | Link |
---|---|
CN (1) | CN1297922A (en) |
AU (1) | AU1510801A (en) |
WO (1) | WO2001038524A1 (en) |
Cited By (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN102257387A (en) * | 2008-10-28 | 2011-11-23 | 巴黎公众助理医院 | Methods and kits for the rapid determination of patients at high risk of death during severe sepsis and septic shock |
CN103460045A (en) * | 2011-04-05 | 2013-12-18 | 奥林巴斯株式会社 | Pancreas test method, and pancreas test kit |
CN116496394A (en) * | 2022-01-26 | 2023-07-28 | 东莞市朋志生物科技有限公司 | Antibodies against S100 protein, reagents and kits for detecting S100 protein |
Family Cites Families (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US5872007A (en) * | 1995-02-17 | 1999-02-16 | Hybridon, Inc. | CAPL-specific oligonucleotides and methods of inhibiting metastatic cancer |
EP0731166A3 (en) * | 1995-03-06 | 1997-12-29 | Tonen Corporation | Novel calcium-binding proteins |
AU5420796A (en) * | 1996-03-11 | 1997-10-01 | Human Genome Sciences, Inc. | Chemotactic cytokine ii |
US5763220A (en) * | 1996-12-12 | 1998-06-09 | Incyte Pharmaceuticals, Inc. | Human apoptosis-related calcium-binding protein |
US5871970A (en) * | 1997-03-31 | 1999-02-16 | Incyte Pharmaceuticals, Inc. | Calcium-binding protein |
-
1999
- 1999-11-26 CN CN 99124131 patent/CN1297922A/en active Pending
-
2000
- 2000-11-20 AU AU15108/01A patent/AU1510801A/en not_active Abandoned
- 2000-11-20 WO PCT/CN2000/000462 patent/WO2001038524A1/en active Application Filing
Cited By (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN102257387A (en) * | 2008-10-28 | 2011-11-23 | 巴黎公众助理医院 | Methods and kits for the rapid determination of patients at high risk of death during severe sepsis and septic shock |
CN103460045A (en) * | 2011-04-05 | 2013-12-18 | 奥林巴斯株式会社 | Pancreas test method, and pancreas test kit |
US9034586B2 (en) | 2011-04-05 | 2015-05-19 | Olympus Corporation | Method of detecting pancreatic disease and pancreas testing kit |
CN103460045B (en) * | 2011-04-05 | 2016-01-20 | 奥林巴斯株式会社 | Pancreas inspection method and pancreas check kit |
CN116496394A (en) * | 2022-01-26 | 2023-07-28 | 东莞市朋志生物科技有限公司 | Antibodies against S100 protein, reagents and kits for detecting S100 protein |
Also Published As
Publication number | Publication date |
---|---|
AU1510801A (en) | 2001-06-04 |
WO2001038524A1 (en) | 2001-05-31 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN1297922A (en) | Human calcium binding S100 protein 21 as one kind of polypeptide and polynucleotides encoding this polypeptide | |
CN1296013A (en) | Novel human membrane granulosa protein and coding sequence | |
CN1292420A (en) | New human NADH oxido-reductase composite I subunit and its code sequence | |
CN1293247A (en) | Human zinc finger protein and its coding sequence | |
CN1302815A (en) | Polypeptide-human COP9 compound subunit 30 and polynucleotide for coding it | |
CN1302886A (en) | Polypeptide-human cell wither correlated protein 12 and polynucleotide for coding it | |
CN1303933A (en) | Novel polypeptide-human muscle BOP protein 41 and polynucleotide coding said polypeptide | |
CN1302817A (en) | Polypeptide-human S4 ribosomal protein 20 and polynucleotide for coding it | |
CN1293204A (en) | Polypeptide-human bromo-functional protein 72 and polynucleotide for coding this polypeptide | |
CN1303937A (en) | Novel polypeptide-human tissue anion transport polypeptide 41 and polynucleotide coding said polypeptide | |
CN1303930A (en) | Novel polypeptide-zinc finger protein 57 and polynucleotide coding said polypeptide | |
CN1302881A (en) | Polypeptide-human beta-galactoside binding protein and polynucleotide for coding it | |
CN1470524A (en) | Polypeptide-human transcriptional elongation factor IIS51 and polynucleotide encoding this polypeptide | |
CN1292385A (en) | New polypeptide-human DNA-PK interaction protein 75 and polynucleotide coding this polypeptide | |
CN1307059A (en) | Human envelope protein and coding sequence thereof | |
CN1303931A (en) | Novel polypeptide-XRN-100 and polynucleotide coding said polypeptide | |
CN1302814A (en) | Polypeptide-human S18 ribosomal protein 18 and polynucleotide for coding it | |
CN1303863A (en) | Novel polypeptide-human transcriptional elongation factor IIS51 and polynucleotide for coding this polypeptide | |
CN1302893A (en) | Polypeptide-human RNA uncoiling enzyme 44 and polynucleotide for coding it | |
CN1293248A (en) | Human shear and adenylation specific factor protein and its coding sequence | |
CN1302870A (en) | Human NADH ubiquinone oxido-reductase 20KD subunit and its coding sequence | |
CN1295081A (en) | Human tumor related nucleoprotein 24 and its code sequence | |
CN1303945A (en) | Novel polypeptide-serine/threonine kinase 39 and polynucleotide coding said polypeptide | |
CN1303938A (en) | Novel polypeptide-human MATH37 and polynucleotide coding said polypeptide | |
CN1296014A (en) | Novel human growth arrestin and coding sequence thereof |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C06 | Publication | ||
PB01 | Publication | ||
C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
WD01 | Invention patent application deemed withdrawn after publication |