CN1303944A

CN1303944A - Novel polypeptide-threonine synthetase 71 and polynucleotide coding said polypeptide

Info

Publication number: CN1303944A
Application number: CN 99119868
Authority: CN
Inventors: 毛裕民; 谢毅
Original assignee: BORONG GENE DEVELOPMENT CO LTD SHANGHAI
Current assignee: BORONG GENE DEVELOPMENT CO LTD SHANGHAI
Priority date: 1999-10-27
Filing date: 1999-10-27
Publication date: 2001-07-18
Also published as: AU1378501A; WO2001031024A1

Abstract

The present invention discloses a novel polypeptide threonine synthetae 71, polynucleotide coding said polypeptide and its method for producing said polypeptide by using DNA recombination technology. Said invention also discloses the method using said polypeptide to cure several disease, such as malignant tumor, blood disease, HIV infection, immunological disease and various inflammations. Said invention also discloses an antagonist resisting said polypeptide and its therapeutic effect, and also discloses the application of polynucleotide for coding this novel threonine sythetase 71.

Description

The polynucleotide of a kind of new polypeptide---threonine synthetase 71 and this peptide species of coding

The invention belongs to biological technical field, specifically, the invention describes a kind of new polypeptide---threonine synthetase 71, and the polynucleotide sequence of this polypeptide of encoding.The invention still further relates to the preparation method and the application of these polynucleotide and polypeptide.

Branch road route of synthesis from the aspartic acid to the Threonine comprises 5 steps, needs the catalysis of 3 kinds of enzymes.Wherein, threonine synthetase catalysis final step is about to O-phosphoric acid-L-homoserine and is transported to Threonine and inorganic phosphorus.

This enzyme is that a kind of 5 '-pyridoxal phosphate relies on enzyme, it comprises a complete open reading frame (428 passwords of encoding) that contains 1542 nucleic acids, two parts are read frame (reading frame that is positioned at the 630bp after the 273bp of initiation codon upstream, another is the reading frame that is positioned at termination codon downstream 84bp 277bp afterwards) (Regula Altmann-Johl.Peter Philippsen1996 Mol Gen Genet250:69-80).There are TATA box and GCN4 protein binding site at 5 ' non-coding region.The GCN4 protein binding site is a bit of the tumor-necrosis factor glycoproteins 5 '-TGACTC-3 ' of 5 ' non-coding region, and this albumen is that the amino acid synthetic is generally regulated albumen.At 21bp place, termination codon downstream, a dyad symmetry zone of being rich in GC is arranged.When transcribing, this zone can form a stable stem district and Lu puff secondary structure.This structure has the advantages that not rely on the rho factor termination site, and may be to be positioned at the terminator that the operon end is transcribed.Also may there be transcription termination signal in some zones of satisfying following condition: the zone of being rich in AT that 1) is positioned at the Transcription Termination zone; 2) relevant with CAATCAA, 3) dyad symmetry district is positioned at before this zone.

The cistron zone of threonine synthetase is made up of a segment length dyad symmetry sequence.This zone may be the termination site of transcribing or in advance the site (Rosenberg, M.andCourt, D.1979Ann.Rev.Genet.13,319-353)

Always there are some palindrome unit near zone near the threonine synthetase gene.The open reading frame that 127 codons of a coding are arranged in these palindrome unit, (1048 bp-669 bp) this reading direction of reading frame is opposite with the direction of threonine operon.(Higgins,C.F.,Ferro-Luzzi?A?mes,G.,Barnes,W.M.,Clement,J.M.,Clement,J.,.and?Hofnung,M1982Nature298,760-762)

Threonine synthetase comprises a conservative pyridoxal phosphate site, and the Sequence of Primitive Elements in this site is [DE]-X-[STVG]-X-[AS]-[FYI]-K-[DLISA]-[RVMF]-[GA]-[LIVMGA].(Parsot?C1986EMBO?J5:3013-3019)

The inventor's polypeptide and threonine synthetase have high homology.So called after threonine synthetase 71, and infer that it has similar biological function.

An object of the present invention is to provide isolating new polypeptide---threonine synthetase 71 with and fragment, analogue and derivative.

Another object of the present invention provides the polynucleotide of this polypeptide of coding.

Another object of the present invention provides the recombinant vectors of the polynucleotide that contain the threonine synthetase 71 of encoding.

Another object of the present invention provides the genetically engineered host cell of the polynucleotide that contain the threonine synthetase 71 of encoding.

Another object of the present invention provides the method for producing threonine synthetase 71.

Another object of the present invention provides at polypeptide of the present invention---the antibody of threonine synthetase 71.

Another object of the present invention has provided at polypeptide of the present invention---the simulated compound of threonine synthetase 71, antagonist, agonist, inhibitor.

Another object of the present invention provides the method for the unusual relevant disease of diagnoses and treatment and threonine synthetase 71.

In a first aspect of the present invention, novel isolated threonine synthetase 71 is provided, this polypeptide is the people source, and it comprises: have the polypeptide of SEQ ID NO:2 aminoacid sequence or its conservative property variation polypeptide or its active fragments or its reactive derivative, analogue.Preferably, this polypeptide is the polypeptide with SEQ ID NO:2 aminoacid sequence.

In a second aspect of the present invention, the polynucleotide of isolating these polypeptide of coding are provided, these polynucleotide comprise a nucleotide sequence, and this nucleotide sequence is shown at least 70% homogeny with a kind of nucleotides sequence that is selected from down group: (a) polynucleotide of the above-mentioned threonine synthetase 71 of coding; (b) with polynucleotide (a) complementary polynucleotide.Preferably, this polynucleotide encoding has the polypeptide of aminoacid sequence shown in the SEQ ID NO:2.More preferably, the sequence of these polynucleotide is be selected from down group a kind of: the sequence that (a) has 64-2007 position among the SEQ ID NO:1; (b) has the sequence of 1-2066 position among the SEQ ID NO:1.

In a third aspect of the present invention, the carrier that contains above-mentioned polynucleotide is provided, and has been transformed or host cell of transduceing or the host cell that is directly transformed or transduce by above-mentioned polynucleotide by this carrier.

Others of the present invention are because disclosing of the technology of this paper is conspicuous to those skilled in the art.

As used herein, " isolating " are meant that material separates (if natural substance, primal environment promptly is a natural surroundings) from its primal environment.Do not have separation and purification as polynucleotide under the native state in the active somatic cell and polypeptide, but same polynucleotide or polypeptide as from native state with in other materials that exist separately, then for separation and purification.

As used herein, " isolating threonine synthetase 71 " is meant that threonine synthetase 71 is substantially free of natural relative other albumen, lipid, carbohydrate or other material.Those skilled in the art can use the purified technology of protein purifying threonine synthetase 71 of standard.Basically pure polypeptide can produce single master tape on non-reduced polyacrylamide gel.The purity of threonine synthetase 71 polypeptide can be used amino acid sequence analysis.

The invention provides a kind of new polypeptide---threonine synthetase 71, it is made up of the aminoacid sequence shown in the SEQ ID NO:2 basically.Polypeptide of the present invention can be recombinant polypeptide, natural polypeptides, synthetic polypeptide, preferred recombinant polypeptide.Polypeptide of the present invention can be the product of natural purifying, or the product of chemosynthesis, or uses recombinant technology to produce from protokaryon or eucaryon host (for example, bacterium, yeast, higher plant, insect and mammalian cell).The host used according to the recombinant production scheme, polypeptide of the present invention can be glycosylated, maybe can be nonglycosylated.Polypeptide of the present invention also can comprise or not comprise initial methionine residues.

The present invention also comprises fragment, derivative and the analogue of threonine synthetase 71.As used herein, term " fragment ", " derivative " and " analogue " are meant biological function or the active polypeptide that keeps threonine synthetase of the present invention 71 identical basically.The fragment of polypeptide of the present invention, derivative or analogue can be: (I) is a kind of like this, wherein one or more amino-acid residues are replaced by conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the amino acid that replaces can be also can not encoded by genetic codon; Perhaps (II) is a kind of like this, and certain group on wherein one or more amino-acid residues is replaced by other group and comprises substituting group; Perhaps (III) is a kind of like this, and wherein mature polypeptide and another kind of compound (such as the compound that prolongs the polypeptide transformation period, for example polyoxyethylene glycol) merge; Perhaps (IV) is a kind of like this, wherein additional aminoacid sequence is integrated into mature polypeptide and the peptide sequence that forms (as leader sequence or secretion sequence or be used for the sequence or the proteinogen sequence of this polypeptide of purifying) by the elaboration of this paper, such fragment, derivative and analogue are considered within those skilled in the art's ken.

The invention provides isolating nucleic acid (polynucleotide), substantially the polynucleotide that have a polypeptide of SEQ ID NO:2 aminoacid sequence by coding are formed.Polynucleotide sequence of the present invention comprises the nucleotide sequence of SEQ ID NO:1.Polynucleotide of the present invention are to find from the cDNA library of people's fetal brain tissue.The polynucleotide sequence total length that it comprises is 2066 bases, its open reading frame (64--2007) 647 amino acid of having encoded.Find relatively that according to amino acid sequence homologous the threonine synthetase of this polypeptide and spirobacteria has 36% homology, deducibility goes out the similar 26S Proteasome Structure and Function of threonine synthetase that this threonine synthetase 71 has spirobacteria.

Polynucleotide of the present invention can be dna form or rna form.Dna form comprises the DNA of cDNA, genomic dna or synthetic.DNA can be strand or double-stranded.DNA can be coding strand or noncoding strand.The coding region sequence of encoding mature polypeptide can be identical with the coding region sequence shown in the SEQ ID NO:1 or the varient of degeneracy.As used herein, " varient of degeneracy " are meant that in the present invention coding has protein or the polypeptide of SEQ ID NO:2, but with the differentiated nucleotide sequence of coding region sequence shown in the SEQ ID NO:1.

The polynucleotide of the mature polypeptide of coding SEQ ID NO:2 comprise: the encoding sequence that has only mature polypeptide; The encoding sequence of mature polypeptide and various additional code sequence; Encoding sequence of mature polypeptide (with optional additional code sequence) and non-coding sequence.

Term " polynucleotide of coded polypeptide " is meant polynucleotide that comprise this polypeptide of encoding and the polynucleotide that comprise additional code and/or non-coding sequence.

The invention still further relates to the varient of foregoing description polynucleotide, its coding has the polypeptide of identical aminoacid sequence or segment, analogue and the derivative of polypeptide with the present invention.The varient of these polynucleotide can be the allelic variant of natural generation or the varient that non-natural takes place.These nucleotide diversity bodies comprise and replace varient, deletion mutation body and insert varient.As known in the art, allelic variant is the replacement form of polynucleotide, and it may be replacement, disappearance or the insertion of one or more Nucleotide, but can be from not changing the function of its encoded polypeptides in fact.

The invention still further relates to and the polynucleotide (have at least 50% between two sequences, preferably have 70% homogeny) of sequence hybridization described above.The present invention be more particularly directed under stringent condition and the interfertile polynucleotide of polynucleotide of the present invention.In the present invention, " stringent condition " is meant: (1) than hybridization under low ionic strength and the comparatively high temps and wash-out, as 0.2 * SSC, and 0.1%SDS, 60 ℃; Or (2) hybridization the time adds and to use denaturing agent, as 50% (v/v) methane amide, 0.1% calf serum/0.1%Ficoll, 42 ℃ etc.; Or (3) only at the homogeny between the two sequences at least more than 95%, be more preferably 97% and just hybridize when above.And the polypeptide of interfertile polynucleotide encoding has identical biological function and activity with the mature polypeptide shown in the SEQ ID NO:2.

The invention still further relates to nucleic acid fragment with sequence hybridization described above.As used herein, " nucleic acid fragment " length contain 10 Nucleotide at least, better be 20-30 Nucleotide at least, be more preferably 50-60 Nucleotide at least, preferably more than at least 100 Nucleotide.Nucleic acid fragment also can be used for the amplification technique (as PCR) of nucleic acid to determine and/or to separate the polynucleotide of coding threonine synthetase 71.

Polypeptide among the present invention and polynucleotide preferably provide with isolating form, more preferably are purified to homogeneous.

The special polynucleotide sequence of coding threonine synthetase 71 of the present invention can obtain with several different methods.For example, separate polynucleotide with hybridization technique well known in the art.These technology including, but not limited to: 1) with probe and genome or the hybridization of cDNA library to detect homologous polynucleotide sequence and 2) antibody screening of expression library to be to detect the polynucleotide passage of the clone with common structure feature.

Sequence dna fragment of the present invention also can obtain with following method: 1) separate double chain DNA sequence from genomic dna; 2) the chemical synthesising DNA sequence is to obtain the double-stranded DNA of described polypeptide.

In the above-mentioned method of mentioning, isolation of genomic DNA is least commonly used.The direct chemical of dna sequence dna is synthetic to be the method for often selecting for use.The more frequent method of selecting for use is the separation of cDNA sequence.The standard method that separates interested cDNA is from the donorcells separating mRNA of this gene of high expression level and carries out reverse transcription, forms plasmid or phage cDNA library.Extract the existing multiple proven technique of method of mRNA, test kit also can obtain (Qiagene) from commercial channels.And the construction cDNA library also is usual method (Sambrook, et al., MolecularCloning, A Laboratory Manual, Cold Spring Harbor Laboratory.New York, 1989).Also can obtain the cDNA library of commercial offers, as the different cDNA library of Clontech company.When being used in combination the polymeric enzyme reaction technology, even few expression product also can be cloned.

Available ordinary method is screened gene of the present invention from these cDNA libraries.These methods include, but is not limited to: (1) DNA-DNA or DNA-RNA hybridization; (2) appearance of marker gene function or forfeiture; (3) level of the transcript of mensuration threonine synthetase 71; (4), detect the protein product of genetic expression by immunological technique or mensuration biologic activity.Aforesaid method can singly be used, but also several different methods combined utilization.

In (1) kind method, hybridizing used probe is and any a part of homology of polynucleotide of the present invention that at least 10 Nucleotide of its length better are at least 30 Nucleotide, are more preferably at least 50 Nucleotide, preferably at least 100 Nucleotide.In addition, within 2000 Nucleotide, preferable is within 1000 Nucleotide to the length of probe usually.Probe used herein is the dna sequence dna of chemosynthesis on the basis of gene order information of the present invention normally.Gene of the present invention itself or fragment are certainly as probe.The mark of dna probe can be used radio isotope, fluorescein or enzyme (as alkaline phosphatase) etc.

In (4) kind method, detect the protein product of threonine synthetase 71 genetic expressions and can use immunological technique such as Western blotting, radioimmunoprecipitation, enzyme-linked immunosorbent assay (ELISA) etc.

Use method (Saiki, the et al.Science1985 of round pcr DNA amplification/RNA; 230:1350-1354) be optimized for acquisition gene of the present invention.When particularly being difficult to from the library, obtain the cDNA of total length, can preferably use RACE method (the terminal rapid amplifying method of RACE-cDNA), the primer that is used for PCR can suitably be selected according to polynucleotide sequence information of the present invention disclosed herein, and available ordinary method is synthetic.Available ordinary method is as the DNA/RNA fragment by gel electrophoresis separation and purifying amplification.

The gene of the present invention that obtains as mentioned above, perhaps the polynucleotide sequence of various dna fragmentations etc. can with ordinary method such as dideoxy chain termination (Sanger et al.PNAS, 1977,74:5463-5467) measure.This class polynucleotide sequence is measured also available commercial sequencing kit etc.In order to obtain the cDNA sequence of total length, order-checking need be carried out repeatedly.Sometimes need to measure a plurality of clones' cDNA sequence, just can be spliced into the cDNA sequence of total length.

The present invention also relates to comprise the carrier of polynucleotide of the present invention, and with carrier of the present invention or directly with the host cell of threonine synthetase 71 encoding sequences through the genetically engineered generation, and the method that produces polypeptide of the present invention through recombinant technology.

Among the present invention, the polynucleotide sequence of coding threonine synthetase 71 can be inserted in the carrier, contains the recombinant vectors of polynucleotide of the present invention with formation.Term " carrier " refers to that bacterial plasmid well known in the art, phage, yeast plasmid, vegetable cell virus, mammalian cell virus are as adenovirus, retrovirus or other carrier.The carrier of Shi Yonging includes but not limited in the present invention: and the expression vector based on the T7 promotor of in bacterium, expressing (Rosenberg, et al.Gene, 1987,71:125); The pMSXND expression vector of in mammalian cell, expressing (Lee and Nathans, J Bio Chem.263:3521,1988) and at the carrier that derives from baculovirus of expressed in insect cells.In a word, as long as can duplicate in host and stablize, any plasmid and carrier may be used to make up recombinant expression vector.A key character of expression vector is to contain replication origin, promotor, marker gene and translational control element usually.

Method well-known to those having ordinary skill in the art can be used to make up the dna sequence dna that contains the threonine synthetase 71 of encoding and the expression vector of suitable transcribing/translational control element.These methods comprise (Sambroook, et al.Molecular Cloning, a LaboratoryManual, cold Spring Harbor Laboratory.New York, 1989) such as extracorporeal recombinant DNA technology, DNA synthetic technology, the interior recombinant technologys of body.Described dna sequence dna can effectively be connected on the suitable promotor in the expression vector, and is synthetic to instruct mRNA.The representative example of these promotors has: colibacillary lac or trp promotor; The PL promotor of lambda particles phage; Eukaryotic promoter comprises LTRs and some other known may command gene expression promoter in prokaryotic cell prokaryocyte or eukaryotic cell or its virus of CMV immediate early promoter, HSV thymidine kinase promoter, early stage and late period SV40 promotor, retrovirus.Expression vector also comprises ribosome bind site that translation initiation is used and transcription terminator etc.Inserting enhancer sequence in carrier will make its transcribing in higher eucaryotic cells be enhanced.Enhanser is the cis acting factor that DNA expresses, and nearly 10 to 300 base pairs act on promotor transcribing with enhancing gene usually.Can for example be included in the SV40 enhanser of 100 to 270 base pairs of replication origin side in late period one, at the polyoma enhanser of replication origin side in late period one and adenovirus enhanser etc.

In addition, expression vector preferably comprises one or more selected markers, to be provided for selecting the phenotypic character of transformed host cells, cultivate Tetrahydrofolate dehydrogenase, neomycin resistance and the green fluorescent protein (GFP) of usefulness as eukaryotic cell, or be used for colibacillary tsiklomitsin or amicillin resistance etc.

Persons skilled in the art all know how to select appropriate carriers/transcriptional regulatory element (as promotor, enhanser etc.) and selected marker.

Among the present invention, the polynucleotide of coding threonine synthetase 71 or the recombinant vectors that contains these polynucleotide can transform or transduce into host cell, contain the genetically engineered host cell of these polynucleotide or recombinant vectors with formation.Term " host cell " refers to prokaryotic cell prokaryocyte, as bacterial cell; Or eukaryotic cell such as low, as yeast cell; Or higher eucaryotic cells, as mammalian cell.Representative example has: intestinal bacteria, streptomyces; Bacterial cell such as Salmonella typhimurium; Fungal cell such as yeast; Vegetable cell; Insect cell such as fruit bat S2 or Sf9; Zooblast such as CHO, COS or Bowes melanoma cells etc.

Can carry out with routine techniques well known to those skilled in the art with dna sequence dna of the present invention or the recombinant vectors transformed host cell that contains described dna sequence dna.When the host was prokaryotic organism such as intestinal bacteria, the competent cell that can absorb DNA can be used CaCl in exponential growth after date results ₂Method is handled, and used step is well-known in this area.Alternative is to use MgCl ₂If desired, transforming also the method for available electroporation carries out.When the host is an eukaryote, can select following DNA transfection method for use: coprecipitation of calcium phosphate method, perhaps conventional mechanical method such as microinjection, electroporation, liposome packing etc.

By the recombinant DNA technology of routine, utilize polynucleotide sequence of the present invention to can be used to express or produce threonine synthetase 71 (Science, 1984 of reorganization; 224:1431).In general following steps are arranged:

(1). with the polynucleotide (or varient) of coding of the present invention people threonine synthetase 71, or with the recombinant expression vector that contains these polynucleotide proper host cell that transforms or transduce;

(2). in suitable medium, cultivate host cell;

(3). separation, protein purification from substratum or cell.

In step (2), according to used host cell, used substratum can be selected from various conventional substratum in the cultivation.Under the condition that is suitable for the host cell growth, cultivate.After host cell grows into suitable cell density, induce the promotor of selection with suitable method (as temperature transition or chemical induction), cell is cultivated for some time again.

In step (3), recombinant polypeptide can wrap and be expressed or be secreted into the extracellular in cell or on cytolemma.If desired, can utilize its physics, the separating by various separation methods with other characteristic and the albumen of purification of Recombinant of chemistry.These methods are well-known to those skilled in the art.These methods include, but are not limited to: conventional renaturation is handled, protein precipitant is handled (salt analysis method), centrifugal, the broken bacterium of infiltration, the combination of ultrasonication, super centrifugal, sieve chromatography (gel-filtration), adsorption chromatography, ion exchange chromatography, high performance liquid chromatography (HPLC) and other various liquid chromatography (LC) technology and these methods.

The antagonist of polypeptide of the present invention and this polypeptide, agonist and inhibitor can be directly used in disease treatment, for example, can treat malignant tumour, adrenal gland defect, tetter, all kinds of inflammation, HIV infection and immunological disease etc.

Polypeptide expression of the present invention is unusual, will have influence on the synthetic of Threonine.Because Threonine is an indispensable ring in the amino acid metabolism approach, be again simultaneously one of indispensable amino acid of human body institute, so the resulting anomaly of Threonine will cause the physiological metabolism disorder, and then influence the many systems of whole body generation functional disorder.Polypeptide expression of the present invention can cause unusually but be not limited to following disease: thromboembolism, homocystinuria, four limbs are long, chest depression, ectopia lentis, spontaneous pneumothorax, osteoporosis, backwardness, mental disorder etc.

The present invention also provides SCREENED COMPOUND to identify the method that improves (agonist) or check the medicament of (antagonist) threonine synthetase 71.Agonist improves threonine synthetase 71 biological function such as stimulate cellular proliferation, and antagonist prevention disorder such as the various cancer relevant with cell hyperproliferation with treatment.For example, can in the presence of medicine, the film preparation of mammalian cell or expression threonine synthetase 71 be cultivated with the threonine synthetase 71 of mark.Measure the medicine raising then or check this interactional ability.

The antagonist of threonine synthetase 71 comprises antibody, compound, acceptor disappearance thing and the analogue etc. that filter out.The antagonist of threonine synthetase 71 can combine and eliminate its function with threonine synthetase 71, or suppresses the generation of this polypeptide, or combines with the avtive spot of this polypeptide and to make this polypeptide can not bring into play biological function.

In screening during as the compound of antagonist, threonine synthetase 71 can be added during bioanalysiss measure, determine to interactional influence between threonine synthetase 71 and its acceptor whether compound is antagonist by measuring compound.With the same quadrat method of above-mentioned SCREENED COMPOUND, can filter out the acceptor disappearance thing and the analogue of antagonist action.Can be incorporated into the rondom polypeptide storehouse that solid formation forms by the various amino acid that may make up by screening with threonine synthetase 71 bonded peptide molecules obtains.During screening, generally tackle threonine synthetase 71 molecules and carry out mark.

The invention provides and use polypeptide, and fragment, derivative, analogue or their cell are as the method for antigen with production antibody.These antibody can be polyclonal antibody or monoclonal antibody.The present invention also provides the antibody at threonine synthetase 71 antigenic determinants.These antibody include, but is not limited to: the fragment that polyclonal antibody, monoclonal antibody, chimeric antibody, single-chain antibody, Fab fragment and Fab expression library produce.

The method of the available threonine synthetase 71 direct injection immune animals of the production of polyclonal antibody (as rabbit, mouse, rat etc.) obtains, and multiple adjuvant can be used for the enhancing immunity reaction, includes but not limited to freund's adjuvant etc.The technology of monoclonal antibody of preparation threonine synthetase 71 include but not limited to hybridoma technology (Kohler andMilstein.Nature, 1975,271:495-497), three knurl technology, people B-quadroma technology, EBV-hybridoma technology etc.With the variable region bonded chimeric antibody in human constant region and inhuman source can with existing technology production (Morrison et al, PNAS, 1985,81:6851).And the technology of existing manufacture order chain antibody (U.S.Pat No.4946778) also can be used for producing the single-chain antibody of anti-threonine synthetase 71.

The antibody of anti-threonine synthetase 71 can be used in the immunohistochemistry technology, detects the threonine synthetase 71 in the biopsy specimen.

With the also available labelled with radioisotope of threonine synthetase 71 bonded monoclonal antibodies, inject in the body and can follow the tracks of its position and distribution.This radiolabeled antibody can be used as a kind of atraumatic diagnostic method and is used for the location of tumour cell and has judged whether transfer.

Antibody also can be used for designing the immunotoxin at a certain privileged sites in the body.As the monoclonal antibody of threonine synthetase 71 high-affinities can with bacterium or plant poison (as diphtheria toxin, ricin, abrine etc.) covalent attachment.A kind of usual method is with sulfydryl linking agent such as SPDP, attacks the amino of antibody, by the exchange of disulfide linkage, toxin is incorporated on the antibody, and this hybrid antibody can be used for killing threonine synthetase 71 positive cells.

The disease that antibody among the present invention can be used for treating or prevention and threonine synthetase 71 are relevant.The antibody that gives suitable dosage can stimulate or block the generation or the activity of threonine synthetase 71.

The invention still further relates to the diagnostic testing process of quantitative and detection and localization threonine synthetase 71 levels.These tests are known in the art, and comprise that FISH measures and radioimmunoassay.Threonine synthetase 71 levels that detected in the test can be with laying down a definition the importance of threonine synthetase 71 in various diseases and be used to the disease of diagnosing threonine synthetase 71 to work.

Polypeptide of the present invention also can be used as the peptide spectrum analysis, for example, the polypeptide available physical, chemistry or enzyme carry out the specificity cutting, and carries out the two-dimentional or three-dimensional gel electrophoresis analysis of one dimension, be more preferably and carry out mass spectroscopy.

The polynucleotide of coding threonine synthetase 71 also can be used for multiple therapeutic purpose.Gene therapy technology can be used for treating because cell proliferation, growth or the metabolic disturbance due to the nothing expression of threonine synthetase 71 or the unusual/non-activity expression.The gene therapy vector (as virus vector) of reorganization can be designed for the threonine synthetase 71 of expressing variation, to suppress endogenic threonine synthetase 71 activity.For example, a kind of threonine synthetase 7l of variation can be the threonine synthetase 71 that shortens, lacked signal conduction function territory, though can combine with the substrate in downstream, lacks signaling activity.Therefore the gene therapy vector of reorganization can be used for treating the disease of threonine synthetase 71 expression or active caused by abnormal.Deriving from viral expression vector such as retrovirus, adenovirus, adeno-associated virus (AAV), hsv, parvovirus etc. can be used for the polynucleotide of coding threonine synthetase 71 are transferred in the cell.The method of recombinant viral vector that structure carries the polynucleotide of coding threonine synthetase 71 is found in existing document (Sambrook, et al.).The polynucleotide of reorganization coding threonine synthetase 71 can be packaged in the liposome and be transferred in the cell in addition.

Polynucleotide import tissue or intracellular method comprises: directly be injected into polynucleotide in the in-vivo tissue; Or external by carrier (as virus, phage or plasmid etc.) earlier with the polynucleotide transfered cell in, again cell is transplanted in the body etc.

Suppress the oligonucleotide (comprising sense-rna and DNA) of threonine synthetase 71 mRNA and ribozyme also within the scope of the invention.Ribozyme is the enzyme sample RNA molecule that a kind of energy specificity is decomposed specific RNA, and its mechanism of action is to carry out the endonuclease effect after ribozyme molecule and the hybridization of complementary target RNA-specific.The RNA of antisense and DNA and ribozyme can obtain with existing any RNA or DNA synthetic technology, as the technology widespread use of solid phase phosphoamide chemical synthesis synthetic oligonucleotide.Antisense rna molecule can be transcribed acquisition by the dna sequence dna of this RNA that encodes in external or body.This dna sequence dna has been incorporated into the downstream of rna polymerase promoter of carrier in order to increase the stability of nucleic acid molecule, available several different methods is modified it, as increasing the sequence length of both sides, the connection between the ribonucleoside is used phosphoric acid thioester bond or peptide bond but not phosphodiester bond.

The polynucleotide of coding threonine synthetase 71 can be used for the diagnosis with the relative disease of threonine synthetase 71.The unconventionality expression of the expression that the polynucleotide of coding threonine synthetase 71 can be used for detecting threonine synthetase 71 threonine synthetase 71 whether or under morbid state.As the dna sequence dna of the threonine synthetase 71 of encoding can be used for biopsy specimen is hybridized to judge the expression situation of threonine synthetase 71.Hybridization technique comprises the Southern blotting, Northern blotting, in situ hybridization etc.These technological methods all are disclosed mature technologies, and relevant test kit all can obtain from commercial channels.Part or all of polynucleotide of the present invention can be used as probe stationary on microarray (Microarray) or DNA chip (being called " gene chip " again), is used for analyzing the differential expression analysis and the gene diagnosis of tissue gene.Carry out the transcription product that RNA-polymerase chain reaction (RT-PCR) amplification in vitro also can detect threonine synthetase 71 with threonine synthetase 71 special primers.

The sudden change that detects threonine synthetase 71 genes also can be used for diagnosing the relevant disease of threonine synthetase 71.The form of threonine synthetase 71 sudden change comprises that the point mutation compared with normal wild type threonine synthetase 71 dna sequence dnas, transposition, disappearance, reorganization and other are any unusual etc.Available existing technology such as Southern blotting, dna sequence analysis, PCR and in situ hybridization detect sudden change.In addition, sudden change might influence proteic expression, therefore can judge indirectly that with Northern blotting, Western blotting gene has or not sudden change.

Sequence of the present invention identifies it also is valuable to karyomit(e).This sequence can be specifically at certain bar human chromosome particular location and and can with its hybridization.At present, need to identify the concrete site of each gene on the karyomit(e).Now, have only chromosomal marker thing seldom to can be used for the marker chromosomes position based on actual sequence data (repetition polymorphism).According to the present invention, for these sequences are associated with disease related gene, its important the first step is positioned these dna sequence dnas on the karyomit(e) exactly.

In brief, prepare PCR primer (preferred 15-35bp), sequence can be positioned on the karyomit(e) according to cDNA.Then, these primers are used for the somatocyte hybrid cell that the PCR screening contains each bar human chromosome.Have only those hybrid cells that contain corresponding to the people's gene of primer can produce the fragment of amplification.

The PCR localization method of somatocyte hybrid cell is that DNA is navigated to concrete chromosomal quick method.Use Oligonucleolide primers of the present invention,, can utilize one group to realize inferior location from specific chromosomal fragment or a large amount of genomic clone by similar approach.Other the similar strategy that can be used for chromosomal localization comprises in situ hybridization, uses the karyomit(e) prescreen and the hybridization preliminary election of the airflow classification of mark, thereby makes up the special cDNA storehouse of karyomit(e).

The cDNA clone is carried out fluorescence in situ hybridization (FISH) with Metaphase Chromosome, can in a step, accurately carry out chromosomal localization.The summary of this technology is referring to Verma etc., Human Chromosomes:a Manualof Basic Techniques, Pergamon Press, New York (1988).

In case sequence is positioned to chromosome position accurately, the physical location of this sequence on karyomit(e) just can be associated with the gene map data.These data for example are found in, V.Mckusick, MendelianInheritance in Man (can by with the online acquisition of Johns Hopkins University Welch Medical Library).Can pass through linkage analysis then, determine gene and navigated to relation between the disease on the chromosomal region already.

Then, need to measure ill and not cDNA between diseased individuals or genome sequence difference.If observe certain sudden change in some or all of diseased individuals, and this sudden change is not observed in any normal individual, then this sudden change may be the cause of disease of disease.More ill and diseased individuals not is usually directed at first seek the variation of structure in the karyomit(e), as from the horizontal visible of karyomit(e) or use based on detectable disappearance of the PCR of cDNA sequence or transposition.Resolving power according to present physical mapping and assignment of genes gene mapping technology, being accurately positioned to the cDNA of the chromosomal region relevant with disease, can be a kind of (the supposing that 1 megabasse mapping resolving power and every 20kb are corresponding to a gene) between 50 to 500 potential Disease-causing genes.

Polypeptide of the present invention, polynucleotide and stand-in thereof, agonist, antagonist and inhibitor and suitable pharmaceutical carrier combination back can be used.These carriers can be water, glucose, ethanol, salt, damping fluid, glycerine and their combination.Composition comprises the polypeptide or the antagonist of safe and effective amount and carrier and the vehicle that does not influence effect of drugs.These compositions can be used as medicine and are used for disease treatment.

The present invention also provides medicine box or the test kit that contains one or more containers, and one or more medicinal compositions compositions of the present invention are housed in the container.With these containers, can have by the given indicative prompting of government authorities of making, using or selling medicine or biological products, the government authorities that this prompting reflects production, uses or sells permits it to use on human body.In addition, polypeptide of the present invention can be used in combination with other treatment compound.

Pharmaceutical composition can be with mode administration easily, as by in part, intravenously, intraperitoneal, intramuscular, subcutaneous, the nose or the route of administration of intracutaneous.Threonine synthetase 71 comes administration with the amount that treats and/or prevents concrete indication effectively.The amount and the dosage range that are applied to patient's threonine synthetase 71 will depend on many factors, as administering mode, person's to be treated healthiness condition and diagnostician's judgement.

Following accompanying drawing is used to illustrate specific embodiments of the present invention, and is not used in qualification by the scope of the invention that claims defined.

Fig. 1 is the amino acid sequence homology comparison diagram of the threonine synthetase of threonine synthetase 71 of the present invention and spirobacteria.The top sequence is a threonine synthetase 71, and the below sequence is the threonine synthetase of spirobacteria.Same amino acid represents with monocase amino acid that between two sequences similar amino acid is represented with "+".

Fig. 2 is the polyacrylamide gel electrophoresis figure (SDS-PAGE) of isolating threonine synthetase 71.71kDa is proteinic molecular weight.The arrow indication is isolated protein band.

Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to people such as normal condition such as Sambrook, molecular cloning: laboratory manual (New York:ColdSpring Harbor Laboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.Embodiment 1: the clone of threonine synthetase 71

Extract the total RNA of people's tire brain with guanidinium isothiocyanate/phenol/chloroform single stage method.From total RNA, separate poly (A) mRNA with Quik mRNA Isolation Kit (Qiegene company product).2ug poly (A) mRNA forms cDNA through reverse transcription.CDNA fragment orientation is inserted on the multiple clone site of pBSK (+) carrier (Clontech company product) with Smart cDNA clone's test kit (available from Clontech), transforms DH5 α, bacterium forms the cDNA library.Measure all clones' 5 ' and 3 ' terminal sequence with Dyeterminate cycle reaction sequencing kit (Perkin-Elmer company product) and ABI 377 automatic sequencers (Perkin-Elmer company).CDNA sequence and the existing public dna sequence data storehouse (Genebank) measured are compared, found that the cDNA sequence of one of them clone 0172f08 is new DNA.By synthetic a series of primers the contained insertion cDNA fragment of this clone is carried out two-way mensuration.The result shows, the contained full-length cDNA of 0172f08 clone is 2066bp (shown in Seq ID NO:1), from 64bp to 2007bp the open reading frame (ORF) of a 1943bp, the new protein (shown in Seq ID NO:2) of encoding arranged.We are with this clone's called after pBS-0172f08, encoded protein matter called after threonine synthetase 71.

Embodiment 2:cDNA clone's homology retrieval

With the sequence and the encoded protein sequence thereof of threonine synthetase 71 of the present invention, with Blast program (Basiclocal Alignment search tool) [Altschul, SF et al.J.Mol.Biol.1990; 215:403-10], carry out the homology retrieval at databases such as Genbank, Swissport.The gene the highest with threonine synthetase 71 homologys of the present invention is the threonine synthetase of a kind of known spirobacteria, and its encoded protein number is AE001448 in the access of Genbank.Protein homology the results are shown in Fig. 1, both height homologies, and its homogeny is 36%; Similarity is 55%.Embodiment 3: with the gene of RT-PCR method clones coding threonine synthetase 71

Total RNA is a template with fetus brain cell, is that primer carries out the synthetic cDNA of reverse transcription reaction with oligo-dT, with behind the test kit purifying of Qiagene, carries out pcr amplification with following primer:

Primer1:5’-GGTCAGAAACTAGGTTGTTGCGTC-3’(SEQ?ID?NO:3)

Primer2:5’-AGTTTGAGATTTATTATTGCATGC-3’(SEQ?ID?NO:4)

Primer1 is the forward sequence that begins of 1bp that is positioned at the 5 ' end of SEQ ID NO:1;

Primer2 be SEQ ID NO:1 in 3 ' end reverse sequence.

The condition of amplified reaction: in the reaction volume of 50 μ l, contain 50mmol/L KCl, 10mmol/LTris-Cl, (pH8.5), 1.5mmol/L MgCl ₂, 200 μ mol/L dNTP, 10pmol primer, the Taq archaeal dna polymerase of 1U (Clontech company product).Go up by 25 cycles of following conditioned response at PE9600 type DNA thermal cycler (Perkin-Elmer company): 94 ℃ of 30sec; 55 ℃ of 30sec; 72 ℃ of 2min.When RT-PCR, establish the blank negative contrast of positive contrast of β-actin and template simultaneously.Amplified production is connected to (Invitrogen company product) on the pCR carrier with the test kit purifying of QIAGEN company with TA clone test kit.The dna sequence analysis result shows that the dna sequence dna of PCR product and the 1-2066bp shown in the SEQ ID NO:1 are identical.Embodiment 4:Northern blotting is analyzed threonine synthetase 71 expression of gene:

Extract total RNA[Anal.Biochem 1987,162,171-159 with single stage method].This method comprises acid guanidine thiocyanate phenol-chloroform extracting.Promptly use 4M guanidinium isothiocyanate-25mM Trisodium Citrate, 0.2M sodium acetate (pH4.0) carries out homogenate to tissue, adds the phenol of 1 times of volume and the chloroform-primary isoamyl alcohol (49: 1) of 1/5 volume, and is centrifugal after mixing.The sucking-off aqueous phase layer adds Virahol (0.8 volume) and with the centrifugal RNA precipitation that obtains of mixture.RNA precipitation 70% washing with alcohol that kidney obtains, dry and soluble in water.With 20 μ g RNA, on 1.2% sepharose that contains 20mM 3-(N-morpholino) propanesulfonic acid (pH7.0)-5mM sodium acetate-lmM EDTA-2.2M formaldehyde, carry out electrophoresis.Be transferred on the nitrocellulose filter then.With α- ³²P dATP prepares by random priming ³²The dna probe of P-mark.Used dna probe is threonine synthetase 71 coding region sequences (64bp to 2007bp) of pcr amplification shown in Figure 1.Probe (about 2 * 10 with the 32P-mark ⁶Cpm/ml) spend the night in 42 ℃ of hybridization in a solution with the nitrocellulose filter that has shifted RNA, this solution comprises 50% methane amide-25mM KH ₂PO ₄(pH7.4)-5 * SSC-5 * Denhardt ' s solution and 200 μ g/ml salmon sperm DNAs.After the hybridization, filter membrane is washed 30min in 55 ℃ in 1 * SSC-0.1%SDS.Then, analyze with quantitative with Phosphor Imager.Embodiment 5: vivoexpression, separation and the purifying of reorganization threonine synthetase 71

According to SEQ ID NO:1 and coding region sequence shown in Figure 1, design a pair of specificity amplification primer, sequence is as follows:

Primer3:5’-?CATCCATGGATGAGTGTGTCTGAAAAATTACAGG-3’(Seq?ID?No:5)

Primer4:5’-?CCCGAGCTCCCTATGAATTGATTTTGGACAAGTTG-3’(Seq?ID?No:6)

5 ' end of these two sections primers contains Nco I and Sac I restriction enzyme site respectively, be respectively the encoding sequence of target gene 5 ' end and 3 ' end thereafter, Nco I and Sac I restriction enzyme site are corresponding to the selectivity restriction enzyme site on the expression vector plasmid pET-28b (+) (Novagen company product, Cat.No.6986 5.3).With the pBS-0172f08 plasmid that contains the total length goal gene is template, carries out the PCR reaction.The PCR reaction conditions is: contain pBS-0172f08 plasmid 10pg, primer Primer-3 and Primer-4 among the cumulative volume 50 μ l and be respectively 10pmol, Advantage polymerase Mix (Clontech company product) 1 μ l.Loop parameter: 94 ℃ of 20s, 60 ℃ of 30s, 68 ℃ of 2min, totally 25 circulations.Respectively amplified production and plasmid pET-28 (+) are carried out double digestion with Nco I and Sac I, reclaim big fragment respectively, and connect with the T4 ligase enzyme.Connect product and transform, after the dull and stereotyped overnight incubation of the LB that contains kantlex (final concentration 30 μ g/ml), use the colony polymerase chain reaction (PCR) method screening positive clone, and check order with the big enterobacterial DH5 of Calcium Chloride Method α.Select the correct positive colony of sequence (pET-0172f08) with Calcium Chloride Method with recombinant plasmid transformed e. coli bl21 (DE3) plySs (Novagen company product).In the LB liquid nutrient medium that contains kantlex (final concentration 30 μ g/ml), host bacterium BL21 (pET-0172f08) is cultured to logarithmic phase at 37 ℃, adds IPTG to final concentration 1mmol/L, continues to cultivate 5 hours.Centrifugal collection thalline, through the broken bacterium of ultrasonic wave, centrifugal collection supernatant with carrying out chromatography with 6 Histidines (6His-Tag) bonded affinity column His.Bind Quick Cartridge (Novagen company product), has obtained the target protein threonine synthetase 71 of purifying.Through the SDS-PAGE electrophoresis, obtain a single band (Fig. 2) at the 71kDa place.This band is transferred on the pvdf membrane carries out the n terminal amino acid sequential analysis with the Edams hydrolysis method, 15 amino acid of N-end hold 15 amino-acid residues identical with the N-shown in the SEQ ID NO:2 as a result.Embodiment 6 anti-threonine synthetase 71 production of antibodies

Synthesize following threonine synthetase 71 specific polypeptide with Peptide synthesizer (PE company product):

NH ₂-Met-Ser-Val-Ser-Glu-Lys-Leu-Gln-Asp-Val-Gly-Asn-Glu-Gln-Phe-COOH(SEQ?ID?NO:7)。Form compoundly with hemocyanin and bovine serum albumin coupling this polypeptide respectively, method is referring to Avrameas, et al.Immunochemistry, 1969; 6:43.Add the complete Freund's adjuvant immunizing rabbit with the above-mentioned hemocyanin polypeptide complex of 4mg, add the incomplete Freund's adjuvant booster immunization once with the hemocyanin polypeptide complex again after 15 days.Employing is done the titre that ELISA measures antibody in the rabbit anteserum through the titer plate of 15 μ g/ml bovine serum albumin polypeptide complex bag quilts.From the rabbit anteserum of antibody positive, separate total IgG with albumin A-Sepharose.Polypeptide is incorporated on the Sepharose4B post of cyanogen bromide-activated, from total IgG, separates anti-peptide antibody with affinity chromatography.Immuno-precipitation proof antibody purified can combine with threonine synthetase 71 specifically.

Sequence table (1) general information: (ⅱ) denomination of invention: threonine synthetase 71 and encoding sequence thereof (ⅲ) sequence number: the information of 7 (2) SEO ID NO:1: (ⅰ) sequence signature:

(A) length: 2066bp

(B) type: nucleic acid

(C) chain: two strands

( D ) ： ( ⅱ ) ：cDNA ( ⅹⅰ ) ：SEQ ID NO:1: 1 GGTCAGAAACTAGGTTGTTGCGTCATAGATGTGGATGATGATATCCTTGAAAAAACCTGG 61 AATATGAGTGTGTCTGAAAAATTACAGGATGTTGGTAATGAGCAATTTTTAGAAGAGGAA121 GGAAAAGCTGTGTTAAACTTCTCTGCATCTGGAAGTGTGATTTCCCTTACTGGGTCCAAT181 CCAATGCATGATGCTAGCATGTGGCATCTGAAGAAAAATGGAATAATTGTATACCTGGAT241 GTACCTCTACTAGATCTAATTTGTCGTCTAAAATTAATGAAGACAGATAGGATTGTAGGT301 CAGAATTCTGGGACATCTATGAAAGACTTACTTAAATTTAGAAGACAGTATTATAAGAAG361 TGGTATGATGCTCGTGTTTTCTGTGAAAGTGGGGCTTCCCCAGAGGAGGTAGCTGACAAA421 GTGCTGAATGCAATTAAAAGATACCAAGATGTGGACTCGGAAACATTCATTTCAACAAGA481 CACGTTTGGCTTGAAGACTGTGAACAGAAGGTTTCAGCAAAATTCTTTAGTGAAGCTGTA541 ATTGAGGGGTTGGCTTCTGATGGTGGCCTCTTTGTTCCTGCAAAGGAGTTTCCAAAATTA601 AGCTGCGGGGAGTGGAAAAGCCTAGTAGGAGCAACCTACGTAGAAAGAGCACAGATACTG661 TTGGAAAGATGTATCCATCCTGCAGACATACCTGCTGCCAGGTTGGGAGAAATGATTGAA721 GCTGCTTATGGGGAAAACTTTGCCTGCTCAAAAAGTGCTCCTGTCAGGCACCTTTCAGGC781 AACCAGTTCATCCTGGAGTTGTTTCATGGACCAACAGGATCATTTAAAGATTTGTCTTTA841 CAGCTTATGCCTCATATTTTTGCACACTGTATCCCACCAAGTTGCAATTATATGATACTT901 GTAGCTACTTCAGGAGACACAGGGAGTGCAGTCTTAAATGGTTTTAGTCCTCTAAATAAG 961 AATGATAAGCAAAGGATAGCTGTGGTTGCATTTTTTCCTGAGAATGGAGTAAGTGATTTT1021 CAAAAAGCACAAATAATTGGCAGTCAGAGAGAAAATGGATGGGCAGTGGGTGTTGAGTCA1081 GATTTTGATTTTTGCCAGACAGCTATAAAAAGAATTTTTAATGATTCTGATTTTACTGGC1141 TTTCTTACTGTGGAATATGGAACAATCTTAAGTTCGGCTAACTCCATAAACTGGGGCCGA1201 CTACTTCCGCAGGTAGTTTATCATGCTTCCGCATATCTTGATCTTGTTAGTCAAGGATTT1261 ATTTCTTTTGGAAGCCCAGTCGATGTCTGTATTCCCACAGGAAACTTTGGTACCATTTTA1321 GCAGCAGTGTATGCCAAAATGATGGGAATCCCGATTCGAAAATTTATCTGTGCCTCTAAT1381 CAGAACCATGTTTTGACTGATTTTATAAAAACAGGACATTATGATCTAAGGGAAAGAAAA1441 TTAGCACAAACCTTTTCACCGTCAATAGATATTCTCAAATCTTCAAACCTAGAACGACAT1501 TTACACTTGATGGCTAATAAAGATGGACAGCTAATGACAGAATTATTTAATCGATTAGAA1561 AGTCAGCATCATTTCCAGATAGAAAAGGCTCTAGTTGAGAAACTTCAGCAGGATTTTGTA1621 GCTGACTGGTGCTCTGAGGGAGAGTGCCTAGCAGCTATTAACTCCACCTATAATACTTCA1681 GGGTATATTTTGGATCCACACACTGCTGTTGCAAAAGTGGTTGCAGATAGGGTGCAAGAC1741 AAAACTTGCCCTGTGATTATCTCATCTACAGCCCATTACTCAAAGTTTGCACCTGCTATC1801 ATGCAGGCTTTAAAGATTAAAGAAATCAATGAGACTTCATCAAGTCAGCTCTATTTGCTG1861 GGTTCATACAATGCATTACCTCCACTGCATGAGGCTTTATTAGAGAGAACAAAACAGCAA1921 GAGAAGATGGAGTACCAGGTCTGTGCAGCTGATATGAATGTCTTGAAGAGTCATGTGGAA1981 CAACTTGTCCAAAATCAATTCATATGAAAGCTTTCAGAGTAAATTTTTTTTTCTAGCTAT2041 AAGCATGCAATAATAAATCTCAAACT ( 3 ) SEQ ID NO:2： ( ⅰ ) ：

(A) length: 647 amino acid

(B) type: amino acid

( D ) ： ( ⅱ ) ： ( ⅹⅰ ) ：SEQ ID NO:2: 1 Met Ser Val Ser Glu Lys Leu Gln Asp Val Gly Asn Glu Gln Phe16 Leu Glu Glu Glu Gly Lys Ala Val Leu Asn Phe Ser Ala Ser Gly31 Ser Val Ile Ser Leu Thr Gly Ser Asn Pro Met His Asp Ala Ser46 Met Trp His Leu Lys Lys Asn Gly Ile Ile Val Tyr Leu Asp Val61 Pro Leu Leu Asp Leu Ile Cys Arg Leu Lys Leu Met Lys Thr Asp 76 Arg Ile Val Gly Gln Asn Ser Gly Thr Ser Met Lys Asp Leu Leu 91 Lys Phe Arg Arg Gln Tyr Tyr Lys Lys Trp Tyr Asp Ala Arg Val106 Phe Cys Glu Ser Gly Ala Ser Pro Glu Glu Val Ala Asp Lys Val121 Leu Asn Ala Ile Lys Arg Tyr Gln Asp Val Asp Ser Glu Thr Phe136 Ile Ser Thr Arg His Val Trp Leu Glu Asp Cys Glu Gln Lys Val151 Ser Ala Lys Phe Phe Ser Glu Ala Val Ile Glu Gly Leu Ala Ser166 Asp Gly Gly Leu Phe Val Pro Ala Lys Glu Phe Pro Lys Leu Ser181 Cys Gly Glu Trp Lys Ser Leu Val Gly Ala Thr Tyr Val Glu Arg196 Ala Gln Ile Leu Leu Glu Arg Cys Ile His Pro Ala Asp Ile Pro211 Ala Ala Arg Leu Gly Glu Met Ile Glu Ala Ala Tyr Gly Glu Asn226 Phe Ala Cys Ser Lys Ser Ala Pro Val Arg His Leu Ser Gly Asn241 Gln Phe Ile Leu Glu Leu Phe His Gly Pro Thr Gly Ser Phe Lys256 Asp Leu Ser Leu Gln Leu Met Pro His Ile Phe Ala His Cys Ile271 Pro Pro Ser Cys Asn Tyr Met Ile Leu Val Ala Thr Ser Gly Asp286 Thr Gly Ser Ala Val Leu Asn Gly Phe Ser Arg Leu Asn Lys Asn301 Asp Lys Gln Arg Ile Ala Val Val Ala Phe Phe Pro Glu Asn Gly316 Val Ser Asp Phe Gln Lys Ala Gln Ile Ile Gly Ser Gln Arg Glu331 Asn Gly Trp Ala Val Gly Val Glu Ser Asp Phe Asp Phe Cys Gln346 Thr Ala Ile Lys Arg Ile Phe Asn Asp Ser Asp Phe Thr Gly Phe361 Leu Thr Val Glu Tyr Gly Thr Ile Leu Ser Ser Ala Asn Ser Ile376 Asn Trp Gly Arg Leu Leu Pro Gln Val Val Tyr His Ala Ser Ala391 Tyr Leu Asp Leu Val Ser Gln Gly Phe Ile Ser Phe Gly Ser Pro406 Val Asp Val Cys Ile Pro Thr Gly Asn Phe Gly Thr Ile Leu Ala421 Ala Val Tyr Ala Lys Met Met Gly Ile Pro Ile Arg Lys Phe Ile436 Cys Ala Ser Asn Gln Asn His Val Leu Thr Asp Phe Ile Lys Thr451 Gly His Tyr Asp Leu Arg Glu Arg Lys Leu Ala Gln Thr Phe Ser466 Pro Ser Ile Asp Ile Leu Lys Ser Ser Asn Leu Glu Arg His Leu481 His Leu Met Ala Asn Lys Asp Gly Gln Leu Met Thr Glu Leu Phe496 Asn Arg Leu Glu Ser Gln His His Phe Gln Ile Glu Lys Ala Leu511 Val Glu Lys Leu Gln Gln Asp Phe Val Ala Asp Trp Cys Ser Glu526 Gly Glu Cys Leu Ala Ala Ile Asn Ser Thr Tyr Asn Thr Ser Gly541 Tyr Ile Leu Asp Pro His Thr Ala Val Ala Lys Val Val Ala Asp556 Arg Val Gln Asp Lys Thr Cys Pro Val Ile Ile Ser Ser Thr Ala571 His Tyr Ser Lys Phe Ala Pro Ala Ile Met Gln Ala Leu Lys Ile586 Lys Glu Ile Asn Glu Thr Ser Ser Ser Gln Leu Tyr Leu Leu Gly601 Ser Tyr Asn Ala Leu Pro Pro Leu His Glu Ala Leu Leu Glu Arg616 Thr Lys Gln Gln Glu Lys Met Glu Tyr Gln Val Cys Ala Ala Asp631 Met Ash Val Leu Lys Ser His Val Glu Gln Leu Val Gln Asn Gln646 Phe Ile ( 4 ) SEQ ID NO:3 ( ⅰ )

(A) length: 24 bases

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linear (ⅱ) molecule type: oligonucleotide (ⅹ ⅰ) sequence description: information (ⅰ) sequence signature of SEQ ID NO:3:GGTCAGAAACTAGGTTGTTGCGTC 24 (5) SEQ ID NO:4

(A) length: 24 bases

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linear (ⅱ) molecule type: oligonucleotide (ⅹ ⅰ) sequence description: information (ⅰ) sequence signature of SEQ ID NO:4:AGTTTGAGATTTATTATTGCATGC 24 (6) SEQ ID NO:5

(A) length: 34 bases

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linear (ⅱ) molecule type: oligonucleotide (ⅹ ⅰ) sequence description: information (ⅰ) sequence signature of SEQ ID NO:5:CATCCATGGATGAGTGTGTCTGAAAAATTACAGG 34 (7) SEQ ID NO:6

(A) length: 35 bases

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linear (ⅱ) molecule type: oligonucleotide (ⅹ ⅰ) sequence description: the information of SEQ ID NO:6:CCCGAGCTCCCTATGAATTGATTTTGGACAAGTTG 35 (8) SEQ ID NO:7: (ⅰ) sequence signature:

(A) length: 15 amino acid

(B) type: amino acid

(D) topological framework: linear (ⅱ) molecule type: polypeptide (ⅹ ⅰ) sequence description: SEQ ID NO:7:Met-Ser-Val-Ser-Glu-Lys-Leu-Gln-Asp-Val-Gly-Asn-Glu-Gln-Phe 15

Claims

1, a kind of isolated polypeptide-threonine synthetase 71 is characterized in that it includes: the polypeptide of the aminoacid sequence shown in the SEQ ID NO:2 or active fragments, analogue or the derivative of its polypeptide.

2, polypeptide as claimed in claim 1, the aminoacid sequence that it is characterized in that described polypeptide, analogue or derivative has the homogeny with the aminoacid sequence at least 95% shown in the SEQ ID NO:2.

3, polypeptide as claimed in claim 2 is characterized in that it comprises the polypeptide with the aminoacid sequence shown in the SEQ ID NO:2.

4, a kind of isolating polynucleotide, it is characterized in that described polynucleotide comprise be selected from down the group in a kind of:

(a) coding has the polynucleotide of the polypeptide of aminoacid sequence shown in the SEQ ID NO:2 or its fragment, analogue, derivative;

(b) with polynucleotide (a) complementary polynucleotide; Or

(c) with (a) or the polynucleotide of at least 70% homogeny (b) are arranged.

5, polynucleotide as claimed in claim 4 is characterized in that described polynucleotide comprise the polynucleotide that coding has aminoacid sequence shown in the SEQID NO:2.

6, polynucleotide as claimed in claim 4, the sequence that it is characterized in that described polynucleotide include the sequence of 1-2066 position among the sequence of 64-2007 position among the SEQ IDNO:1 or the SEQ ID NO:1.

7, a kind of recombinant vectors that contains exogenous polynucleotide is characterized in that it is the recombinant vectors that is formed by the described polynucleotide of arbitrary claim among the claim 4-6 and plasmid, virus or vehicle expression vector establishment.

8, a kind of genetically engineered host cell that contains exogenous polynucleotide is characterized in that it is to be selected from following a kind of host cell:

(a) host cell that transforms or transduce with the described recombinant vectors of claim 7; Or

(b) host cell that transforms or transduce with the described polynucleotide of the arbitrary claim among the claim 4-6.

9, a kind of preparation method with threonine synthetase 71 active polypeptide is characterized in that described method comprises:

(a) expressing under threonine synthetase 71 conditions, cultivate the described through engineering approaches host cell of claim 8;

(b) from culture, isolate and have threonine synthetase 71 active polypeptide.

10, a kind of can with polypeptide bonded antibody, it is characterized in that described antibody be can with threonine synthetase 71 specificity bonded antibody.

11, the compound of an analoglike or adjusting polypeptide active or expression is characterized in that they are simulation, promotion, antagonism or the active compound that suppresses threonine synthetase 71.

12, compound as claimed in claim 11 is characterized in that it is the polynucleotide sequence shown in the SEQ ID NO:1 or its segmental antisense sequences.

13, the described application of compound of a kind of claim 11, it is characterized in that described compound be used to regulate threonine synthetase 71 in vivo, the method for external activity.

14, a kind of disease relevant or method of disease susceptibility of detecting with the described polypeptide of arbitrary claim among the claim 1-3, it is characterized in that it comprises the described polypeptide expression amount that detects, perhaps detect the activity of described polypeptide, perhaps detect and cause described expression of polypeptides amount or active unusual nucleotide diversity in the polynucleotide.

15, as the application of polypeptide as described in the arbitrary claim among the claim 1-3, it is characterized in that it is applied to screen the stand-in of threonine synthetase 71, agonist, antagonist or inhibitor; Perhaps be used for the peptide finger print identification.

16, as the application of the described nucleic acid molecule of arbitrary claim among the claim 4-6, it is characterized in that it is used for nucleic acid amplification reaction as primer, perhaps be used for hybridization, perhaps be used to make gene chip or microarray as probe.

17,, it is characterized in that forming pharmaceutical composition with safe and effective dosage and pharmaceutically acceptable carrier as the relevant unusually disease of diagnosis or treatment and threonine synthetase 71 with described polypeptide, polynucleotide or its stand-in, agonist, antagonist or inhibitor as the described polypeptide of arbitrary claim, polynucleotide or application of compound in claim 1-6 and 11.

18, the described polypeptide of arbitrary claim, polynucleotide or the application of compound among the claim 1-6 and 11, it is characterized in that being used for the treatment of as malignant tumour with described polypeptide, polynucleotide or compound, hemopathy, the medicine of HIV infection and immunological disease and all kinds of inflammation.