CN1300783A - Human neuron linear protein and its coding sequence - Google Patents

Abstract

A novel human neuronal thread protein (BioHNTP), the polynucleotide for coding it, the process for preparing said polypeptide by recombination, the application of said polypeptide and polynucleotide in treating diseases (senile dementia, immune system's disorder, cancer, etc), the antagonist of said polypeptide and its medical function, the diagontic method based on the mutation of nucleotide sequence and variation in said polypeptide expression level, and the application of said polynucleotide are disclosed.

Description

New Novel Human Thread Protein and encoding sequence thereof

The invention belongs to biological technical field and field of genetic engineering, specifically, the present invention relates to a kind of new polypeptide-human neuron linear protein (Novel Human Neuronal Thread Protein is called for short " BioHNTP "), and the polynucleotide sequence of this polypeptide of encoding.The invention still further relates to the preparation method and the application of these polynucleotide and polypeptide.

Neuron linear protein (NTP) is a phosphorprotein family of expressing when neural axon is sprouted.NTP is accumulated in patients of senile dementia, Down's syndrome patient's the cerebral tissue, all contains NTP in neurone and stellate cell, and it all plays a crucial role when the neural axon of normal and pathology is sprouted.The wherein NTP of 15-18KD and neuronic differentiation and develop relevantly, it is relevant that the NTP of 21 KD and 673-42KD and nerve retrograde affection take place to separate with cynapse, expresses at the patients of senile dementia camber.NTP may be subjected to adjusting [de la Monte SM, et al, the J Cereb BloodFlow Metab 1997 of central nervous system damage and shock; 17:623-35].Work in the neuron regeneration process of the NTP of 15-18KD after sophisticated central nervous system is impaired.

NTP constitutes a molecule family that is expressed in brain and the original neuroectodermal tumors cell strain.It has high level expression in the neuronal kernel pericentral siphon of patients of senile dementia, nerve fiber, aixs cylinder.In patients of senile dementia, but [De La Monte SM, etal, J Neuropathol Exp Neurol 1996 such as neurone, aixs cylinder ball, malnutritive neuritis and irregular nerve fiber that AD7c-NTP monoclonal antibody mark is degenerated; 55:1038-50].The expression of NTP is subjected to DNA to synthesize, dash through adjustings such as aixs cylinder sprouting, neurone differentiation.Ethanol may suppress the NTP relevant with the neurone differentiation of central nervous system and express [Xu YY, etal, Biochem J1995; 310:125-32].

Discover that neuron linear protein (NTP) and polynucleotide encoding thereof are relevant with diseases such as senile dementia, Down's syndrome, nervous system neoplasms.Therefore, significant for therapeutic purpose research and development Novel Human Thread Proteins (NTP).

An object of the present invention is to provide isolating new polypeptide-human neuron linear protein (abbreviating " BioHNTP " as) with and fragment, analogue and derivative.

Another object of the present invention provides the polynucleotide of this BioHNTP polypeptide of coding.

Another object of the present invention provides the recombinant vectors of the polynucleotide that contain the BioHNTP that encodes.

Another object of the present invention provides the genetically engineered host cell of the polynucleotide that contain the BioHNTP that encodes.

Another object of the present invention provides the method for producing BioHNTP.

Another object of the present invention provides the antibody at BioHNTP polypeptide of the present invention.

Another object of the present invention has provided at the simulated compound of BioHNTP polypeptide of the present invention, antagonist, agonist, inhibitor.

Another object of the present invention provides the method for the diagnosis disease relevant unusually with BioHNTP with treatment.

In a first aspect of the present invention, novel isolated Novel Human Thread Protein (BioHNTP) is provided, this polypeptide is the people source, and it comprises: have the polypeptide of SEQ ID NO:2 aminoacid sequence or its conservative property variation polypeptide or its active fragments or its reactive derivative, analogue.Preferably, this polypeptide is that polypeptide or its amino acid variation with SEQ ID NO:2 aminoacid sequence is no more than 5% derivative.

In a second aspect of the present invention, the polynucleotide of these polypeptide of separated coding are provided, these polynucleotide comprise a nucleotide sequence, and this nucleotide sequence is shown at least 70% homogeny with a kind of nucleotides sequence that is selected from down group: (a) polynucleotide of the above-mentioned BioHNTP of coding; (b) with polynucleotide (a) complementary polynucleotide.Preferably, this polynucleotide encoding has the polypeptide of aminoacid sequence shown in the SEQ ID NO:2.More preferably, the sequence of these polynucleotide is a kind of of the white group down of choosing: the sequence that (a) has 673-1332 position among the SEQ ID NO:1; (b) has the sequence of 1-2692 position among the SEQ ID NO:1.

In a third aspect of the present invention, the carrier that contains above-mentioned polynucleotide is provided, and has been transformed or host cell of transduceing or the host cell that is directly transformed or transduce by above-mentioned polynucleotide by this carrier.

Others of the present invention are because disclosing of the technology of this paper is conspicuous to those skilled in the art.

Following accompanying drawing is used to illustrate specific embodiments of the present invention, and is not used in qualification by basis that claims defined

Invention scope.

Fig. 1 is the amino acid sequence homology comparison diagram of the neuron linear protein (AF010144) of Novel Human Thread Protein of the present invention (BioHNTP) and Homo sapiens.Same amino acid represents with monocase amino acid that between two sequences similar amino acid is represented with "+".Fig. 2 is isolating Novel Human Thread Protein's (BioHNTP) polyacrylamide gel electrophoresis figure (SDS-PAGE).24kDa is proteinic molecular weight, and the arrow indication is isolated protein band.

As used herein, " separation " refer to material from its primal environment, separate (if crude, Primal environment namely is natural surroundings). For example, the polynucleotide under the native state in the active somatic cell and polypeptide are not divide From purifying, but same polynucleotide or polypeptide as from native state with in other materials that exist separately, then be Separation and purification.

As used herein, " BioHNTP albumen or the polypeptide of separation " refers to that BioHNTP is substantially free of natural and its phase Other albumen, lipid, carbohydrate or other material that close. Those skilled in the art can use the purified technology of protein of standard Purifying BioHNTP. Basically pure polypeptide can produce single master tape on non-reduced polyacrylamide gel. BioHNTP The purity of polypeptide can be determined with amino acid analysis.

The invention provides a kind of new polypeptide---BioHNTP polypeptide, it is basically by shown in the SEQ ID NO:2 Amino acid sequence forms. Polypeptide of the present invention can be recombinant polypeptide, natural polypeptides, synthetic polypeptide, and preferred restructuring is many Peptide. Polypeptide of the present invention can be the product of natural purifying, or the product of chemical synthesis, or uses recombinant technique from former Produce in nuclear or the eucaryon host (for example, bacterium, yeast, higher plant, insect and mammalian cell). According to restructuring The host that production decision is used, polypeptide of the present invention can be glycosylated, maybe can be nonglycosylated. Of the present invention Polypeptide also can comprise or not comprise initial methionine residues.

The present invention also comprises fragment, derivative and the analog of BioHNTP. As used herein, term " fragment ", " derivative " and " analog " refer to the biological function or the work that basically keep the natural BioHNTP of the present invention identical The polypeptide of property. The fragment of polypeptide of the present invention, derivative or analog can be: (ⅰ) have one or more conservative or non-conservative The substituted polypeptide of acidic amino acid residue (preferred conservative amino acid residue), and the amino acid residue of such replacement is passable Be also can not encoded by genetic code, or (ⅱ) in one or more amino acid residues, have the many of substituted radical Peptide, or (ⅲ) mature polypeptide and another compound (such as the compound that prolongs the polypeptide half-life, for example polyethylene glycol) melt Close formed polypeptide, or (ⅳ) additional amino acid sequence be fused to this peptide sequence and the polypeptide that forms (such as targeting sequencing Secretion sequence or be used for sequence or the proteinogen sequence of this polypeptide of purifying). According to the instruction of this paper, these fragments, derive Thing and analog belong to the known range of those skilled in the art.

The present invention also provides the nucleic acid (polynucleotides) that separates, and these polynucleotides have SEQ ID NO:2 ammonia by coding substantially The polynucleotides of the polypeptide of base acid sequence form. Preferably, polynucleotide sequence of the present invention has SEQ ID NO:1's Nucleotide sequence.

Polynucleotides of the present invention can be dna form or rna form. Dna form comprises cDNA, genomic DNA Or artificial synthetic DNA. DNA can be strand or double-stranded. DNA can be coding strand or noncoding strand. Coding The coding region sequence of mature polypeptide can be identical with the coding region sequence shown in the SEQ ID NO:1 or the variant of degeneracy. As used herein, " variant of degeneracy " the protein with SEQ ID NO:2 or many that refers in the present invention encode Peptide, but with the differentiated nucleotide sequence of coding region sequence shown in the SEQ ID NO:1.

The polynucleotides of the mature polypeptide of coding SEQ ID NO:2 comprise: the coded sequence that only has mature polypeptide; Maturation is many The coded sequence of peptide and various additional code sequence; The coded sequence of mature polypeptide (with optional additional code sequence) and Non-coding sequence.

Term " polynucleotides of coded polypeptide " refer to comprise encode this polypeptide polynucleotides and comprise additional code and/ Or the polynucleotides of non-coding sequence.

The invention still further relates to the variant of above-mentioned polynucleotides, it is encoded the polypeptide of identical amino acid sequence with the present invention Or the fragment of polypeptide, analog and derivative. The variant of these polynucleotides can be natural generation allelic variant or The variant that non-natural takes place. These nucleotide diversity bodies comprise and replace variant, deletion mutation body and insert variant. As known in the art, allelic variant is a kind of replacement form of polynucleotides, and it may be one or more nucleotides Replacement, disappearance or insertion, but can be from the function of the polypeptide that changes in fact its coding.

The invention still further relates to and the polynucleotides of sequence hybridization described above (have at least 50% between two sequences, excellent Choosing has 70% homogeny). The present invention be more particularly directed under stringent condition interfertile many with polynucleotides of the present invention Nucleotides. In the present invention, " stringent condition " refers to: (1) is than the hybridization under LIS and the higher temperature with wash Take off, such as 0.2 * SSC, 0.1%SDS, 60 ℃; Or (2) hybridization the time is added with denaturant, and such as 50% (v/v) formamide, 0.1% is little Cow's serum/0.1%Ficoll, 42 ℃ etc.; Or (3) only at the homogeny between the two sequences at least more than 95%, be more preferably 97% just hybridizes when above. And, the polypeptide of interfertile polynucleotide encoding and becoming shown in the SEQ ID NO:2 Ripe polypeptide has identical biological function and activity.

The invention still further relates to the nucleic acid fragment with sequence hybridization described above. As used herein, " nucleic acid fragment " Length contain at least 10 nucleotides, better be at least 30 nucleotides, be more preferably at least 50 nucleotides, preferably More than at least 100 nucleotides. Nucleic acid fragment also can be used for the amplification technique (such as PCR) of nucleic acid to determine and/or to separate and compile The polynucleotides of code BioHNTP.

Polypeptide among the present invention preferably provides with the form of separating with polynucleotides, more preferably is purified to homogeneous.

The special polynucleotide sequence of coding BioHNTP of the present invention can obtain with several different methods. For example, use this area The hybridization technique of knowing is separated polynucleotides. These technology including, but not limited to: 1) with probe and genome or cDNA literary composition The polynucleotide sequence and 2 of homology is hybridized to detect in the storehouse) antibody screening of expression library has the common structure feature to detect Clone's polynucleotide passage.

Sequence dna fragment of the present invention also can obtain with following method: 1) separate double chain DNA sequence from genomic DNA; 2) the chemical synthesising DNA sequence is to obtain the double-stranded DNA of described polypeptide.

In the above-mentioned method of mentioning, isolation of genomic DNA is least commonly used.The direct chemical of dna sequence dna is synthetic to be the method for often selecting for use.The more frequent method of selecting for use is the separation of cDNA sequence.The standard method that separates interested cDNA is from the donorcells separating mRNA of this gene of high expression level and carries out reverse transcription, forms plasmid or phage cDNA library.Extract the existing multiple proven technique of method of mRNA, test kit also can obtain (Qiagene) from commercial channels.And the construction cDNA library also is usual method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, ColdSpring Harbor Laboratory.New York, 1989).Also can obtain the cDNA library of commercial offers, as the different cDNA library of Clontech company.When being used in combination polymerase chain reaction technique, even few expression product also can be cloned.

Available ordinary method is screened gene of the present invention from these cDNA libraries.These methods include, but is not limited to: (1) DNA-DNA or DNA-RNA hybridization; (2) appearance of marker gene function or forfeiture; (3) level of mensuration BioHNTP transcript; (4), detect the protein product of genetic expression by immunological technique or mensuration biologic activity.Aforesaid method can singly be used, but also several different methods combined utilization.In (1) kind method, hybridizing used probe is and any a part of homology of polynucleotide of the present invention that at least 10 Nucleotide of its length better are at least 3 Nucleotide, are more preferably at least 50 Nucleotide, preferably at least 100 Nucleotide.In addition, within 2000 Nucleotide, preferable is within 1000 Nucleotide to the length of probe usually.Probe used herein is the dna sequence dna of chemosynthesis on the basis of gene order information of the present invention normally.Gene of the present invention itself or fragment are certainly as probe.Dna probe can carry out mark with radio isotope, fluorescein or enzyme (as alkaline phosphatase) etc.

In (4) kind method, detect the protein product of BioHNTP genetic expression and can use immunological technique such as Western blotting, radioimmunoprecipitation, enzyme-linked immunosorbent assay (ELISA) etc.

Use method (Saiki, the et al.Science 1985 of round pcr DNA amplification/RNA; 230:1350-1354) be optimized for acquisition gene of the present invention.When particularly being difficult to from the library, obtain the cDNA of total length, can preferably use RACE method (the terminal rapid amplifying method of RACE-cDNA).The primer that is used for PCR can suitably be selected according to polynucleotide sequence information of the present invention disclosed herein, and available ordinary method is synthetic.Available ordinary method is as the DNA/RNA fragment by gel electrophoresis separation and purifying amplification.

The gene of the present invention that obtains as mentioned above or the nucleotide sequence of its various dna fragmentations, and available ordinary method such as dideoxy chain termination (Sanger et al.PNAS, 1977,74:5463-5467) measure.This class polynucleotide sequence is measured also available commercial sequencing kit.In order to obtain the cDNA sequence of total length, order-checking need be carried out repeatedly.Sometimes need to measure a plurality of clones' cDNA sequence, just can be spliced into the cDNA sequence of total length.

The present invention also relates to comprise the carrier of polynucleotide of the present invention, and with carrier of the present invention or directly with the host cell of BioHNTP encoding sequence through the genetically engineered generation, and the method that produces polypeptide of the present invention through recombinant technology.

Among the present invention, the polynucleotide sequence of coding BioHNTP can be inserted in the carrier, contains the recombinant vectors of polynucleotide of the present invention with formation.Term " carrier " refers to that bacterial plasmid well known in the art, phage, yeast plasmid, vegetable cell virus, mammalian cell virus are as adenovirus, retrovirus or other carrier.The carrier of Shi Yonging includes but not limited in the present invention: and the expression vector based on the T7 promotor of in bacterium, expressing (Rosenberg, et al.Gene, 1987,56:125); The pMSXND expression vector of in mammalian cell, expressing (Lee and Nathans, J Bio Chem.263:3521,1988) and at the carrier that derives from baculovirus of expressed in insect cells.In a word, as long as can duplicate in host and stablize, any plasmid and carrier may be used to make up recombinant expression vector.A key character of expression vector is to contain replication origin, promotor, marker gene and translational control element usually.

Available method well-known to those having ordinary skill in the art makes up the dna sequence dna that contains the BioHNTP that encodes and the expression vector of suitable transcribing/translational control element.These methods comprise (Sambroook, et al.Molecular Cloning, a Laboratory Manual, Cold SpringHarbor Laboratory.New York, 1989) such as extracorporeal recombinant DNA technology, DNA synthetic technology, the interior recombinant technologys of body.Described dna sequence dna can effectively be connected on the suitable promotor in the expression vector, and is synthetic to instruct mRNA.The representative example of these promotors has: colibacillary lac or trp promotor; The PL promotor of lambda particles phage; Eukaryotic promoter comprises LTRs and some other known may command gene expression promoter in prokaryotic cell prokaryocyte or eukaryotic cell or its virus of CMV immediate early promoter, HSV thymidine kinase promoter, early stage and late period SV40 promotor, retrovirus.Expression vector also comprises ribosome bind site that translation initiation is used and transcription terminator etc.Inserting enhancer sequence in carrier will make its transcribing in higher eucaryotic cells be enhanced.Enhanser is the cis acting factor that DNA expresses, and nearly 10 to 300 base pairs act on promotor transcribing with enhancing gene usually.Can for example be included in the SV40 enhanser of 100 to 270 base pairs of replication origin side in late period one, at the polyoma enhanser of replication origin side in late period one and adenovirus enhanser etc.

In addition, expression vector preferably comprises one or more selected markers, to be provided for selecting the phenotypic character of transformed host cells, cultivate Tetrahydrofolate dehydrogenase, neomycin resistance and the green fluorescent protein (GFP) of usefulness as eukaryotic cell, or be used for colibacillary tsiklomitsin or amicillin resistance etc.

Persons skilled in the art all know how to select appropriate carriers/transcriptional regulatory element (as promotor, enhanser etc.) and selected marker.

Among the present invention, the polynucleotide of coding BioHNTP or the recombinant vectors that contains these polynucleotide can transform or transduce into host cell, contain the genetically engineered host cell of these polynucleotide or recombinant vectors with formation.Term " host cell " refers to prokaryotic cell prokaryocyte, as bacterial cell; Or eukaryotic cell such as low, as yeast cell; Or higher eucaryotic cells, as mammalian cell.The representative example of host cell has: intestinal bacteria, streptomyces; Bacterial cell such as Salmonella typhimurium; Fungal cell such as yeast; Vegetable cell; Insect cell such as fruit bat S2 or Sf9; Zooblast such as CHO, COS or Bowes melanoma cells etc.

Can carry out with routine techniques well known to those skilled in the art with dna sequence dna of the present invention or the recombinant vectors transformed host cell that contains described dna sequence dna.When the host was prokaryotic organism such as intestinal bacteria, the competent cell that can absorb DNA can be used CaCl in exponential growth after date results ₂Method is handled, and used step is well-known in this area.Also available MgCl ₂Carry out.If desired, transforming also the method for available electroporation carries out.When the host is an eukaryote, can select following DNA transfection method for use: coprecipitation of calcium phosphate method, perhaps conventional mechanical method such as microinjection, electroporation, liposome packing etc.

Recombinant DNA technology (Science, 1984 by routine; 224:1431), utilize polynucleotide sequence of the present invention to can be used to express or produce the BioHNTP of reorganization.In general following steps are arranged:

(1). with the polynucleotide (or varient) of coding of the present invention people BioHNTP, or with the recombinant expression vector that contains these polynucleotide proper host cell that transforms or transduce;

(2). in suitable medium, cultivate the host cell that transforms or transduce;

(3). separation, protein purification from substratum or cell.

In step (2), according to used host cell, used substratum can be selected from various conventional substratum in the cultivation.Under the condition that is suitable for the host cell growth, cultivate.After host cell grows into suitable cell density, induce the promotor of selection with suitable method (as temperature transition or chemical induction), cell is cultivated for some time again.

In step (3), recombinant polypeptide can wrap and be expressed or be secreted into the extracellular in cell or on cytolemma.If desired, can utilize its physics, the separating by various separation methods with other characteristic and the albumen of purification of Recombinant of chemistry.These methods are well-known to those skilled in the art.These methods include, but are not limited to: conventional renaturation is handled, protein precipitant is handled (salt analysis method), centrifugal, the broken bacterium of infiltration, the combination of ultrasonication, super centrifugal, sieve chromatography (gel-filtration), adsorption chromatography, ion exchange chromatography, high performance liquid chromatography (HPLC) and other various liquid chromatography (LC) technology and these methods.

The antagonist of polypeptide of the present invention and this polypeptide, agonist and inhibitor can be directly used in disease treatment.BioHNTP albumen or polypeptide can as pharmacological agent neuron linear protein hypofunction or the forfeiture due to disease.The antagonist of EioHNTP can be used to treatment or prevention nervous system degenerative disease, and disease comprises but (being not limited to): senile dementia, Parkinson's disease, chorea, amnesia, Heng Yandun disease, epilepsy, dementia etc.

The antagonist of BioHNTP, agonist and inhibitor can be used to treatment or prevention nervous system neoplasm, and disease comprises but (being not limited to): astrocytoma, ependymoma, medulloblastoma, meningioma, glioma, acoustic tumor, angiogenic tumour, Pituitaryadenoma etc.

The fragment of BioHNTP or derivative, antagonist, agonist or inhibitor can be used to treatment or preventing cancer, and cancer includes (but are not limited to): gland cancer, leukemia, lymphoma, melanoma, sarcoma etc.; Especially relevant cancers in position such as kidney, bladder, pancreas, bone, brain, mammary gland, uterus, gall-bladder, liver, lung, Tiroidina, esophagus, testis, skin, mesentery.Can directly be used as antagonist with BioHNTP specificity bonded antibody, or with target or pass through mechanism medicament be taken in the cell or tissue of expressing BioHNTP indirectly.The antagonist of BioHNTP or fragment or derivative can be used to treatment or preventing cancer immunologic derangement.

The present invention also provides SCREENED COMPOUND to identify the method that improves (agonist) or check the medicament of (antagonist) BioHNTP.Agonist improves BioHNTP biological function such as stimulate cellular proliferation, and antagonist prevention disorder such as the various cancer relevant with cell hyperproliferation with treatment.For example, in the presence of medicine, the BioHNTP with mark cultivates with mammalian cell, measures the ability that medicine improves or check the BioHNTP effect then, thereby identifies agonist or antagonist.

The antagonist of BioHNTP comprises antibody, compound, acceptor disappearance thing and the analogue etc. that filter out.The antagonist of BioHNTP can combine and eliminate its function with the BioHNTP polypeptide, or suppresses the generation of this polypeptide, or combines with the avtive spot of this polypeptide and to make this polypeptide can not bring into play biological function.

In screening during as the compound of antagonist, BioHNTP can be added during bioanalysis measures, by measuring compound interactional influence between BioHNTP and its acceptor is determined whether compound is antagonist.With the same quadrat method of above-mentioned SCREENED COMPOUND, can filter out the acceptor disappearance thing and the analogue of antagonist action.Can be incorporated into the rondom polypeptide storehouse that solid formation forms by the various amino acid that may make up by screening with BioHNTP bonded peptide molecule obtains.During screening, generally tackle the BioHNTP molecule and carry out mark.

The invention provides and use polypeptide, and fragment, derivative, analogue or their cell are as the method for antigen with production antibody.These antibody can be polyclonal antibody or monoclonal antibody.The present invention also provides the antibody at the BioHNTP antigenic determinant.These antibody include, but is not limited to: the fragment that polyclonal antibody, monoclonal antibody, chimeric antibody, single-chain antibody, Fab fragment and Fab expression library produce.

The method of the available BioHNTP direct injection of the production of polyclonal antibody immune animal (as rabbit, mouse, rat etc.) obtains.Have multiple adjuvant to can be used for enhancing immunity reaction, comprising but be not limited to freund's adjuvant etc.The technology of the monoclonal antibody of preparation BioHNTP includes, but is not limited to: and hybridoma technology (Kohler and Milstein.Nature, 1975,256:495-497), three knurl technology, people B-quadroma technology, EBV-hybridoma technology etc.With the variable region bonded chimeric antibody in human constant region and inhuman source can with existing technology production (Morison et al, PNAS, 1985,81:6851).And the technology of existing manufacture order chain antibody (U.S.Pat No.496778) also can be used for producing the single-chain antibody of anti-BioHNTP.

The antibody of anti-BioHNTP can be used in the immunohistochemistry technology, detects the BioHNTP in the biopsy specimen.With the also available labelled with radioisotope of BioHNTP bonded monoclonal antibody, inject in the body and can follow the tracks of its position and distribution.This radiolabeled antibody can be used as a kind of atraumatic diagnostic method and is used for the location of tumour cell and has judged whether transfer.

Antibody also can be used for designing the immunotoxin at a certain privileged sites in the body.As the monoclonal antibody of BioHNTP high-affinity can with bacterium or plant poison (as diphtheria toxin, ricin, abrine etc.) covalent attachment.A kind of usual method is with sulfydryl linking agent such as SPDP, attacks the amino of antibody, by the exchange of disulfide linkage, toxin is incorporated on the antibody, and this hybrid antibody can be used for killing the BioHNTP positive cells.

The disease that antibody among the present invention can be used for treating or prevention is relevant with BioHNTP.The antibody that gives suitable dosage can stimulate or block generation or the activity of BioHNTP.

The invention still further relates to the diagnostic testing process of quantitative and detection and localization BioHNTP level.These tests are known in the art, and comprise that FISH measures and radioimmunoassay.The BioHNTP level that is detected in the test can be with laying down a definition the importance of BioHNTP in various diseases and be used to the disease of diagnosing BioHNTP to work.

Polypeptide of the present invention also can be used as the peptide spectrum analysis.For example, the polypeptide available physical, chemistry or enzyme carry out the specificity cutting, and carries out the two-dimentional or three-dimensional gel electrophoresis analysis of one dimension, be more preferably and carry out mass spectroscopy.

The polynucleotide of coding BioHNTP also can be used for multiple therapeutic purpose.Gene therapy technology can be used for treating because cell proliferation, growth or the metabolic disturbance due to the nothing expression of BioHNTP or the unusual/non-activity expression.The gene therapy vector (as virus vector) of reorganization can be designed for the BioHNTP that expresses variation, to suppress endogenic BioHNTP activity.For example, a kind of BioHNTP of variation can be the BioHNTP that shortens, lacked signal conduction function territory, though can combine with the substrate in downstream, lacks signaling activity.Therefore the gene therapy vector of reorganization can be used for treating the disease of BioHNTP expression or active caused by abnormal.Deriving from viral expression vector such as retrovirus, adenovirus, adeno-associated virus (AAV), hsv, parvovirus etc. can be used for the polynucleotide of coding BioHNTP are transferred in the cell.The method of recombinant viral vector that structure carries the polynucleotide of coding BioHNTP be found in existing document (Sambrook, etal.).The polynucleotide of reorganization coding BioHNTP can be packaged in the liposome and then be transferred in the cell in addition.

Polynucleotide import tissue or intracellular method comprises: directly be injected into polynucleotide in the in-vivo tissue; Or external by carrier (as virus, phage or plasmid etc.) earlier with the polynucleotide transfered cell in, again cell is transplanted in the body etc.

Suppress the oligonucleotide (comprising sense-rna and DNA) of BioHNTP mRNA and ribozyme also within the scope of the invention.Ribozyme is the enzyme sample RNA molecule that a kind of energy specificity is decomposed specific RNA, and its mechanism of action is to carry out the endonuclease effect after ribozyme molecule and the hybridization of complementary target RNA-specific.The RNA of antisense and DNA and ribozyme can obtain with existing any RNA or DNA synthetic technology, as the technology widespread use of solid phase phosphoamide chemical synthesis synthetic oligonucleotide.Antisense rna molecule can be transcribed acquisition by the dna sequence dna of this RNA that encodes in external or body.This dna sequence dna has been incorporated into the downstream of rna polymerase promoter of carrier.In order to increase the stability of nucleic acid molecule, available several different methods is modified it, and as increasing the sequence length of both sides, the connection between the ribonucleoside is used phosphoric acid thioester bond or peptide bond but not phosphodiester bond.

The polynucleotide of coding BioHNTP can be used for diagnosing the disease relevant with BioHNTP.The unconventionality expression of the expression that the polynucleotide of coding BioHNTP can be used for detecting BioHNTP BioHNTP whether or under morbid state.As the dna sequence dna of the BioHNTP that encodes can be used for biopsy specimen is hybridized to judge the expression situation of BioHNTP.Hybridization technique comprises the Southern blotting, Northern blotting, in situ hybridization etc.These technological methods all are disclosed mature technologies, and relevant test kit all can obtain from commercial channels.Part or all of polynucleotide of the present invention can be used as probe stationary on microarray (microarray) or DNA chip (being called " gene chip " again), is used for analyzing the differential expression analysis and the gene diagnosis of tissue gene.Carry out the transcription product that RNA-polymerase chain reaction (RT-PCR) amplification in vitro also can detect BioHNTP with the special primer of BioHNTP.

The sudden change that detects the BioHNTP gene also can be used for the disease of diagnosing BioHNTP relevant.The form of BioHNTP sudden change comprises that the point mutation compared with normal wild type BioHNTP dna sequence dna, transposition, disappearance, reorganization and other are any unusual etc.Available existing technology such as Southern blotting, dna sequence analysis, PCR and in situ hybridization detect sudden change.In addition, sudden change might influence proteic expression, therefore can judge indirectly that with Northern blotting, Western blotting gene has or not sudden change.

Sequence of the present invention identifies it also is valuable to karyomit(e).This sequence can be specifically at certain bar human chromosome particular location and and can with its hybridization.At present, need to identify the concrete site of each gene on the karyomit(e).Yet, have only chromosomal marker thing seldom to can be used for the marker chromosomes position now based on actual sequence data (repetition polymorphism).According to the present invention, for these sequences are associated with disease related gene, its important the first step is positioned these dna sequence dnas on the karyomit(e) exactly.

In brief, prepare PCR primer (preferred 15-35bp), sequence can be positioned on the karyomit(e) according to cDNA.Then, these primers are used for the somatocyte hybrid cell that the PCR screening contains each bar human chromosome.Have only those hybrid cells that contain corresponding to the people's gene of primer can produce the fragment of amplification.

The PCR localization method of somatocyte hybrid cell is that DNA is navigated to concrete chromosomal quick method.Use Oligonucleolide primers of the present invention,, can utilize one group to realize inferior location from specific chromosomal fragment or a large amount of genomic clone by similar approach.Other the similar strategy that can be used for chromosomal localization comprises in situ hybridization, uses the karyomit(e) prescreen and the hybridization preliminary election of the airflow classification of mark, thereby makes up the special cDNA storehouse of karyomit(e).

The cDNA clone is carried out fluorescence in situ hybridization (FISH) with Metaphase Chromosome, can in a step, accurately carry out chromosomal localization.The summary of this technology is referring to Verma etc., Human Chromosomes:a Manual of BasicTechniques, Pergamon Press, New York (1988).

In case sequence is positioned to chromosome position accurately, the physical location of this sequence on karyomit(e) just can be associated with the gene map data.These data for example are found in, V.Mckusick, Mendelian Inheritance in Man (can by with the online acquisition of Johns Hopkins University Welch Medicai Library).Can pass through linkage analysis then, determine gene and navigated to relation between the disease on the chromosomal region already.

Then, measure ill and not cDNA between diseased individuals or genome sequence difference.If observe certain sudden change in some or all of diseased individuals, and this sudden change is not observed in any normal individual, then this sudden change may be the cause of disease of disease.More ill and diseased individuals not is usually directed at first seek the variation of structure in the karyomit(e), as from the horizontal visible of karyomit(e) or use based on detectable disappearance of the PCR of cDNA sequence or transposition.Resolving power according to present physical mapping and assignment of genes gene mapping technology, being accurately positioned to the cDNA of the chromosomal region relevant with disease, can be a kind of (the supposing that 1 megabasse mapping resolving power and every 20kb are corresponding to a gene) between 50 to 500 potential Disease-causing genes.

Polypeptide of the present invention, polynucleotide and stand-in thereof, agonist, antagonist and inhibitor and suitable pharmaceutical carrier (pharmaceutically acceptable carrier) combination back can be used.These carriers can be water, glucose, ethanol, salt, damping fluid, glycerine and their combination.Composition comprises the polypeptide of the present invention or the antagonist of safe and effective amount and carrier and the vehicle that does not influence effect of drugs.These compositions can be used as medicine and are used for disease treatment.

The present invention also provides medicine box or the test kit that contains one or more containers, and one or more medicinal compositions compositions of the present invention are housed in the container.With these containers, can have by the given indicative prompting of government authorities of making, using or selling medicine or biological products, the government authorities that this prompting reflects production, uses or sells permits it to use on human body.In addition, polypeptide of the present invention can be used in combination with other treatment compound.

Pharmaceutical composition can be with mode administration easily, as by in part, intravenously, intraperitoneal, intramuscular, subcutaneous, the nose or the route of administration of intracutaneous etc.BioHNTP comes administration with the amount that treats and/or prevents concrete indication effectively.The amount and the dosage range that are applied to patient's BioHNTP will depend on many factors, as administering mode, person's to be treated healthiness condition and diagnostician's judgement.

In an example of the present invention, a kind of isolating polynucleotide are provided, its coding has the mature polypeptide of aminoacid sequence shown in the SEQ ID NO:2.These polynucleotide are to find from the cDNA library of people's fetal brain tissue, and the polynucleotide sequence total length is 2692 bases, its open reading frame (673-1332) 219 amino acid of having encoded.Find relatively that according to amino acid sequence homologous the neuron linear protein of this polypeptide and Homo sapiens has 58% homology, infer that thus the new people BioHNTP of the present invention has the similar 26S Proteasome Structure and Function of neuron linear protein gene family.

The cDNA of people BioHNTP provided by the present invention, oligonucleotide, polypeptide and antibody etc. have important value for diseases related, screening inhibitor or these diseases of pharmacological agent of the effect of neuron linear protein in research different tissues and the cell, the imbalance of diagnosis neuron linear protein.

In addition, because people BioHNTP albumen of the present invention has the natural acid sequence that is derived from the people, therefore, compare, estimate to have higher active and/or lower side effect (for example in the intravital immunogenicity of people lower or do not have) being applied to man-hour with the albumen of the same clan that derives from other species.

Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to people such as normal condition such as Sambrook, molecular cloning: laboratory manual (New York:Cold Spring Harbor Laboratory, Press, 1989) condition described in, or the condition of advising according to manufacturer.

The clone of embodiment 1:BioHNTP cDNA

Extract the total RNA of people's tire brain with guanidinium isothiocyanate/phenol/chloroform single stage method.From total RNA, separate poly (A) mRNA with Quick mRNA separating kit (Qiegene company product).2ug poly (A) mRNA forms cDNA through reverse transcription.CDNA fragment orientation is inserted on the multiple clone site of pBSK (+) carrier (Clontech company product) with Smart cDNA clone's test kit (purchasing white Clontech), transforms DH5 α bacterium and form the cDNA library.Measure the sequence of all clones' 5 ' and 3 ' end with dyestuff termination circulating reaction sequencing kit (Perkin-Elmer company product) and ABI377 automatic sequencing view (Perkin-Elmer company).CDNA sequence and the existing public dna sequence data storehouse (Genbank) measured are compared, and the cDNA sequence that found that one of them clone (0151f11) is new DNA.By synthetic a series of primers the contained insertion cDNA fragment of this clone is carried out two-way mensuration.The result shows, the contained full-length cDNA of 015f11 clone is 2692bp (shown in SEQ ID NO:1), from 673bp to 1332bp the open reading frame (ORF) of a 660bp, the new protein (shown in SEQ ID NO:2) of encoding arranged.This clone is named as pBS-0151f11, its encoded protein matter called after Novel Human Thread Protein (abbreviating " BioHNTP " as).

Embodiment 2:cDNA clone's homology retrieval

With the nucleotide sequence and the encoded protein sequence thereof of people BioHNTP gene of the present invention, with Blast program (Basiclocal Alignment search tool) [Altschul, SF et al.J.Mol.Biol.1990; 215:403-10], carry out the homology retrieval at databases such as Genbank, Swissport.The gene the highest with people BioHNTP dna homolog of the present invention is the gene of the neuron linear protein of a kind of known Homo sapiens, and its encoded protein number is AF010144 in the access of Genbank.The protein homology comparative result is shown in Fig. 1, both height homologies, and its homogeny is 58%; Similarity is 66%.This shows that novel polypeptide of the present invention has the 26S Proteasome Structure and Function of neuron linear protein.

Embodiment 3: with RT-PCR method clone BioHNTP gene

Total RNA is a template with fetus brain cell, is that primer carries out the synthetic cDNA of reverse transcription reaction with oligo-dT, with behind the test kit purifying of Qiagene, carries out pcr amplification with following primer:

Primer 1:5 '-GCTAAAATTCTTTCAGATAA-3 ' (SEQ ID NO.3)

Primer 2: 5 '-TATAAAAAATCATTTTATTC-3 ' (SEQ ID NO.4)

Primer l is corresponding to the forward sequence that begins of 1bp of the 5 ' end of SEQ ID NO:1; Primer 2 is corresponding to the end of 3 ' among SEQ ID NO:1 reverse sequence.

The condition of amplified reaction: in the reaction volume of 50 μ l, contain 50mmol/L KCl, 10mmol/L Tris-Cl, (pH8.5), 1.5mmol/L MgCl ₂, 200 μ mol/L dNTP, 10pmol primer, the Taq archaeal dna polymerase of 1U (Clontech company product).Go up by 25 cycles of following conditioned response at PE9600 type DNA thermal cycler (Perkin-Elmer company): 94 ℃ of 30sec; 55 ℃, 30sec; 72 ℃ of 2min.When RT-PCR, establish the blank negative contrast of positive contrast of beta-actin and template simultaneously.Amplified production is connected to (Invitrogen company product) on the pCR carrier with the test kit purifying of QIAGEN company with TA clone test kit.Dna sequence analysis is the result show, the 1-2692bp shown in the dna sequence dna of PCR product and the SEQID NO:1 is identical.

Embodiment 4:Northern blotting is analyzed the BioHNTP expression of gene:

Extract total RNA[Anal.Biochem 1987,162,156-159 with single stage method].This method comprises acid guanidine thiocyanate phenol-chloroform extracting.Promptly use 4M guanidinium isothiocyanate-25mM Trisodium Citrate, 0.2M sodium acetate (pH4.0) carries out homogenate to tissue, adds the phenol of 1 times of volume and the chloroform-primary isoamyl alcohol (49: 1) of 1/5 volume, and is centrifugal after mixing.The sucking-off aqueous phase layer adds Virahol (0.8 volume) and with the centrifugal RNA precipitation that obtains of mixture.With RNA precipitation 70% washing with alcohol that obtains, dry and soluble in water.

With 20 μ g RNA, on 1.2% sepharose that contains 20mM3-(N-morpholino) propanesulfonic acid (pH7.0)-5mM sodium acetate-lmM EDTA-2.2M formaldehyde, carry out electrophoresis.Be transferred on the nitrocellulose filter then.With α- ³²P dATP prepares by random priming ³²The dna probe of P-mark.Used dna probe is the BioHNTP coding region sequence (673bp to 1332bp) of the pcr amplification shown in the SEQ 1.Will ³²The probe of P-mark (about 2 * 10 ⁶Cpm/ml) spend the night in 42 ℃ of hybridization in solution with the nitrocellulose filter that has shifted RNA, this solution comprises 50% methane amide-25mM KH ₂PO ₄(pH7.4)-5 * SSC-5 * Denhardt ' s solution and 200 μ g/ml salmon sperm DNAs.After the hybridization, filter membrane is washed 30min in 55 ℃ in 1 * SSC-0.1%SDS.Then, analyze with quantitative with Phosphor Imager.

Embodiment 5: vivoexpression, separation and the purifying of reorganization BioHNTP

According to the coding region sequence (673-1332 position) of SEQ ID NO:l, design a pair of specificity amplification primer, sequence is as follows:

Primer 3:5 '-CCCGGATCCATGCTAGAGGAAGCAGTGTG-3 ' (SEQ ID No 5)

Primer 4:5 '-CCCGCGGCCGCCTAGCTATGCATAGCCCACT-3 ' (SEQ ID No 6)

5 ' end of these two sections primers contains BamH I and Not I restriction enzyme site respectively, be respectively the encoding sequence of target gene 5 ' end and 3 ' end thereafter, BamH I and Not I restriction enzyme site are corresponding to expression vector plasmid pET-28b (+) (Novagen company product, Cat.No.69865.3) the selectivity restriction enzyme site on.With the pBS-0151f11 plasmid that contains the total length goal gene is template, carries out the PCR reaction.The PCR reaction conditions is: contain pBS-0151f11 plasmid 10pg, primer 3 and primer 4 among the cumulative volume 50 μ l and be respectively 10pmmol, Advantage polymerase Mix (Clontech company product) 1 μ l.Loop parameter: 94 ℃ of 20s, 60 ℃ of 30s, 68 ℃ of 2min, totally 25 circulations.Respectively amplified production and plasmid pET-28 (+) are carried out double digestion with BamH I and Not I, reclaim big fragment respectively, and connect with the T4 ligase enzyme.Connect product and transform, after the dull and stereotyped overnight incubation of the LB that contains kantlex (final concentration 30 μ g/ml), use the colony polymerase chain reaction (PCR) method screening positive clone, and check order with the big enterobacterial DH5 of Calcium Chloride Method α.Select the correct positive colony of sequence (pET-0151f11) with Calcium Chloride Method with recombinant plasmid transformed e. coli bl21 (DE3) plySs (Novagen company product).In the LB liquid nutrient medium that contains kantlex (final concentration 30 μ g/ml), host bacterium BL21 (pET-0151f11) is cultured to logarithmic phase at 37 ℃, adds IPTG to final concentration lmmol/L, continues to cultivate 5 hours.Centrifugal collection thalline, through the broken bacterium of ultrasonic wave, centrifugal collection supernatant with carrying out chromatography with 6 Histidines (6His-Tag) bonded affinity column His.BindQuick Cartridge (Novagen company product), has obtained the target protein BioHNTP of purifying.Through the SDS-PAGE electrophoresis, obtain a single band at the 24kDa place.This band is transferred on the pvdf membrane carries out the n terminal amino acid sequential analysis with the Edams hydrolysis method, 15 amino acid of N-end hold 15 amino-acid residues identical with the N-shown in the SEQ ID NO:2 as a result.

Embodiment 6: anti-BioHNTP production of antibodies

With the synthetic specific polypeptide of following BioHNTP: the Met-Leu-Glu-Glu-Ala-Val-Trp-Gln-Thr-Asp-His-Glu-Val-Leu-Thr (SEQ ID NO:7) of Peptide synthesizer (PE company product).This polypeptide formed mixture with the coupling of hemocyanin and bovine serum albumin respectively, and method is referring to Avrameas, et al.Immunochemistry, 1969; 6:43.Add the complete Freund's adjuvant immunizing rabbit with the above-mentioned hemocyanin polypeptide complex of 4mg, add the incomplete Freund's adjuvant booster immunization once with the hemocyanin polypeptide complex again after 15 days.Employing is done the titre that ELISA measures antibody in the rabbit anteserum through the titer plate of 15 μ g/ml bovine serum albumin polypeptide complex bag quilts.From the rabbit anteserum of antibody positive, separate total IgG with albumin A-Sepharose.Polypeptide is incorporated on the Sepharose 4B post of cyanogen bromide-activated, from total IgG, separates anti-peptide antibody with affinity chromatography.Immuno-precipitation proof antibody purified can combine with BioHNTP specifically.

Embodiment 7: polynucleotide passage of the present invention is as the application of hybridization probe

Picking out suitable oligonucleotide fragment from polynucleotide of the present invention is of use in many ways as hybridization probe, as can whether containing polynucleotide sequence of the present invention and detect the homologous polynucleotide sequence to identify it with the healthy tissues of different sources or the genome or the hybridization of cDNA library of pathological tissue with this probe, whether further also available this probe in detecting polynucleotide sequence of the present invention or the expression of its homologous polynucleotide sequence in healthy tissues or pathological tissue cell be unusual.

The purpose of present embodiment is to pick out suitable oligonucleotide fragment as hybridization probe from polynucleotide SEQ ID NO:1 of the present invention, and identifies in some tissues whether contain polynucleotide sequence of the present invention or its homologous polynucleotide sequence with the filter hybridization method.The filter hybridization method comprises dot blotting, Southern blotting, Northern blotting and copy method etc., and they all are that polynucleotide sample to be measured is fixed on use essentially identical step crossover in back on the filter membrane.These identical steps are: the filter membrane of having fixed sample at first carries out prehybridization with the hybridization buffer that does not contain probe, so that nonspecific combining site suppressed by vector of sample and synthetic polymer institute are saturated on the filter membrane.Prehybridization solution is contained the hybridization buffer replacement of label probe then, and insulation makes probe and target nucleic acid hybridization.After the hybridization step, the probe in the hybridization is not removed by a series of film steps of washing.Present embodiment utilizes the film condition of washing (as than low salt concn and higher temperature) of higher-strength, so that hybrid context reduces and only keep the signal of high specificity.The probe that present embodiment is selected for use comprises two classes: first kind probe be fully with the identical or complementary oligonucleotide fragment of polynucleotide SEQ ID NO:1 of the present invention; The second class probe is part and the identical or complementary oligonucleotide fragment of polynucleotide SEQ ID NO:l of the present invention.Present embodiment selects for use dot blotting that sample is fixed on the filter membrane, higher-strength wash under the film condition, the hybridization specificity of first kind probe and sample is the strongest and kept.One, probe selects for use

From polynucleotide SEQ ID NO:1 of the present invention, select oligonucleotide fragment as hybridization probe, the several aspects that should follow following principle and need to consider: 1, the probe size preferable range is a 18-50 Nucleotide; 2, GC content is 30%-70%, and surpassing then, non-specific hybridization increases; 3, probe interior should not have complementary region; 4, what meet above condition can be used as the primary election probe, further do the computer sequential analysis then, comprise this primary election probe is carried out homology relatively with its source sequence area (being SEQ ID NO:1) and other known genome sequence and complementary district thereof respectively, if with the homology in non-target molecule zone greater than 85% or there are 15 continuous bases of surpassing identical, then this primary election probe is general just should not use; 5, whether the primary election probe finally is chosen to be the probe of actual application value also should further be determined by experiment.

Select and synthetic following two probes after finishing the analysis of above each side:

Probe 1 (probel) belongs to first kind probe, with complete homology of gene fragment or complementation (41Nt): the AAGAGAGAAAAGATGCTAGAGGAAGCAGTGTGGCAGACAGA of SEQ ID NO:1.

Probe 2 (probe2) belongs to the second class probe, is equivalent to gene fragment or its complementary segmental replacement mutant nucleotide sequence (41Nt): the GGCGAGCTGTTTATAGAGGCTGGAAGGATCTTGAGATGCTA of SEQ ID NO:1.

Other unlisted common agents and the compound method thereof relevant with following concrete experimental procedure please refer to document: DNAPROBES G.H.Keller; M.M.Manak; Stockton Press, 1989 (USA) and molecular cloning laboratory manual books more commonly used are as works such as " molecular cloning experiment guide " (second edition in 1998) [U.S.] Sa nurse Brooker, Science Press.

Specimen preparation: 1, from fresh or frozen tissue, extract DNA

Step: 1) the fresh or fresh people's fetal brain tissue that thaws is put into the plate that is immersed on ice and fills phosphate buffered saline buffer (PBS).With scissors or scalpel tissue is cut into small pieces.Should keep organizing moistening in the operation.2) with 1000g centrifugal chopper tissue 10 minutes.3) with cooled homogenate damping fluid (0.25mol/L sucrose; 25mmol/L Tris-HCl, pH7.5; 25mmol/LnaCl; 25mmol/L MgCl ₂) precipitation that suspends (approximately 10ml/g).4) 4 ℃ with electric homogenizer homogenate tissue suspension at full speed, until tissue by broken fully.5) 1000g is centrifugal 10 minutes.6) with re-suspended cell precipitation (the initial tissue sample of every 0.1g adds 1-5ml), centrifugal 10 minutes again with 1000g.7) with the resuspended precipitation of lysis buffer (the initial tissue sample of every 0.1g adds 1ml), connect following phenol extraction process then.2, the phenol extraction process of DNA

Step: 1) wash cell, centrifugal 10 minutes of 1000g with the cold PBS of 1-10ml.2) with the sedimentary cell (1 * 10 of cold cell pyrolysis liquid resuspension ⁸The minimum of applications 100ul lysis buffer of cell/ml).3) adding SDS is 1% to final concentration, if before re-suspended cell SDS is directly joined in the cell precipitation, cell may form big agglomerate and be difficult to fragmentation, and the overall yield that reduces.This point is in extracting＞10 ⁷Especially severe during cell.4) add Proteinase K to final concentration 200ug/ml.5) 50 ℃ of insulation reaction 1 hour or 37 ℃ gently jolting spend the night.6) use equal-volume phenol: chloroform: primary isoamyl alcohol (25: 24: 1) extracting, in little centrifuge tube centrifugal 10 minutes.Two corresponding clear separation, otherwise carry out centrifugal again.7) water is transferred to new pipe.8) use the equal-volume chloroform: primary isoamyl alcohol (24: 1) extracting, centrifugal 10 minutes.9) water that will contain DNA is transferred to new pipe.Carry out purifying and the ethanol sedimentation of DNA then.3, the purifying of DNA and ethanol sedimentation

Step: 1) 1/10 volume 2mol/L sodium-acetate and 2 times of cold 100% ethanol of volume are added in the dna solution mixing.-20 ℃ of placements 1 hour or to spending the night.2) centrifugal 10 minutes.3) careful sucking-off or pour out ethanol.4) with 70% cold ethanol 500ul washing precipitation, centrifugal 5 minutes.5) careful sucking-off or pour out ethanol.With the cold washing with alcohol precipitation of 500ul, centrifugal 5 minutes.6) careful sucking-off or pour out ethanol is inverted on thieving paper then residual ethanol is flow to end.Dry air 10-15 minute, so that the volatilization of surperficial ethanol.Note not making the precipitation complete drying, otherwise dissolve again than difficulty.7) with small volume TE or the resuspended DNA precipitation of water.The low speed vortex vibrates or uses the dropper pressure-vaccum, increases TE gradually simultaneously, is mixed to DNA and fully dissolves, every 1-5 * 10 ⁶Cell extracted approximately adds 1ul.

Below the 8-13 step only be used for must removing when depolluting, otherwise can directly carry out the 14th step.8) RNA enzyme A is added in the dna solution, final concentration is 100ug/ml, and 37 ℃ are incubated 30 minutes.9) add SDS and Proteinase K, final concentration is respectively 0.5% and 100ug/ml.37 ℃ are incubated 30 minutes.10) use isopyknic phenol: chloroform: primary isoamyl alcohol (25: 24: 1) extractive reaction liquid, centrifugal 10 minutes.11) carefully shift out water, use isopyknic chloroform: primary isoamyl alcohol (24: 1) extracting again, centrifugal 10 minutes.12) carefully shift out water, add 1/10 volume 2mol/L sodium-acetate and the cold ethanol of 2.5 volumes, mixing put-20 ℃ 1 hour.13) with 70% ethanol and 100% washing with alcohol precipitation, dry air, resuspended nucleic acid, process is with the 3-6 step.14) measure A ₂₆₀And A ₂₈₀To detect purity and the productive rate of DNA.15) deposit in-20 ℃ after the packing.The preparation of sample film:

1) get 4 * 2 suitably nitrocellulose filters (NC film) of size, mark point sample position and sample number thereon gently with pencil, each probe needs two NC films, so that wash film with high strength condition and strength condition respectively in the experimental procedure of back.

2) draw and contrast respectively 15 microlitres, put on the sample film, dry at room temperature.

3) place infiltration that 0.1mol/LNaOH is arranged, last 5 minute of filter paper (twice) of 1.5mol/LNaCl, drying to place to soak into has 0.5mol/L Tris-HCl (pH7.0), last 5 minute of filter paper (twice) of 3mol/LNaCl, dries.

4) be sandwiched in the clean filter paper, wrap, 60-80 ℃ of vacuum-drying 2 hours with aluminium foil.

The mark of probe

1) 3 μ lProbe (0.1OD/10 μ l) add 2 μ lKinase damping fluids, 8-10uCi γ- ³²P-dATP+2U Kinase is to add to final volume 20 μ l.

2) 37 ℃ are incubated 2 hours.

3) add the tetrabromophenol sulfonphthalein indicator (BPB) of 1/5 volume.

4) cross Sephadex G-50 post.

5) to having ³²Before washing out, P-Probe begins to collect first peak (available Monitor monitoring).

6) 5/pipe, collect the 10-15 pipe.

7) monitor isotopic weight with liquid glimmer instrument

8) merge and to be required preparation behind the collection liquid of first peak ³²P-Probe (second peak for free γ- ³²P-dATP).

Prehybridization

The sample film is placed plastics bag, add 3-10mg prehybridization solution (10 * Denhardt ＇ s; 6 * SSC, 0.1mg/ml CT DNA (calf thymus DNA).), seal sack after, 68 ℃ of water-baths were shaken 2 hours.

Hybridization

Plastics bag is cut off one jiao, adds the probe prepare, seal sack after, 42 ℃ of water-baths are shaken and are spent the night.

Wash film: high strength is washed film:

1) good sample film has been hybridized in taking-up.

2) 2 * SSC among the 0.1%SDS, washes 15 minutes (2 times) for 40 ℃.

3) 0.1 * SSC among the 0.1%SDS, washes 15 minutes (2 times) for 40 ℃.

4) 0.1 * SSC among the 0.1%SDS, washes 30 minutes (2 times) for 55 ℃, and room temperature is dried.Low strength is washed film:

1) good sample film has been hybridized in taking-up.

2) 2 * SSC among the 0.1%SDS, washes 15 minutes (2 times) for 37 ℃.

3) 0.1 * SSC among the 0.1%SDS, washes 15 minutes (2 times) for 37 ℃.

4) 0.1 * SSC among the 0.1%SDS, washes 15 minutes (2 times) for 40 ℃, and room temperature is dried.X-light autography :-70 ℃, X-light autography (the compressing tablet time decides according to hybridization spot radioactivity is strong and weak).

Experimental result:

Adopt low strength to wash the hybrid experiment that the film condition is carried out, more than four strong and weak not obviously differences of probe hybridization spot radioactivity; And adopting low strength to wash the hybrid experiment that the film condition is carried out, the hybridization spot radioactive intensity of probe 1 obviously is better than the radioactive intensity of other three probe hybridization spots.Thereby available probe 1 is qualitative and analyze existence and the differential expression of polynucleotide of the present invention in different tissues quantitatively.

All quote in this application as a reference at all documents that the present invention mentions, just quoted as a reference separately as each piece document.Should be understood that in addition those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims institute restricted portion equally.

Sequence table (1) general information:

(ⅰ) denomination of invention: new Novel Human Thread Protein and encoding sequence thereof

(ⅱ) sequence number: the information of 7 (2) SEQ ID NO:1:

(ⅰ) sequence signature:

(A) length: 2692bp

(B) type: nucleic acid

(C) chain: two strands

(D) topological framework: linearity

(ⅱ) molecule type: cDNA

( ⅲ ) ：SEQ ID NO:1： 1 GCTAAAATTCTTTCAGATAATTTTTTTCTTGTTGAAGCTGTGGGATATAATCAATGATGC 61 CAAGCTGTCTGAGAATTTTATAGAATAATATCCAAATATATTGATCCTGCCTCTTTCTGC 121 TTCTATGTAATTAAACTTTCTTTTGATGTTTATTTTTAAAATGTATGCTTCACACAACAC 181 CAATAAACATCTAAGAGATGTGATATAATCCAAGGCAAAGAAAAGTAAGAATCAGTTAAT 241 GTCTATTTTATCTGCACAGCATTACGAACAGAAAATTGTAATAAAAAAAGGTTTAACCAA 301 ACTGAAAAAAAGAGAGACAAAATCTTGGTTTTAATTTGAAAAGATGATTGGGAGTGATCT 361 CAGAAGAGAGTTCAGCAGGAAGCAAGGAAGAGGCTGTTGACCTTGAGTGCAGCCTCAAGA 421 ATGGAACCTTTTTGAAATATTTTAAAGGAAATATCTTGTCATCCAGCTGTTATGGTTAAT 481 AATGAATAGTTTTCTCTGGGTGAAGCTTATCCATCGCACACCTGATGTGCTGGCCCCTGC 541 GATTTCCCCAAATGTTGGAATGTTGCCTGCATAATTTGTGGTAATGGGGGACTGTGTTCC 601 TGCTTTTACCTGGTTACAAAAAACAAAACAAAACAAAACAAAACAACAAACAGAAAAAAA 661 AAGAGAGAAAAGATGCTAGAGGAAGCAGTGTGGCAGACAGATCATGAGGTGCTGACGGAG 721 AGAACAGAGTGGTACCTGTTTACCCACTTGGACCATGACAGTATCAAGGCTCCACCCCTT 781 GCTGTCCCTTCCCAAGAGGTGCTCTCCTGGGAGTTTGATCACAGTGAAACAACACTCCCG 841 TTTTCTTTTTCCTTTCTTTCTTTCTTTCTTTTTTTCTTTTTTTTTTTTTTTTTTGTTGAG 901 ACAGAGTTTTTTGCTCTTGTTGCCCAGGCTGGAGTGCAATGGCGTGATCTCGGCTCACCG 961 CAACCTCCGCCTCCCAGGTTCAAGCGATTCTCGTGCCTCAGCCTCTGGAGTAGCTGGGAT1021 TACAGGCATGCGCCACCACACCCGGCTAATTTTGTACTTTTAGTAGAGATGGGGTTTCTC1081 CATATTGGTCAGGCTGGTCCCGAACTCCTGACCTCAGGTGATCTGCCCGCCTCAGCCTCC1141 CAAAGTGCTGGGATTACAGGCATAAGCCACCGAGCCCAGCCCCACACTCCTGTTTTCATA1201 GCCCTTTTTTGTCTGTACTTTGGTACATATTCCCCAAATAAGATTATTATTTACATCTGT1261 CATGATGAGGCAGTGATAGCAGCAAGTGTCACTTTGACCCTCACCCTTGGAAAGTGGGCT1321 ATGCATAGCTAGAGTTAGAACAGGAGGTTCTAACCCTGCTTCCACAATTACTTCAGTAAC1381 AGGCTTTTGTATCCATGATTACTTAAGCTGACTTAGATGCATTTTCTACCCTGTATTCTA1441 GTGTACACAACACAAACACACATAAGCCCTTTACCTGTGGAGAAGAGGGAGATGGTTGAT1501 TCAGTGGGAGTGGGGAGTGGCAGAGGGTGCCTTAACTTTTTCTGGCTTGACCCCTACTTC1561 CTTATGTGTTTCCTTCATATACCTCTGTCACTTTAGAGATGTAATCATGTCTGTTCCAAG1621 TTGTATCGTTATTATCAAGAAGTCCTATAAATGTAGCAAATGTGACTATTTTATAGAAAT1681 GCACAATAGTTTATAGGCCTTGGAGAAGTCTGATAATAGTATGTAAATATCCTTCATTGA1741 AGTCATAGAACCTTCTAGTAGGAAGCTCCATAGGTGATAACTGCAAGAGGATTAATGTTT1801 GTTTCTCCAGTAAACACCGGAAGCAAGGAATCAATCTGTCACTGTTTATCATTCAGTCTT1861 GAGCACCGTTGGGTGTTGATAGGTTACTATAGACACTCCCCTTATAATTAATATACAGGA1921 CTCACAATTTAGGATGTCTGATGGCCACTAGGGTACATCATAGAGACACTAGAGAGAAGA1981 GAACAAATATAGCTCCATCAAAAAGCCTGCTTAATCTTTAACAAGTCTGAAATATTACTA2041 AAATTCCAGTTACCGTGCAGCATAGTCAGTCTAAAAAGCACTGGGGAAAAAGGTGCCTTT2101 TTGGTCTCTTTAATTCTATTATGGCACATTTTAATATTATTCCACATGTGTGCAAACTAT2161 TTCTCAAGAGCAAAGTTTGAGGCTGGAGTTAAGAAAATAGAAAAATTAAAACATTATTTT2221 TTCTCATATAATATAATCTGACTACTAGTTCATGGATATAATAATTCTGGGAAAAATTTT2281 AGATTAAACTATAAAATTGAAATCACCTTTGAAGAGTATATGGAATTGCTTCTTTCTATT2341 AAAGCCAACCTACATTGGCAAAAAGTGTGGAGAAAATCAGTGTGCTCAATTCTTTTTGTA2401 GAGTTTCATCTAAAATGTTGCAGGTAAAAAAGAAAACTTTAATTGGTACTTTCTACGGTG2461 TGATTAGAAAAATTAGTATCTATCTCTGTTGGTTCTGCTGACTTGCTTCTTTCCACCGAA2521 TCTAAATGCAATGTCATAGGAGGAGGTTTGCTGTAAAAACATGTCTTTTTCTTTGGTGTA2581 TTCATTGTAATTATGGCTGGCAGTGAGAAGGTTCGGTAAGTCTCAATTTCTCTACCTCCT2641 TTACTTGGAGAAAATTTGTAAATGTACCCTGTGAATAAAATGATTTTTTATA ( 2 ) SEQ ID NO:2：

(ⅰ) sequence signature:

(A) length: 219 amino acid

(B) type: amino acid

(D) topological framework: linearity

(ⅱ) molecule type: polypeptide

( ⅲ ) : SEQ ID NO:2: 1 Met Leu Glu Glu Ala Val Trp Gln Thr Asp His Glu Val Leu Thr 16 Glu Arg Thr Glu Trp Tyr Leu Phe Thr His Leu Asp His Asp Ser 31 Ile Lys Ala Pro Pro Leu Ala Val Pro Ser Gln Glu Vay Leu Ser 46 Trp Glu Phe Asp His Ser Glu Thr Thr Leu Pro Phe Ser Phe Ser 61 Phe Leu Ser Phe Phe Leu Phe Phe Phe Phe Phe Phe Phe Phe Val 76 Glu Thr Glu Phe Phe Ala Leu Val Ala Gln Ala Gly Val Gln Trp 91 Arg Asp Leu Gly Ser Pro Gln Pro Pro Pro Pro Arg Phe Lys Arg106 Phe Ser Cys Leu Ser Leu Trp Ser Ser Trp Asp Tyr Arg His Ala121 Pro Pro His Pro Ala Asn Phe Val Leu Leu Val Glu Met Gly Phe136 Leu His Ile Gly Gln Ala Gly Pro Glu Leu Leu Thr Ser Gly Asp151 Leu Pro Ala Ser Ala Ser Gln Ser Ala Gly Ile Thr Gly Ile Ser166 His Arg Ala Gln Pro His Thr Pro Val Phe Ile Ala Leu Phe Cys181 Leu Tyr Phe Gly Thr Tyr Ser Pro Asn Lys Ile Ile Ile Tyr Ile196 Cys His Asp Glu Ala Val Ile Ala Ala Ser Val Thr Leu Thr Leu211 Thr Leu Gly Lys Trp Ala Met His Ser ( 2 ) SEQ ID NO:3

(ⅰ) sequence signature

(A) length: 20 bases

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ⅱ) molecule type: oligonucleotide

(ⅲ) sequence description: the information of SEQ ID NO:3:GCTAAAATTCTTTCAGATAA 20 (2) SEQ ID NO:4

(ⅰ) sequence signature

(A) length: 20 bases

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ⅱ) molecule type: oligonucleotide

(ⅲ) sequence description: the information of SEQ ID NO:4:TATAAAAAATCATTTTATTC 20 (2) SEQ ID NO:5

(ⅰ) sequence signature

(A) length: 29 bases

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ⅱ) molecule type: oligonucleotide

(ⅲ) sequence description: the information of SEQ ID NO:5:CCCGGATCCATGCTAGAGGAAGCAGTGTG 29 (2) SEQ ID NO:6

(ⅰ) sequence signature

(A) length: 31 bases

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ⅱ) molecule type: oligonucleotide

(ⅲ) sequence description: the information of SEQ ID NO:6:CCCGCGGCCGCCTAGCTATGCATAGCCCACT 31 (2) SEQ ID NO:7:

(ⅰ) sequence signature:

(A) length: 15 amino acid

(B) type: amino acid

(D) topological framework: linearity

(ⅱ) molecule type: polypeptide

(ⅲ) sequence description: SEQ ID NO:7:Met-Leu-Glu-Glu-Ala-Val-Trp-Gln-Thr-Asp-His-Glu-Val-Leu-Thr 15

Claims (18)

1, a kind of isolating people BioHNTP polypeptide is characterized in that it comprises: have the polypeptide of the aminoacid sequence shown in the SEQ ID NO.2 or fragment, analogue or the derivative of its polypeptide.

2, polypeptide as claimed in claim 1 is characterized in that, it is that polypeptide or its amino acid variation with the aminoacid sequence shown in the SEQ ID NO.2 are no more than 5% derivative.

3, polypeptide as claimed in claim 2 is characterized in that, it is the polypeptide with the aminoacid sequence shown in the SEQ ID NO.2.

4, a kind of isolating polynucleotide is characterized in that, described polynucleotide are to be selected from down group:

(a) coding has the polynucleotide of the polypeptide of aminoacid sequence shown in the SEQ ID NO.2 or its fragment, analogue, derivative;

(b) with polynucleotide (a) complementary polynucleotide;

(c) with (a) or the polynucleotide of at least 70% homogeny (b) are arranged.

5, polynucleotide as claimed in claim 4 is characterized in that, described polynucleotide are polynucleotide that coding has aminoacid sequence shown in the SEQ ID NO.2.

6, polynucleotide as claimed in claim 4 is characterized in that, the sequence of described polynucleotide is the sequences that have the sequence of 673-1332 position among the SEQ IDNO.1 or have 1-2692 position among the SEQ ID NO.1.

7, a kind of recombinant vectors that contains exogenous polynucleotide is characterized in that, it is the recombinant vectors that is formed by the described polynucleotide of claim 4 and plasmid, virus or expression vector establishment.

8, a kind of genetically engineered host cell that contains exogenous polynucleotide is characterized in that, it is to be selected from following a kind of host cell:

(a) host cell that transforms or transduce with the described recombinant vectors of claim 7;

(b) host cell that transforms or transduce with the described polynucleotide of claim 4.

9, a kind of preparation method with the active polypeptide of BioHNTP is characterized in that, described method comprises:

(a) being fit to express under the BioHNTP condition, cultivate the described through engineering approaches host cell of claim 8;

(b) from culture, isolate and have the active polypeptide of BioHNTP.

10, a kind of can with polypeptide bonded antibody, it is characterized in that, described antibody be can with BioHNTP specificity bonded antibody.

11, the compound of an analoglike or adjusting polypeptide active or expression, it is characterized in that it is the active compound of simulation BioHNTP, or promote the active compound of BioHNTP, or the active compound of antagonism BioHNTP, or the active compound of inhibition BioHNTP.

12, compound as claimed in claim 11 is characterized in that, it is the polynucleotide sequence shown in the SEQ ID NO.1 or its segmental antisense sequences.

13, the described application of compound of a kind of claim 11 is characterized in that, described compound be used to regulate BioHNTP in vivo, the method for external activity.

14, a kind of disease relevant with the described BioHNTP polypeptide of claim 1 or method of disease susceptibility of detecting is characterized in that, is to detect the relevant disease or the susceptibility of disease by the method that is selected from down group:

Whether (a) detect described expression of polypeptides amount indirectly or directly unusual;

Whether (b) detect described polypeptide active indirectly or directly unusual;

(c) directly or indirectly detect and cause described expression of polypeptides amount or active unusual nucleotide diversity in the polynucleotide.

15, the application of polypeptide according to claim 1 is characterized in that, it is applied to screen stand-in, agonist, antagonist or the inhibitor of BioHNTP; Perhaps be used for the peptide finger print identification.

16, the application of nucleic acid molecule as claimed in claim 4 is characterized in that, it is used for nucleic acid amplification reaction as primer, perhaps is used for hybridization as probe, perhaps is used to make gene chip or microarray.

17, a kind of pharmaceutical composition is characterized in that, it contains the described polypeptide of claim 1 and/or the described polynucleotide of claim 4 and the pharmaceutically acceptable carrier of safe and effective amount.

18, the application of polypeptide as claimed in claim 1 is characterized in that, is used for the treatment of the medicine of diseases such as senile dementia, Down's syndrome, nervous system neoplasm, immunologic derangement, cancer with described polypeptide preparation.

Images