CN1367179A - Novel liver regeneration related protein, its code sequence and application - Google Patents
Novel liver regeneration related protein, its code sequence and application Download PDFInfo
- Publication number
- CN1367179A CN1367179A CN01105282A CN01105282A CN1367179A CN 1367179 A CN1367179 A CN 1367179A CN 01105282 A CN01105282 A CN 01105282A CN 01105282 A CN01105282 A CN 01105282A CN 1367179 A CN1367179 A CN 1367179A
- Authority
- CN
- China
- Prior art keywords
- lrtm4
- polypeptide
- sequence
- polynucleotide
- protein
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Peptides Or Proteins (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The present invention provides a noval liver regeneration associated protein-LRTM4 protein and polynucleotide for coding LPTM4 protein. This invention also discloses the preparation method and application of LRTM4 protein and its polynucleotide. This invention also discloses the method for curing several diseases by using the said LRTM4 protein, for example, for repairing liver injury. This invention also provides a medicine composition containing LRTM4 protein.
Description
The invention belongs to molecular biology and medical field, specifically, the present invention relates to the polynucleotide of new coding liver regeneration related protein-LRTM4, and the polypeptide of this polynucleotide encoding.The invention still further relates to the purposes and the preparation of these polynucleotide and polypeptide.Specifically, polypeptide of the present invention is a kind of new liver regeneration related protein relevant with liver regeneration.
Liver has tangible orthogenesis, and after liver partly excises, or when being subjected to physics and chemical damage, liver just begins regeneration, and regeneration stops when lasting till the ratio arrival certain value of liver and health.Liver regeneration phenomenon and multiple hepatic diseases accompany, as liver cirrhosis, acute, chronic hepatitis etc.The generating process of liver cancer also often is attended by the liver regeneration phenomenon; Simultaneously, the liver regeneration phenomenon is applied to part liver transplantation and hepatocyte transplantation clinically.
Liver cancer is a kind of worldwide malignant tumour, and mortality ratio is high, and especially China is the high region of disease of liver cancer.Have 250,000 people to die from liver cancer in the annual world wide, China has accounted for 40% (Li Shaobai, " hepatology ", People's Health Publisher, 1995) wherein.The generation of liver cancer and virus infection such as hepatitis B virus (hepatitis B virus, HBV), hepatitis C virus (hepatitis C virus, HCV) infect relevantly, edible water that contains carcinogenic substance such as aflatoxin and food etc. all are the principal elements of onset of liver cancer.Find also that at present liver cancer takes place with liver regeneration confidential relation to be arranged: the process that liver cancer takes place is often with the liver regeneration phenomenon.Know that now liver regeneration is to be subjected to the closely hepatocyte growth of regulation and control, and the hepatocellular carcinoma uncontrolled propagation that is liver cell.The theory that has now thinks, the process that liver cancer takes place comprises liver by virus or chemical substance damage, and the damage that continues causes the regeneration that continues, and regenerating just becomes liver cancer after out of hand.So understand the relation of liver cancer and liver regeneration, help people better early hepatocarcinoma to be predicted undoubtedly and treat.
At present, the most effective scheme of treatment for some hepatic diseases is liver transplantation, and the technology of liver transplantation comparative maturity, it is very limited that but can benefit from the number of this technology every year, and this is because present liver transplantation has two aspects to be restricted: donor source and immunological rejection.Want to make more people to benefit from liver transplantation, just must break through these two restrictions.The main policies that breaks through this restriction now is partial liver transplantation and hepatocyte transplantation.Partial liver transplantation can make a donor liver be transplanted to two people or more, makes also simultaneously that liver transplantation becomes possibility between relatives, thereby has reduced immunological rejection.The better scheme of another one is a hepatocyte transplantation, is about to the liver cell directly transplanting and enters patient's liver or spleen position, and liver cell regenerates gradually, bears the function of liver.Hepatocyte transplantation can utilize patient's oneself liver cell, thereby the immunological rejection phenomenon can not take place; Simultaneously the patient liver cell is carried out vitro culture and imports special genes, can carry out gene therapy.
In order to satisfy the demand of partial liver transplantation and hepatocyte transplantation etc., this area presses for to be understood and the relevant factor of hepatic tissue regeneration, especially relevant with liver regeneration gene and albumen.
The purpose of this invention is to provide a kind of new liver regeneration related protein-LRTM4 albumen with and fragment, analogue and derivative.
Another object of the present invention provides the polynucleotide of these polypeptide of coding.
Another object of the present invention provides the method for these polypeptide of production and the purposes of this polypeptide and encoding sequence.LRTM4 gene of the present invention is a new gene that does not at home and abroad appear in the newspapers, and its Molecular Study is helped illustrating the The Molecular Biology Mechanism of liver regeneration, also may be used for the gene therapy of hepatic diseases simultaneously.
In a first aspect of the present invention, novel isolated LRTM4 polypeptide is provided, this peptide source is from rat, and it comprises: polypeptide or its conservative property variation polypeptide or its active fragments or its reactive derivative with SEQ ID NO:2 aminoacid sequence.Preferably, this polypeptide is the polypeptide with SEQ ID NO:2 aminoacid sequence.
In a second aspect of the present invention, the polynucleotide of isolating these polypeptide of coding are provided, these polynucleotide comprise a nucleotide sequence, and this nucleotide sequence is shown at least 75% homogeny with a kind of nucleotides sequence that is selected from down group: (a) polynucleotide of the above-mentioned LRTM4 polypeptide of coding; (b) with polynucleotide (a) complementary polynucleotide.Preferably, this polynucleotide encoding has the polypeptide of aminoacid sequence shown in the SEQ ID NO:2.More preferably, the sequence of these polynucleotide is be selected from down group a kind of: the sequence that (a) has 335-940 position among the SEQ ID NO:1; (b) has the sequence of 1-1576 position among the SEQ ID NO:1.
In a third aspect of the present invention, the carrier that contains above-mentioned polynucleotide is provided, and has been transformed or host cell of transduceing or the host cell that is directly transformed or transduce by above-mentioned polynucleotide by this carrier.
In a fourth aspect of the present invention, provide preparation to have the method for the polypeptide of LRTM4 protein-active, this method comprises: (a) be fit to cultivate the above-mentioned host cell that is transformed or transduce under the proteic condition of expression LRTM4; (b) from culture, isolate polypeptide with LRTM4 protein-active.
In a fifth aspect of the present invention, provide and above-mentioned LRTM4 polypeptid specificity bonded antibody.The nucleic acid molecule that can be used for detecting also is provided, and it contains a successive 15-1576 Nucleotide in the above-mentioned polynucleotide.
In a sixth aspect of the present invention, the compound of simulation, promotion, antagonism LRTM4 polypeptide active is provided, and the compound that suppresses the LRTM4 polypeptide expression.The method of screening and/or prepare these compounds also is provided.Preferably, this compound is the antisense sequences of the encoding sequence (or its fragment) of LRTM4 polypeptide.
In a seventh aspect of the present invention, provide and whether had the proteic method of LRTM4 in the test sample, it comprises: sample is contacted with the proteic specific antibody of LRTM4, observe whether form antibody complex, formed antibody complex and just represented to exist in the sample LRTM4 albumen.
In a eighth aspect of the present invention, a kind of disease relevant with LRTM4 polypeptide unconventionality expression or method of disease susceptibility of detecting is provided, this method comprises: whether have sudden change in the nucleotide sequence of detection coding said polypeptide.
In a ninth aspect of the present invention, provide the purposes of polypeptide of the present invention and encoding sequence.
In a tenth aspect of the present invention, a kind of pharmaceutical composition is provided, it contains LRTM4 polypeptide of the present invention or its encoding sequence of safe and effective amount or contains the carrier of this encoding sequence, and pharmaceutically acceptable vehicle, thinner and carrier.These pharmaceutical compositions can be applicable to repair behind the hepatocellular injury that hepatitis or hepatitis gravis cause, and the treatment that is applied to liver cancer, liver partly transplant and hepatocyte transplantation in promote illness such as hepatocyte growth.
Others of the present invention are because disclosing of the technology of this paper is conspicuous to those skilled in the art.
The inventor has cloned the new gene LRTM4 of high expression level in the liver regeneration by suppressing subtractive hybridization.This cDNA total length of complete sequence determination is 1576bp (seeing SEQ ID NO.1), the LRTM4 protein of being made up of 202 amino acid (seeing SEQ ID NO.2) of having encoded.Homology analysis shows that LRTM4 is a new gene.
LRTM4 albumen is one four transmembrane protein, and is closely related with liver regeneration, can be applicable to promote liver regeneration and hepar damnification reparation.
With the dot blot method LRTM4 is expressed and to analyze, find that this gene has certain expression in the liver regeneration process in normal hepatocytes, express obviously raising in liver regeneration, and expression amount is relevant with the time that liver regeneration continues, this shows that gene LRTM4 and liver regeneration have very high dependency.
The LRTM4 gene is carried out Northern trace tissue distribution analysis revealed, and this gene is expressed in the tissue of cell proliferation is arranged, and can be used as the sign of cell proliferation.
The further experiment that carries out in the rat carbon tetrachloride hepatic injury animal model shows, the LRTM4 gene has the reparation of the hepar damnification of promotion and promptly promotes the regenerated effect, can be applicable to liver and divide the reparation that promotes the hepatocellular injury that regeneration, acute, chronic hepatitis cause in transplanting and the hepatocyte transplantation, have important use and be worth.
Following accompanying drawing is used to illustrate specific embodiments of the present invention, and is not used in qualification by the scope of the invention that claims defined.
Fig. 1 has shown the expression of LRTM4 gene in liver regeneration that the RNA dot blot detects.Among the figure: 1,2,3 sampling amounts of representing total RNA respectively be 5,15,45 μ g points on nylon membrane, 0h, 24h, 48h, 72h are the time after rats'liver is partly excised; LRTM4 represents to be result behind the probe hybridization with gene fragment, and 18S represents to be of 18S ribosomal RNA gene fragment the result of probe hybridization, as reference.
Fig. 2 has shown that with LRTM4 cDNA be probe, with the Northern results of hybridization of rat different tissues mRNA.Among the figure: 9 tissues comprise Liver Regeneration, normal hepatocytes, testis, spleen, prostate gland, skeletal muscle, lung, heart, brain.Last figure is with the result of LRTM4 gene fragment mark as probe hybridization, 18S and 28S indication electrophoretic band position, and the size of hybridization band is 1.6Kb; Figure below is for using the result of 18S ribosome-RNA(rRNA) fragment label as probe hybridization, as reference.
Fig. 3 has shown in the carbon tetrachloride hepatic injury rat model, the dependency of the expression of liver L RTM4 and blood plasma gpt (GPT).Among the figure: different treatment group 1 is a normal rat, and 2,3 for irritating hello 0.5 milliliter of tetracol phenixin/kg body weight, and 4,5 irritate hello 1 milliliter of tetracol phenixin/kg body weight, wherein 3,5 all import the LRTM4 gene.The GPT level is the gpt units per ml, and the LRTM4 gene expression amount is through the relative ratio after the house-keeping gene GAPDH stdn.The measuring method of gene intensity is the amplified production while electrophoresis of LRTM4 and GAPDH, and scanning is quantitatively calculated the expression level of the ratio of LRTM4 and GAPDH amount as LRTM4.The expression level of the LRTM4 that curve representation records in different processing among the figure, gpt GPT level in the histogram graph representation blood.As can be seen, GPT level and LRTM4 expression level are negative correlation among the figure.
Fig. 4 is CDNA sequence and the aminoacid sequence of LRTM4.
In the present invention, term " LRTM4 albumen ", " LRTM4 polypeptide " or " liver regeneration related protein LRTM4 " Be used interchangeably all refer to the to have liver regeneration related protein LRTM4 amino acid sequence albumen of (SEQ ID NO:2) Or polypeptide. They comprise the liver regeneration related protein LRTM4 that contains or do not contain initial methionine.
As used herein, " separation " refers to that material separates (if natural from its primal environment Material, primal environment namely are natural surroundingses). Such as the polynucleotide under the native state in the active somatic cell and many Peptide does not have separation and purification, but same polynucleotide or polypeptide are such as same other that exist from native state In the material separately, then for separation and purification.
As used herein, it is natural that " LRTM4 albumen or the polypeptide of separation " refers to that the LRTM4 polypeptide is substantially free of Relative other albumen, lipid, carbohydrate or other material. Those skilled in the art can use the egg of standard White matter purification technique purifying LRTM4 albumen.
Polypeptide of the present invention can be recombinant polypeptide, natural polypeptides, synthetic polypeptide, preferred recombinant polypeptide. This The polypeptide of invention can be the product of natural purifying, or the product of chemical synthesis, or use recombinant technique from Produce in protokaryon or the eucaryon host (for example, bacterium, yeast, higher plant, insect and mammalian cell). The host used according to the recombinant production scheme, polypeptide of the present invention can be glycosylated, or can right and wrong sugar Baseization.
The present invention also comprises fragment, derivative and the analog of LRTM4 albumen. As used herein, term " sheet Section ", " derivative " refer to basically keep natural LRTM4 albumen of the present invention identical with " analog " Biological function or active polypeptide. Polypeptide fragment of the present invention, derivative or analog can be that (i) has one Individual or a plurality of conservative or substituted polypeptide of non-conservation amino acid residue (preferred conservative amino acid residue), and The amino acid residue of such replacement can be also can be by the genetic code coding, or (ii) one or The polypeptide that has substituted radical in a plurality of amino acid residues, or (iii) mature polypeptide and another compound (such as Prolong the compound of polypeptide half-life, for example polyethylene glycol) merge formed polypeptide, or (iv) additional ammonia The base acid sequence be fused to this peptide sequence and the polypeptide that forms (as targeting sequencing or secretion sequence or be used for purifying this The sequence of polypeptide or proteinogen sequence, or with the fusion of the formation of antigen I gG fragment). According to this paper's Instruction, these fragments, derivative and analog belong to the known scope of those skilled in the art.
The special LRTM4 analog of one class is other mammals (such as ox, sheep, rabbit, dog, monkey, people etc.) The homologous protein of middle LRTM4. The coded sequence of the homologous protein of these other species can disclose according to the present invention Sequence, the method by hybridization or amplification obtains, and then obtains these homology eggs by conventional recombination method In vain.
In the present invention, term " LRTM4 polypeptide " refers to have the SEQ ID NO.2 of LRTM4 protein active The polypeptide of sequence. This term also comprise have with LRTM4 albumen identical function, SEQ ID NO.2 sequence Variant form. These variant forms comprise (but being not limited to): several (are generally 1-50, preferably 1-30, more preferably 1-20,1-10 best) amino acid whose disappearance, insertion and/or replacement, with And C end and/or N terminal add one or several (being generally in 20, preferably is in 10, More preferably be in 5) amino acid. For example, in the art, the amino acid close or similar with performance advances When row replaces, usually can not change the function of protein. Again such as, add one in that C end and/or N are terminal Individual or several amino acid also can not change the function of protein usually. This term also comprises the activity of LRTM4 albumen Fragment and reactive derivative.
The variant form of this polypeptide comprises: homologous sequence, conservative variant, allelic variant, natural sudden change Body, induced mutation body, can be coded with the DNA of LRTM4 DNA hybridization under high or low stringency condition Albumen and polypeptide or the albumen that utilizes the antiserum of anti-LRTM4 polypeptide to obtain. The present invention also provides it His polypeptide, as comprise fusion (the fusion egg shown in SEQ ID NO:3 of LRTM4 polypeptide or its fragment In vain). Except the polypeptide of total length almost, the present invention has also comprised the soluble fragments of LRTM4 polypeptide. Usually, This fragment have the LRTM4 peptide sequence at least about 10 continuous amino acids, usually at least about 30 Continuance ammines Base acid is preferably at least about 50 continuous amino acids, more preferably at least about 80 continuous amino acids, best At least about 100 continuous amino acids.
Invention also provides the analog of LRTM4 albumen or polypeptide. These analogs and natural LRTM4 polypeptide poor Can not be the difference on the amino acid sequence, also can be the difference that does not affect on the modified forms of sequence, perhaps Have both at the same time. These polypeptide comprise genetic variant natural or that induce. The induce variation body can be by various skills Art obtains, as by radiation or be exposed to mutagens and produce random mutagenesis, and also can be by direct mutagenesis method or its The biological technology of his known molecular. Analog also comprises having and is different from the amino acid whose residue of natural L-(such as D-Amino acid) analog, and have that non-natural exists or synthetic amino acid (such as β, gamma-amino acid) Analog. Should be understood that polypeptide of the present invention is not limited to the above-mentioned representational polypeptide that exemplifies.
(usually the not changing primary structure) form of modifying comprises: in the body or the chemically derived form of external polypeptide as Acetylation or carboxylated. Modify and also to comprise glycosylation, such as those in the synthetic and processing of polypeptide or further add Carry out glycosylation modified and polypeptide that produce during work step is rapid. This modification can be carried out sugar by polypeptide is exposed to The enzyme of baseization (such as mammiferous glycosylase or deglycosylating enzyme) and finishing. Modified forms also comprises having phosphorus The sequence of acidifying amino acid residue (such as phosphotyrosine, phosphoserine, phosphothreonine). Also comprise and being repaiied Thereby decorations have improved its anti-proteolysis performance or have optimized the polypeptide of solubility property.
In the present invention, " LRTM4 albumen conservative variation polypeptide " refers to the amino acid order with SEQ ID NO:2 Row are compared, and have 10 at the most, and preferably at the most 8, more preferably at the most 5,3 amino acid at the most best Replaced by similar performance or close amino acid and form polypeptide. These conservative variation polypeptide are preferably according to table 1 carries out amino acid substitution and produces.
Table 1
| Initial residue | Representational replacement | The preferred replacement |
| Ala(A) | Val；Leu；Ile | Val |
| Arg(R) | Lys；Gln；Asn | Lys |
| Asn(N) | Gln；His；Lys；Arg | Gln |
| Asp(D) | Glu | Glu |
| Cys(C) | Ser | Ser |
| Gln(Q) | Asn | Asn |
| Glu(E) | Asp | Asp |
| Gly(G) | Pro；Ala | Ala |
| His(H) | Asn；Gln；Lys；Arg | Arg |
| Ile(I) | Leu；Val；Met；Ala；Phe | Leu |
| Leu(L) | Ile；Val；Met；Ala；Phe | Ile |
| Lys(K) | Arg；Gln；Asn | Arg |
| Met(M) | Leu；Phe；Ile | Leu |
| Phe(F) | Leu；Val；Ile；Ala；Tyr | Leu |
| Pro(P) | Ala | Ala |
| Ser(S) | Thr | Thr |
| Thr(T) | Ser | Ser |
| Trp(W) | Tyr；Phe | Tyr |
| Tyr(Y) | Trp；Phe；Thr；Ser | Phe |
| Val(V) | Ile；Leu；Met；Phe；Ala | Leu |
Polynucleotides of the present invention can be dna form or rna form. Dna form comprises cDNA, genome DNA or artificial synthetic DNA. DNA can be strand or double-stranded. DNA can be coding strand or non-volume The code chain. The coding region sequence of encoding mature polypeptide can be identical with the coding region sequence shown in the SEQ ID NO:1 or The person is the variant of degeneracy. As used herein, " variant of degeneracy " refers to that in the present invention coding has SEQ The protein of ID NO:2, but with the differentiated nucleotide sequence of coding region sequence shown in the SEQ ID NO:1.
The polynucleotides of the mature polypeptide of coding SEQ ID NO:2 comprise: the coded sequence of an encoding mature polypeptide; The coded sequence of mature polypeptide+various additional code sequences; The coded sequence of mature polypeptide is (with optional additional volume The code sequence)+non-coding sequence.
Term " polynucleotides of coded polypeptide " can be the polynucleotides that comprise this polypeptide of encoding, and also can be The polynucleotides that also comprise additional code and/or non-coding sequence.
The invention still further relates to the variant of above-mentioned polynucleotides, its coding has identical amino acid sequence with the present invention Polypeptide or fragment, analog and the derivative of polypeptide. The variant of these polynucleotides can be natural generation The variant that allelic variant or non-natural take place. These nucleotide diversity bodies comprise that replacement variant, disappearance become Allosome and insertion variant. As known in the art, allelic variant is the replacement form of polynucleotides, It may be replacement, disappearance or the insertion of one or more nucleotides, but can be from not changing in fact its coding The function of polypeptide.
The invention still further relates to and above-mentioned sequence hybridization and two sequences between have at least 60%, preferably at least 75%, the polynucleotides of at least 80% homogeny more preferably. The present invention be more particularly directed under stringent condition and this The interfertile polynucleotides of bright described polynucleotides. In the present invention, " stringent condition " refers to: (1) is Hybridization under LIS and the higher temperature and wash-out, such as 0.2 * SSC, 0.1%SDS, 60 ℃; Or (2) Be added with denaturant during hybridization, such as 50% (v/v) formamide, 0.1% calf serum/0.1%Ficoll, 42 ℃ etc.; Or (3) only at the homogeny between the two sequences at least more than 90%, be more preferably 95% and just mix when above Hand over. And the polypeptide of interfertile polynucleotide encoding has identical with the mature polypeptide shown in the SEQ ID NO:2 Biological function and activity.
The invention still further relates to the nucleic acid fragment with above-mentioned sequence hybridization. As used herein, " nucleic acid fragment " Length contains 15 nucleotides at least, better is at least 30 nucleotides, is more preferably at least 50 nucleotides, Preferably more than at least 100 nucleotides. Nucleic acid fragment can be used for the amplification technique (such as PCR) of nucleic acid to determine And/or the polynucleotide of separation coding LRTM4 albumen.
LRTM4 nucleotides full length sequence of the present invention or its fragment can be used pcr amplification method, recombination method or people usually The method that the worker synthesizes obtains. For the pcr amplification method, can be disclosed according to the present invention about nucleotide sequence, Especially open reading frame sequence designs primer, and with commercially available cDNA storehouse or by those skilled in the art known The prepared cDNA storehouse of conventional method as template, amplification and must relevant sequence. When sequence is longer, usually Need to carry out twice or pcr amplification repeatedly, and then the fragment that each time amplified by the proper order splicing one Rise.
In case obtained relevant sequence, just can obtain in large quantity relevant sequence with recombination method. This is common Be that it is cloned into carrier, change again cell over to, separate from the host cell after the propagation by conventional method then Obtain relevant sequence.
In addition, also the method for available synthetic is synthesized relevant sequence, especially fragment length more in short-term.Usually, by first synthetic a plurality of small segments, and then connect and to obtain the very long fragment of sequence.
At present, can be fully obtain the dna sequence dna of code book invention albumen (or its fragment, or derivatives thereof) by chemosynthesis.This dna sequence dna can be introduced in various existing dna moleculars as known in the art (or as carrier) and the cell then.In addition, also can will suddenly change and introduce in the protein sequence of the present invention by chemosynthesis.
Use method (Saiki, the et al.Science1985 of round pcr DNA amplification/RNA; 230:1350-1354) be optimized for acquisition gene of the present invention.The primer that is used for PCR can suitably be selected according to sequence information of the present invention disclosed herein, and available ordinary method is synthetic.Available ordinary method is as the DNA/RNA fragment by gel electrophoresis separation and purifying amplification.
The present invention also relates to comprise the carrier of polynucleotide of the present invention, and the host cell that produces through genetically engineered with carrier of the present invention or LRTM4 albumen coded sequence, and the method that produces polypeptide of the present invention through recombinant technology.
Recombinant DNA technology (Science, 1984 by routine; 224:1431), can utilize polymerized nucleoside acid sequence of the present invention to can be used to express or produce the LRTM4 polypeptide of reorganization.In general following steps are arranged:
(1). with the polynucleotide (or varient) of coding of the present invention LRTM4 polypeptide, or with the recombinant expression vector that contains these polynucleotide proper host cell that transforms or transduce;
(2). the host cell of in suitable medium, cultivating;
(3). separation, protein purification from substratum or cell.
Among the present invention, the LRTM4 polynucleotide sequence can be inserted in the recombinant expression vector.Term " recombinant expression vector " refers to that bacterial plasmid well known in the art, phage, yeast plasmid, vegetable cell virus, mammalian cell virus are as adenovirus, retrovirus or other carriers.The carrier of Shi Yonging includes but not limited in the present invention: the expression vector based on T7 of expressing in bacterium; The pMSXND expression vector of in mammalian cell, expressing and at the carrier that derives from baculovirus of expressed in insect cells.In a word, as long as can duplicate in host and stablize, any plasmid and carrier can be used.A key character of expression vector is to contain replication orgin, promotor, marker gene and translation controlling elements usually.
Method well-known to those having ordinary skill in the art can be used to make up and contains LRTM4 DNA sequences encoding and suitable transcribing/the translate expression vector of control signal.These methods comprise (Sambroook, et al.Molecular Cloning, a Laboratory Manual, cold Spring Harbor Laboratory.New York, 1989) such as extracorporeal recombinant DNA technology, DNA synthetic technology, the interior recombinant technologys of body.Described dna sequence dna can effectively be connected on the suitable promotor in the expression vector, and is synthetic to instruct mRNA.The representative example of these promotors has: colibacillary lac or trp promotor; Lambda particles phage P
LPromotor; Eukaryotic promoter comprises CMV immediate early promoter, HSV thymidine kinase promoter, early stage and late period SV40 promotor and some other known may command gene expression promoter in protokaryon or eukaryotic cell or its virus.Expression vector also comprises ribosome bind site and the transcription terminator that translation initiation is used.
In addition, expression vector preferably comprises one or more selected markers, to be provided for selecting the phenotypic character of transformed host cells, cultivate Tetrahydrofolate dehydrogenase, neomycin resistance and the green fluorescent protein (GFP) of usefulness as eukaryotic cell, or be used for colibacillary tsiklomitsin or amicillin resistance.
Comprise the carrier of above-mentioned suitable dna sequence dna and suitable promotor or control sequence, can be used to transform appropriate host cell, so that it can marking protein.
Host cell can be a prokaryotic cell prokaryocyte, as bacterial cell; Or eukaryotic cell such as low, as yeast cell; Or higher eucaryotic cells, as mammalian cell.Representative example has: intestinal bacteria, streptomyces; The bacterial cell of Salmonella typhimurium; Fungal cell such as yeast; Vegetable cell; The insect cell of fruit bat S2 or Sf9; Zooblasts such as CHO, COS, 293 cells.
When polynucleotide of the present invention are expressed in higher eucaryotic cells, be enhanced if will make to transcribe when in carrier, inserting enhancer sequence.Enhanser is the cis acting factor of DNA, and nearly 10 to 300 base pairs act on promotor transcribing with enhancing gene usually.Can for example be included in the SV40 enhanser of 100 to 270 base pairs of replication origin side in late period one, at the polyoma enhanser of replication origin side in late period one and adenovirus enhanser etc.
Persons skilled in the art all know how to select appropriate carriers, promotor, enhanser and host cell.
Can carry out with routine techniques well known to those skilled in the art with the recombinant DNA transformed host cell.When the host was prokaryotic organism such as intestinal bacteria, the competent cell that can absorb DNA can be used CaCl in exponential growth after date results
2Method is handled, and used step is well-known in this area.Another kind method is to use MgCl
2If desired, transforming also the method for available electroporation carries out.When the host is an eukaryote, can select following DNA transfection method for use: coprecipitation of calcium phosphate method, conventional mechanical method such as microinjection, electroporation, liposome packing etc.
The transformant that obtains can be cultivated with ordinary method, expresses the polypeptide of coded by said gene of the present invention.According to used host cell, used substratum can be selected from various conventional substratum in the cultivation.Under the condition that is suitable for the host cell growth, cultivate.After host cell grows into suitable cell density, induce the promotor of selection with suitable method (as temperature transition or chemical induction), cell is cultivated for some time again.
The extracellular can be expressed or be secreted into to recombinant polypeptide in the above methods in cell or on cytolemma.If desired, can utilize its physics, the separating by various separation methods with other characteristic and the albumen of purification of Recombinant of chemistry.These methods are well-known to those skilled in the art.The example of these methods includes, but are not limited to: conventional renaturation handles, with protein precipitant handle (salt analysis method), centrifugal, the broken bacterium of infiltration, superly handle, the combination of super centrifugal, sieve chromatography (gel-filtration), adsorption chromatography, ion exchange chromatography, high performance liquid chromatography (HPLC) and other various liquid chromatography (LC) technology and these methods.
The LRTM4 albumen or the polypeptide of reorganization are of use in many ways.These purposes include, but is not limited to: the direct disease (especially promoting the reparation of hepar damnification) due to the low or forfeiture and be used to screen and promote or antibody, polypeptide or other part of antagonism LRTM4 protein function as pharmacological agent LRTM4 protein function.The peptide molecule that can suppress or stimulate the LRTM4 protein function that can be used for seeking therapeutic value with the reorganization LRTM4 protein screening peptide library of expressing.
On the other hand, the present invention also comprises LRTM4 DNA or the polypeptide of its fragment coding has specific polyclonal antibody and monoclonal antibody, especially monoclonal antibody.Here, " specificity " is meant that antibody capable is incorporated into LRTM4 gene product or fragment.Preferably, refer to that those can combine with LRTM4 gene product or fragment but nonrecognition and be incorporated into the antibody of other irrelevant antigen molecule.Among the present invention antibody comprise those can in conjunction with and suppress the proteic molecule of LRTM4, comprise that also those do not influence the antibody of LRTM4 protein function.The present invention also comprise those can with modify or without the LRTM4 gene product bonded antibody of modified forms.
The present invention not only comprises complete mono-clonal or polyclonal antibody, but also comprises having immunocompetent antibody fragment, as Fab ' or (Fab)
2Fragment; Heavy chain of antibody; Light chain of antibody; Or chimeric antibody.
Antibody of the present invention can be prepared by the known various technology of those skilled in that art.For example, the LRTM4 gene product of purifying or its have antigenic fragment, can be applied to animal (as rabbit, mouse etc.) to induce the generation of polyclonal antibody.Similarly, expressing LRTM4 albumen or its has antigenic segmental cell and can be used to immune animal and produce antibody.Can use the reaction of multiple adjuvant enhancing immunity, comprising (but being not limited to) freund's adjuvant etc.
Monoclonal antibody of the present invention can utilize hybridoma technology to prepare.Each antibody-like of the present invention can utilize the fragment or the functional zone of LRTM4 gene product, obtains by the routine immunization technology.These fragments or functional zone can utilize recombinant methods or utilize Peptide synthesizer synthetic.Can come immune animal and produce with the gene product of producing in the prokaryotic cell prokaryocyte (for example E.Coli) with the unmodified form bonded antibody of LRTM4 gene product; With posttranslational modification form bonded antibody (as the albumen or the polypeptide of glycosylation or phosphorylation), can come immune animal and obtain with the gene product that produces in the eukaryotic cell (for example yeast or insect cell).
The proteic antibody of anti-LRTM4 can be used in the immunohistochemistry technology, detects the LRTM4 albumen in the biopsy specimen.In addition, with the also available labelled with radioisotope of the protein bound monoclonal antibody of LRTM4, inject in the body and can follow the tracks of its position and distribution.This radiolabeled antibody can be used as a kind of atraumatic diagnostic method and is used for the location of tumour cell and has judged whether transfer.
Utilize albumen of the present invention,, can filter out with LRTM4 albumen interactional material takes place, as acceptor, inhibitor, agonist or antagonist etc. by various conventional screening methods.
Albumen of the present invention and antibody thereof, inhibitor, agonist, antagonist or acceptor etc. when using (administration) in treatment, can provide different effects.Usually, can these materials are formulated in nontoxic, inert and the pharmaceutically acceptable aqueous carrier medium, wherein pH is about 5-8 usually, and preferably pH is about 6-8, although the pH value can be with being changed to some extent by preparation Substance Properties and illness to be treated.The pharmaceutical composition for preparing can carry out administration by conventional route, comprising (but being not limited to): intramuscular, intraperitoneal, intravenously, subcutaneous, intracutaneous or topical.
Polypeptide of the present invention can be directly used in disease treatment, for example, is used for the treatment of hepar damnification reparation aspect.When using LRTM4 albumen of the present invention, also can use the other treatment agent simultaneously.
The present invention also provides a kind of pharmaceutical composition, and it contains LRTM4 polypeptide of the present invention or its agonist, antagonist and the pharmaceutically acceptable carrier or the vehicle of safe and effective amount.This class carrier comprises (but being not limited to): salt solution, damping fluid, glucose, water, glycerine, ethanol and combination thereof.Pharmaceutical preparation should be complementary with administering mode.Pharmaceutical composition of the present invention can be made into the injection form, for example is prepared by ordinary method with the physiological saline or the aqueous solution that contains glucose and other assistant agents.Pharmaceutical composition such as tablet and capsule can be prepared by ordinary method.Pharmaceutical composition such as injection, solution, tablet and capsule should be made under aseptic condition.The dosage of activeconstituents is the treatment significant quantity, for example every day about 1 microgram/kg body weight-Yue 5 mg/kg body weight.In addition, polypeptide of the present invention also can use with the other treatment agent.
When making pharmaceutical composition, be that the LRTM4 albumen of safe and effective amount or its antagonist, agonist are applied to Mammals, wherein this safe and effective amount is usually at least about 10 micrograms/kg body weight, and in most of the cases be no more than about 8 mg/kg body weight, preferably this dosage is about 10 micrograms/kg body weight-Yue 1 mg/kg body weight.Certainly, concrete dosage also should be considered factors such as route of administration, patient health situation, and these all are within the skilled practitioners skill.
The proteic polynucleotide of LRTM4 also can be used for multiple therapeutic purpose.Gene therapy technology can be used for treating because the proteic no expression of LRTM4, non-activity or active cell proliferation, growth or metabolic disturbance due to low, also can be used for increasing expression and the activity (for example being used to promote liver regeneration) of LRTM4.The gene therapy vector (as virus vector) of reorganization can be designed to express LRTM4 albumen, to increase endogenic LRTM4 protein-active.Deriving from viral expression vector such as retrovirus, adenovirus, adeno-associated virus (AAV), hsv, parvovirus etc. can be used for the LRTM4 transgenosis to cell.The method that structure carries the recombinant viral vector of foreign gene is found in existing document (Sambrook, et al.).The LRTM4 gene of recombinating in addition can be packaged in the liposome, and then is transferred in the cell.
Suppress the oligonucleotide (comprising sense-rna and DNA) of LRTM4 mRNA and ribozyme also within the scope of the invention.The RNA of antisense and DNA and ribozyme can obtain with existing any RNA or DNA synthetic technology, as the technology widespread use of solid phase phosphoamide chemical synthesis synthetic oligonucleotide.Antisense rna molecule can be transcribed acquisition by the dna sequence dna of this RNA that encodes in external or body.This dna sequence dna has been incorporated into the downstream of rna polymerase promoter of carrier.In order to increase the stability of nucleic acid molecule, available several different methods is modified it, and as increasing the sequence length of both sides, the connection between the ribonucleoside is used phosphoric acid thioester bond or peptide bond but not phosphodiester bond.
Polynucleotide imports tissue or intracellular method comprises: directly be injected into polynucleotide in the in-vivo tissue; Or external by carrier (as virus, phage or plasmid etc.) earlier with the polynucleotide transfered cell in, again cell is transplanted in the body etc.
Can be incorporated into the rondom polypeptide storehouse that solid formation forms by the various amino acid that may make up by screening with the protein bound peptide molecule of LRTM4 obtains.
The invention still further relates to the diagnostic testing process of quantitative and detection and localization LRTM4 protein level.These tests are known in the art, and comprise that FISH measures and radioimmunoassay.The LRTM4 protein level that is detected in the test can be with laying down a definition the importance of LRTM4 albumen in various diseases and be used to the disease of diagnosing LRTM4 albumen to work.
Whether having the proteic method of LRTM4 in a kind of detection test sample is to utilize the proteic specific antibody of LRTM4 to detect, and it comprises: sample is contacted with the LRTM4 protein specific antibody; Observe whether form antibody complex, formed antibody complex and just represented to exist in the sample LRTM4 albumen.
The proteic polynucleotide of LRTM4 can be used for the diagnosis and the treatment of LRTM4 protein related diseases.Aspect diagnosis, the proteic polynucleotide of LRTM4 can be used for detecting the proteic expression of LRTM4 LRTM4 abnormal exprssion whether or under morbid state.Can be used for the hybridization of biopsy specimen to judge the proteic abnormal expression of LRTM4 as the LRTM4 dna sequence dna.Hybridization technique comprises the Southern blotting, Northern blotting, in situ hybridization etc.These technological methods all are disclosed mature technologies, and relevant test kit all can obtain from commercial channels.Part or all of polynucleotide of the present invention can be used as probe stationary on microarray (microarray) or DNA chip (being called " gene chip " again), is used for analyzing the differential expression analysis and the gene diagnosis of tissue gene.Carry out RNA-polymerase chain reaction (RT-PCR) amplification in vitro with the special primer of LRTM4 albumen and also can detect the proteic transcription product of LRTM4.
The sudden change that detects the LRTM4 gene also can be used for the disease of diagnosing LRTM4 albumen relevant.The form of LRTM4 protein mutation comprises that the point mutation compared with normal wild type LRTM4 dna sequence dna, transposition, disappearance, reorganization and other are any unusual etc.Available existing technology such as Southern blotting, dna sequence analysis, PCR and in situ hybridization detect sudden change.In addition, sudden change might influence proteic expression, therefore can judge indirectly that with Northern blotting, Western blotting gene has or not sudden change.
The invention has the advantages that:
1, provides a brand-new genes related with liver regeneration LRTM4.It expresses rising in regenerating hepatic tissue, and regulating cell growth, be one with the liver regeneration height correlation, have the functional gene of promotion hepatocyte proliferation activity.
2, the present invention finds that the LRTM4 gene can promote the reparation of hepar damnification in vivo in the animal model experiment, the effect that stimulates liver cell growth is arranged, show that LRTM4 can be used as a series of clinical applications such as acute and chronic injury of pharmacological agent liver, comprise the application such as gene therapy that promote liver regeneration, liver cancer after the liver transplantation.
3, LRTM4 does not express in most healthy tissuess, but in testis and regenerating hepatic tissue high expression level, show that LRTM4 has very strong tissue expression specificity.Testis is cell proliferation and the very vigorous tissue of differentiation in the adult tissue, shows that LRTM4 is also relevant with cell proliferation, and the signage applications that can be used as cell proliferation is in the diagnosis of some and cell proliferation diseases associated such as tumour.
Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to people such as normal condition such as Sambrook, molecular cloning: laboratory manual (New York:ColdSpring Harbor Laboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.
Use Trizol reagent and MessageMaker reagent assembly test kit (being Gibco BRL company product), middle to specifications method of recommending is carried out total tissue RNA and Poly (A)
+The RNA extracting, and use Clontech company test kit to suppress the poor hybridization that subtracts.Concrete grammar is as follows: get 2 μ g mRNA (from normal hepatocytes or Liver Regeneration), add the oligonucleotide that 1 μ l concentration is 10 μ mol/L [5 '-TTTGTACGCGGCCGC (T) 15-3 '] and be primer, use the synthetic first chain cDNA of SuperScript II ThermoScript II (Gibco BRL), use synthetic second chain of the second chain synthetic enzyme in the test kit.The double-stranded cDNA fragment of synthetic is cut with the RsaI enzyme, and the cDNA fragment of taking out Liver Regeneration then is person under inspection (tester), adds two set of joints 1 and joint 2R (joint sequence is seen the test kit explanation) respectively.As driver (driver), dna sequence dna identical with normal hepatocytes in the Liver Regeneration is deducted because of the two strands that hybridization forms, and is cloned behind the PCR selective amplification because of the remaining fragment of difference in the Liver Regeneration with the cDNA (not adding joint) in normal liver tissue source.All solution hybridizations and PCR all carry out on a PTC-100 PCR instrument (MJ Research Inc.).
Obtain selecting the cloned sequence a new EST, clone's full-length cDNA from poor subtracting.Carry out the computer splicing according to the database est sequence, design polymerase chain reaction (PCR) primer P1 (5 '-GCAACTCGAACATCTTGTC TGT-3 ' (SEQ ID NO:4)), P2:(5 '-GGCAAATTATGACAGGCTCATA-3 ' (SEQ ID NO:5)).Adopt TRIZOL test kit (GIBCOL/BRL company), middle to specifications method of recommending is separated the total RNA of rat regenerating hepatic tissue.In 20 μ L reverse transcription reaction systems, add the total RNA of 1 μ g regenerating hepatic tissue, 1 μ L thermostable reverse transcriptases (Gibco company product), dNTP is a primer with oligomerization (dT) 20.50 ℃ 1 hour, 85 ℃ 5 minutes, add 1 μ L RNase H again, place 20 minutes excision RNA for 37 ℃.The cDNA that obtains with reverse transcription reaction is a template, and pcr amplification obtains the LRTM4 gene cDNA, and the PCR reaction conditions is 94 ℃ of pre-sex change in 2 minutes, circulating reaction be 94 ℃ 30 seconds, 55 ℃ 30 seconds, 68 ℃ 90 seconds, carry out 35 circulations altogether.PCR product (about 1600bp) reclaims purifying with the low melting point gel, is cloned in the T-carrier (Promega company product), and method is with reference to " molecular cloning.Experiment guide " (Sambrook, J., Fritsh, E.F., and Maniais, T., Molecular Cloning, Cold Spring HarborLaboratory Press, 1989).Complete sequence is measured by TaKaRa company (China, Dalian).The cDNA total length of measuring is 1576bp (SEQ ID NO:1), comprised a complete protein-coding region (335-940 position among the SEQ ID NO:1, do not comprise terminator codon), the protein of forming by 202 amino acid (SEQID NO.2) of having encoded.This albumen is named as LRTM4 albumen, and gene is named as the LRTM4 gene.
The structural analysis that LRTM4 albumen is carried out shows, it is one four transmembrane protein, have four distinctive hydrophobic transmembranes, from 30 to 47 amino acids residues are first extracellular region, from 109 to 155 amino acids residues are second extracellular region, wherein second extracellular region is longer, is 47 amino-acid residues.Prediction shows that LRTM4 albumen has two glycosylation sites, is respectively 124 and 156 N residue.
Homology is relatively found, LRTM4 and a known people TM4SF4 gene (Wice.B.M.etc, JBC, 270 (35): 21907-21918,1995) have 87%, but on function, the proteic function of people TM4SF4 is to suppress cell proliferation, and the function of LRTM4 gene is different with it among the present invention, has the function that promotes that cell proliferation and cell injury are repaired.LRTM4 albumen and several people's tumour marker protein have homology in addition: with the L6 tumour antigen 48% homology (Marken J.S.etc, PNAS, 89:3503-3507 are arranged, 1992), with the TM4SF5 tumour antigen by 38% homology (Muller P.F.etc, 208 (1): 25-30,1998).
Get rat normal hepatocytes and the Liver Regeneration of partly excising back different time points (24,48,72 hours), put into liquid nitrogen behind the excision immediately and preserve.Adopt TRIZOL test kit (GIBCOL/BRL company), the method for Tui Jianing prepares the total RNA of tissue sample to specifications.
The normal hepatocytes (0) of preparation or total RNA of 24,48,72 hours Liver Regeneration will be separated, amount according to the 7.5 DNase I/200 μ g RNA of unit adds DNase I (Pharmacia Biotech) digestion, remove the trace genome DNA that may pollute, each sample is respectively by 5,15,45 μ g RNA amount, point prints on the nylon membrane, bakes 2 hours for 80 ℃ then.Nylon membrane is put into hybrid pipe, add 5mL quick hybridization liquid (Clontech company product), 68 ℃ of prehybridizations 30 minutes change the fresh hybridization solution of 5mL, add sex change
32The segmental probe of the random labeled LRTM4 of P (Random Primer dna marker test kit, TaKaRa company) was hybridized 1 hour for 68 ℃.Hybond membrane washes twice in room temperature, each 20 minutes with lavation buffer solution I (0.3M NaCl, 0.03M sodium-acetate (PH7.0), 0.05% sodium laurylsulfonate); Use lavation buffer solution II (15mM NaCl, 1.5mM sodium-acetate (pH7.0), 0.1% sodium laurylsulfonate) to wash twice, each 20 minutes then in 50 ℃.Then, compressing tablet ,-70 ℃ of radioautograph.
The result as shown in Figure 1, the LRTM4 gene is expressed obviously in 24 and 72 hours Liver Regeneration and is raise.This shows that LRTM4 expresses rising in the regenerative process of liver.
Embodiment 4, the LRTM4 expression analysis in rat tissue
Get rat 24 hours Liver Regeneration, normal hepatocytes, testis, spleen, skeletal muscle, lung, heart and brains of preserving in the liquid nitrogen, adopt TRIZOL test kit (GIBCOL/BRL company), the method for Tui Jianing prepares the total RNA of tissue sample to specifications.Get each total tissue RNA of 10-15 μ g, in 1% agarose that contains 2.2 mol/L formaldehyde, after the electrophoretic separation, use the kapillary method to transfer on the nylon membrane, and the method reference " molecular cloning. experiment guide " (Sambrook, J., Fritsh, E.F., and Maniais, T., Molecular Cloning, ColdSpring Harbor Laboratory Press, 1989).
Nylon membrane (Multiple Tissue Northern Blot I, Clontech company product) is put into hybrid pipe, add 5mL quick hybridization liquid (Clontech company product), 68 ℃ of prehybridizations 30 minutes change the fresh hybridization solution of 5mL, add sex change
32The segmental probe of the random labeled LRTM4 of P (Random Primer dna marker test kit, TaKaRa company) was hybridized 1 hour for 68 ℃.Hybond membrane washes twice in room temperature, each 20 minutes with lavation buffer solution I (0.3M NaCl, 0.03M sodium-acetate (PH7.0), 0.05% sodium laurylsulfonate); Use lavation buffer solution II (15mM NaCl, 1.5mM sodium-acetate (pH7.0), 0.1% sodium laurylsulfonate) to wash twice, each 20 minutes then in 50 ℃.Then, compressing tablet ,-70 ℃ of radioautograph.
Experimental result as shown in Figure 2, the LRTM4 gene has expression in liver and testis, express obviously to raise in Liver Regeneration, the expression product size is about 1.6Kb.This explanation LRTM4 gene may not only work in liver regeneration, also may have certain effect in the fission process of testis.
Embodiment 5, LRTM4 gene promotion liver reparation in the carbon tetrachloride hepatic injury rat model
Dissolve tetracol phenixin (CCl with vegetables oil
4), to tetracol phenixin concentration be 40% (V/V).Amount according to 0.5ml/kg and 1.0ml/kg body weight is irritated hello rat with tetracol phenixin.Get the pCDNA3 recombinant plasmid that 200 μ g contain the LRTM4 gene coding region, and mix after 50 μ L liposomes are dissolved in 500 μ L PBS respectively, get and irritate the rat that feeds after 24 hours and the LRTM4 expression plasmid is injected in the rat body by the tail vein.After 72 hours, put to death rat, take out hepatic tissue and insert the liquid nitrogen preservation; Get blood and leave standstill back centrifuging and taking serum.
Adopt TRIZOL test kit (GIBCOL/BRL company), the method for Tui Jianing prepares the total RNA of tissue sample to specifications.Carry out reverse transcription according to the method for embodiment 2 and prepare the cDNA template.The amplification of LRTM4 gene be to use LRTM4 coding region primer (CDS1:5 '-CCGCTCGAGCCACCCCAGCATGTGTACT-3 ' (SEQ ID NO:6); CDS2:5 '-GCGTCGACT GGTCTATCACCCCCACA-3 ' (SEQ ID NO:7)), carry out pcr amplification, reaction conditions is 94 ℃ of pre-sex change in 2 minutes, circulating reaction be 94 ℃ 30 seconds, 55 ℃ 30 seconds, 72 ℃ 90 seconds, carry out 35 circulations altogether.The mensuration of GAPDH expression amount be to use the GAPDH gene specific primer (GAPDHL:5 '-ACCACAGTCCATGCCATCAC-3 '; GAPDHR:5 '-ACCACAGTCCATGCC ATCAC-3 '), carry out pcr amplification, reaction conditions is 94 ℃ of pre-sex change in 2 minutes, circulating reaction be 94 ℃ 30 seconds, 55 ℃ 30 seconds, 72 ℃ 90 seconds, carry out 25 circulations altogether, reaction product is as interior mark.The amplified production of LRTM4 and GAPDH is electrophoresis simultaneously, and scanning is quantitatively calculated the expression level of the ratio of LRTM4 and GAPDH amount as LRTM4.
Use transaminase quantification kit (Transaminases Quantitative Kit, SIGMA company), detect GPT level in the serum according to description of product recommend method: after getting 100 microlitre L-Ala-α-37 ℃ of preheatings of KG substrate, add 20 microlitre serum, mix back 37 ℃ of insulations 30 minutes, add 100 microlitre colouring reagentss then, mix the back and placed room temperature 20 minutes, add 1 milliliter of 0.4mol/L NaOH, place behind the mixing after at least 5 minutes, with water in contrast, measure the 505nm photoabsorption.According to explanation drawing standard curve, obtain GPT content in each sample at typical curve.
The result as shown in Figure 3, different treatment group 1 is a normal rat, 2,3 for irritate feeding 0.5 milliliter of tetracol phenixin/kg body weight, 4,5 irritate and feed 1 milliliter of tetracol phenixin/kg body weight, wherein 3,5 all import the LRTM4 gene.Test shows that LRTM4 has low-level expression in the normal liver tissue, and the GPT level is lower simultaneously; After taking in tetracol phenixin, GPT level and LRTM4 expression level all raise, and intake is big more, and the GPT level is high more, and the LRTM4 expression level reduces when the tetracol phenixin level raises on the contrary; After importing the LRTM4 gene, the LRTM4 expression level obviously raises, and follows the GPT level to descend.This shows that GPT level and LRTM4 expression of gene level are close negative correlation behind liver tissue injury.
In sum, LRTM4 albumen is a novel liver regeneration related protein that does not appear in the newspapers.Recombinant expressed and the purifying of embodiment 6 LRTM4 albumen
Adopt the T carrier plasmid purification that contains total length LRTM4 gene that obtains among the embodiment 2 as template, the primer of the coding region sequence of use LRTM4 albumen second extracellular region (EC2f:5 '-CGGGATCCTTTCCATCAACAAGGGTCCT-3 ' (SEQ ID NO:8), EC2r:5 ' CGAATTCCGAGATTCCAAGG GACCACAT-3 ' (SEQ ID NO:9)), increase according to preceding method, the PCR reaction conditions is 94 ℃ of pre-sex change in 2 minutes, circulating reaction be 94 ℃ 30 seconds, 55 ℃ 30 seconds, 72 ℃ 90 seconds, carry out 20 circulations altogether.After the PCR product is purified, handle, be connected on the pGEX-3X carrier that these two enzymes are handled, and transform DH5 α competent cell with Bam HI and Eco RI restriction enzyme.
The saturated culture that transformant after identifying spends the night is inoculated in 1 liter of 2 * YT substratum according to 1: 60 ratio, cultivates after 3 hours for 37 ℃, add IPTG to 0.3mmol/L, after inducing 3 hours, centrifugal 4000rpm, 10 minutes results thalline, after the PBS washing once, hang thalline with 25 milliliters of PBS that contain 1mmol/L PMSF, behind the ultrasonic disruption thalline, in solution, added 10%Triton X-100 to 1%, centrifugal 10000rpm behind the mixing, 10 minutes.The glutathione agarose gel pillar that balance is good on the supernatant after centrifugal is according to Pharmacia company operation instruction, purified fusion protein.
Through the 10%SDS-PAGE electrophoresis detection, at about 31kDa place one main band is arranged, conform to the molecular weight of the GST-LRTM4 fusion rotein of predicting.The aminoacid sequence of GST-LRTM4 fusion rotein is shown in SEQ IDNO:3, and wherein the 229-272 position is the fragment that is derived from LRTM4.The generation of embodiment 7 anti-LRTM4 protein antibodies
Get the purified fusion protein that obtains among the 200 μ g embodiment 6, be dissolved in 0.5 ml deionized water, add isopyknic Freund's complete adjuvant and mixing, multi-point injection is in the male new zealand white rabbit intracutaneous of body weight 2.5Kg.Same protein content and the Freund's incomplete adjuvant of 4 weeks back use carries out booster shots.After 2 weeks, strengthen once more.Strengthen the back and get blood, use immune double diffusion method to detect antibody titer at arteria auricularis.When antibody titer reached requirement, the carotid artery bloodletting was collected blood and is prepared antiserum(antisera), added NaN
3To 0.1%, place-20 ℃ of preservations.
All quote in this application as a reference at all documents that the present invention mentions, just quoted as a reference separately as each piece document.Should be understood that in addition those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims institute restricted portion equally.
Sequence table (1) general information: (ii) denomination of invention: new liver regeneration related protein, its encoding sequence and purposes be the sequence number (iii): the information of 3 (2) SEQ ID NO:1: (i) sequence signature:
(A) length: 1576bp
(B) type: nucleic acid
(C) chain: two strands
( D ) ： ( ii ) ：cDNA ( xi ) ：SEQ ID NO：1：agcaactcga acatcttgtc tgtgctggtg gattattaac agaggttatt ggtctccatg 60gcaaaacaat tgaacgatcg cgcagaacgt aatctcattt atggggtgca aaaaaaaaaa 120gacattgggt cagggatata aatgcccatt gccactgagg gcctgctata gttcagaagt 180gactccacgg ttcaaaacgc tctgacattt tggtcccaaa tttcttactg aaccaggtac 240agccactgca acgcgctgcc aaaacccctg aggagtcctg tgaagctggt ggtgaggagc 300ctttgatctc tgtgctttac tgtgccaccc cagcatgtgt actgggggct gtgccaggtg 360cctggggggc accctcattc ccttggctgt gtttgccgtc ctggcaaata tcctgttgtt 420ttttcctgga ggaaaagtgg tggatgacaa cagccacctt tcagatgagg tctggtactt 480cggaggaata ctgggaagtg gagtcttgat gatcttccct gcgctggtgt tcttgggcct 540gcagaacaat gactgctgcg gatgctgtgg taatgagagc tgtgggaagc gatttgcgat 600gttcacctcc acgttgtttg ctgtggttgg cttcttgggt gctgcatact catttatcgt 660ctcagccgtt tccatcaaca agggtcctaa atgcttcatg accaataaca cctggggata 720ccccttccac gatggtgatt atcttaatga ccaagccttg tggagcaagt gcgaagaacc 780ccgcgatgtg gtcccttgga atctcaccct tttctccatt ctgctggtca tcggagggat 840ccagatggtt ctctgtgcca tccaggtgat caatggcctc ctgggaactc tctgtggaga 900ctgccagtgc tgtggctgct gtgggggtga tagaccagtc taacaggcta cgatgatctg 960ctccaagtct acagcaccat gtgtgggaag acatggccca ggcccagcac tgcacacatg 1020ggctgctaac tcctgtccgg ttggatcctc tctggcagag cttgggaggc acaggagatc 1080ctttactctc tccaaacaac ttagctcaac ccaggaattt ggtggaattt ttttactttg 1140caaattaggc cctattttga attccagaac aagtttaaag cacatttttc atgatttccc 1200ataagaaaag ttaaaataga ggaggtcact tgtcctacca cattgtctct ttgtgtataa 1260agatgtccat actttaggaa tatttgcatt gaactcaaag agataaagca ttacaaggaa 1320aaccggtttt tcaggatgca taggtaagga atgattgcta tattatatat aatttttatg 1380tgaagcctgt tttggctaac ttgtctggac tacttgtaac tagttttatg agcctgtcat 1440aatttgccag ggttcccaca tgtatattaa gttaattaaa ttcagaatta aaataataaa 1500tgtgggggga ggaagaagag aaagaatgta tcagacctgc ttgtcttttt tctttttata 1560aatgcattct ttcttt 1576 ( 2 ) SEQ ID NO：2： ( i ) ：
(A) length: 202 amino acid
(B) type: amino acid
(D) topological structure: linear (ii) molecule type: polypeptide (xi) sequence description: the information of SEQ ID NO:2:MCTGGCARCL GGTLIPLAVF AVLANILLFF PGGKVVDDNS HLSDEVWYFG GILGSGVLMI 60FPALVFLGLQ NNDCCGCCGN ESCGKRFAMF TSTLFAVVGF LGAAYSFIVS AVSINKGPKC 120FMTNNTWGYP FHDGDYLNDQ ALWSKCEEPR DVVPWNLTLF SILLVIGGIQ MVLCAIQVIN 180GLLGTLCGDC QCCGCCGGDR PV 202 (2) SEQ ID NO:3: (i) sequence signature:
(A) length: 276 amino acid
(B) type: amino acid
(D) topological structure: linear (ii) molecule type: polypeptide (xi) sequence description: the information of SEQ ID NO:3:MSPILGYWKI KGLVQPTRLL LEYLEEKYEE HLYERDEGDK WRNKKFELGL EFPNLPYYID 60GDVKLTQSMA IIRYIADKHN MLGGCPKERA EISMLEGAVL DIRYGVSRIA YSKDFETLKV 120DFLSKLPEML KMFEDRLCHK TYLNGDHVTH PDFMLYDALD VVLYMDPMCL DAFPKLVCFK 180KRIEAIPQID KYLKSSKYIA WPLQGWQATF GGGDHPPKSD LIEGRGILSI NKGPKCFMTN 240NTWGYPFHDG DYLNDQALWS KCEEPRDVVP WNLNSS 276 (2) SEQ ID NO:4
(i) sequence signature
(A) length: 22 bases
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linearity
(ii) molecule type: oligonucleotide
(xi) sequence description: the information of SEQ ID NO:4:GCAACTCGAA CATCTTGTCT GT 22 (2) SEQ ID NO:5
(i) sequence signature
(A) length: 22 bases
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linearity
(ii) molecule type: oligonucleotide
(xi) sequence description: the information of SEQ ID NO:5:GGCAAATTAT GACAGGCTCA TA 22 (2) SEQ ID NO:6
(i) sequence signature
(A) length: 28 bases
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linearity
(ii) molecule type: oligonucleotide
(xi) sequence description: the information of SEQ ID NO:6:CCGCTCGAGC CACCCCAGCA TGTGTACT 28 (2) SEQ ID NO:7
(i) sequence signature
(A) length: 26 bases
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linearity
(ii) molecule type: oligonucleotide
(xi) sequence description: the information of SEQ ID NO:7:GCGTCGACTG GTCTATCACC CCCACA 26 (2) SEQ ID NO:8
(i) sequence signature
(A) length: 28 bases
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linearity
(ii) molecule type: oligonucleotide
(xi) sequence description: the information of SEQ IDNO:8:CGGGATCCTT TCCATCAACA AGGGTCCT 28 (2) SEQ ID NO:9
(i) sequence signature
(A) length: 28 bases
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linearity
(ii) molecule type: oligonucleotide
(xi) sequence description: SEQ ID NO:9:CGAATTCCGA GATTCCAAGG GACCACAT 28
Claims (11)
1. an isolating LRTM4 polypeptide is characterized in that it comprises: polypeptide or its conservative property variation polypeptide or its active fragments or its reactive derivative with SEQ ID NO:2 aminoacid sequence.
2. polypeptide as claimed in claim 1 is characterized in that, this polypeptide is the polypeptide with SEQ ID NO:2 aminoacid sequence.
3. isolating polynucleotide is characterized in that, it comprises a nucleotide sequence, and this nucleotide sequence is shown at least 75% homogeny with a kind of nucleotides sequence that is selected from down group:
(a) coding is as the polynucleotide of polypeptide as described in claim 1 and 2;
(b) with polynucleotide (a) complementary polynucleotide.
4. polynucleotide as claimed in claim 3 is characterized in that, this polynucleotide encoding has the polypeptide of aminoacid sequence shown in the SEQ ID NO:2.
5. polynucleotide as claimed in claim 3 is characterized in that, the sequence of these polynucleotide is selected from down a kind of of group:
(a) has the sequence of 335-940 position among the SEQ ID NO:1;
(b) has the sequence of 1-1576 position among the SEQ ID NO:1.
6. a carrier is characterized in that, it contains the described polynucleotide of claim 3.
7. a genetically engineered host cell is characterized in that, it contains the described carrier of claim 6.
8. the preparation method with polypeptide of LRTM4 protein-active is characterized in that, this method comprises:
(a) being fit to express under the proteic condition of LRTM4, cultivate the described host cell of claim 7;
(b) from culture, isolate polypeptide with LRTM4 protein-active.
9. energy and the described LRTM4 protein-specific of claim 1 bonded antibody.
10. a pharmaceutical composition is characterized in that, it contains the described polypeptide of claim 1 or the described polynucleotide of claim 3 or the described carrier of claim 6 of safe and effective amount, and pharmaceutically acceptable vehicle, diluent or carrier.
11. whether there is the proteic method of LRTM4 in the test sample, it is characterized in that, comprising:
The described antibody of sample and claim 9 is contacted,
Observe whether form antibody complex, formed antibody complex and just represented to exist in the sample LRTM4 albumen.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN011052821A CN1216910C (en) | 2001-01-22 | 2001-01-22 | Novel liver regeneration related protein, its code sequence and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN011052821A CN1216910C (en) | 2001-01-22 | 2001-01-22 | Novel liver regeneration related protein, its code sequence and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1367179A true CN1367179A (en) | 2002-09-04 |
| CN1216910C CN1216910C (en) | 2005-08-31 |
Family
ID=4654365
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN011052821A Expired - Fee Related CN1216910C (en) | 2001-01-22 | 2001-01-22 | Novel liver regeneration related protein, its code sequence and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1216910C (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2004060914A1 (en) * | 2003-01-03 | 2004-07-22 | Shanghai Institutes For Biological Sciences, Chinese Academy Of Sciences | A human liver regeneration associated protein and the use of it |
| CN112147336A (en) * | 2019-09-18 | 2020-12-29 | 首都医科大学附属北京佑安医院 | Marker for detecting and evaluating liver regeneration and application thereof |
-
2001
- 2001-01-22 CN CN011052821A patent/CN1216910C/en not_active Expired - Fee Related
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2004060914A1 (en) * | 2003-01-03 | 2004-07-22 | Shanghai Institutes For Biological Sciences, Chinese Academy Of Sciences | A human liver regeneration associated protein and the use of it |
| US7741468B2 (en) | 2003-01-03 | 2010-06-22 | Shanghai Institutes For Biological Sciences, Chinese Academy Of Sciences | Human liver regeneration associated protein and the use thereof |
| CN112147336A (en) * | 2019-09-18 | 2020-12-29 | 首都医科大学附属北京佑安医院 | Marker for detecting and evaluating liver regeneration and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN1216910C (en) | 2005-08-31 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN1308346C (en) | Novel human phosphotidylethanolamine binding protein, its coding sequence and application | |
| CN1216910C (en) | Novel liver regeneration related protein, its code sequence and application | |
| CN1343725A (en) | Human angiogenin-like protein and coding sequence and application thereof | |
| CN1194087C (en) | New plasmin and its coding sequence and use | |
| CN1289852A (en) | Human nif gene homogenous protein and its coding sequence | |
| CN1223607C (en) | Human calcium ion/calmodulin dependent protein kinase II inhibitory protein and its application | |
| CN1209369C (en) | Cell death inducing protein and its coding sequence and use | |
| CN1385441A (en) | Novel human lymphokine, its coding sequence and use | |
| CN1352138A (en) | Sperm formation relative protein and its coding sequence and use | |
| CN1171901C (en) | New interferon-like protein and its code sequence and use | |
| CN1238379C (en) | New osteoclast formation inhibiting factor and its coding sequence and use | |
| CN1618808A (en) | Liver cancer related protein and its coding sedquence and use | |
| CN1300783A (en) | Human neuron linear protein and its coding sequence | |
| CN1148381C (en) | New human chemotaxis factor macrophage inflammatory protein, its coding sequence and use | |
| CN1299830A (en) | New human heat shock protein and its code sequence and use | |
| CN1377891A (en) | Zinc finger protein from dendritic cell, its coding sequence and use | |
| CN1477193A (en) | Novel human Rab GTP enzyme, its coding sequence and application | |
| CN1303933A (en) | Novel polypeptide-human muscle BOP protein 41 and polynucleotide coding said polypeptide | |
| CN1511847A (en) | Ubiquitin-like molecule coming from human dendritic cell and its codnig sequence and use | |
| CN1475503A (en) | New type human bone marrow substrate cell source growth inhibiting factor, its coded sequence and use | |
| CN1510051A (en) | Polypeptide-human cytochrome C oxidase COII protein9 and polynucleotide for encoding said polypeptide | |
| CN1293203A (en) | Polypeptide-human zinc finger protein 59 and polynucleotide for coding this polypeptide | |
| CN1510042A (en) | Polypeptide-Human PAX protein 12 and polynucleotide for coding this polypeptide | |
| CN1746186A (en) | Atrial fibrillation peccant gene and uses thereof | |
| CN1297897A (en) | New human oxyglutelinoid and its code sequence |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C56 | Change in the name or address of the patentee |
Owner name: SHANGHAI INST. OF LIFE SCIENCE, CAS Free format text: FORMER NAME OR ADDRESS: SHANGHAI INST. OF BIOCHEMISTRY, CHINESE ACADEMY OF SCIENCES |
|
| CP03 | Change of name, title or address |
Address after: 200031 No. 320, Yueyang Road, Shanghai Patentee after: Shanghai Institute of life Sciences, Chinese Academy of Sciences Address before: 200031 No. 320, Yueyang Road, Shanghai Patentee before: Shanghai Research Institute of Biochemistry Chinese Academy of Sciences |
|
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20050831 Termination date: 20140122 |