CN1303862A - Novel polypeptide-human shearing and polyadenylation specific factor subunit 66 and polynucleotide for coding said polypeptide - Google Patents

Abstract

The present invention discloses a novel polypeptide-human shear and polyadenylic acidified specific factor subunit 66, polynucleotide coding the said polypeptide and its method for producing this polypeptide by using DNA recombination technology. Said invention also discloses the method for curing several diseases of malignant tumor, blood disease, HIV infection, immunological disease and various inflammations, by using the said polypeptide. Said invention also discloses antagonist resisting said polypeptide and its therapeutic effect. Said invention also discloses the application of the polynucleotide for coding this novel human sheat and polyadenylic acidified specific factor subunit 66.

Description

The polynucleotide of a kind of shearing of new polypeptide-human and polyadenylic acid specific factor subunit 66 and this peptide species of coding

The invention belongs to biological technical field, specifically, the invention describes a kind of shearing and polyadenylic acid specific factor subunit 66 of new polypeptide-human, and the polynucleotide sequence of this polypeptide of encoding.The invention still further relates to the preparation method and the application of these polynucleotide and polypeptide.

Be processed in the process of ripe mRNA at nearly all eukaryotic mrna precursor, also and then at the shearing stump add tens poly-A tails (polyadenylic acidization) to the identification of tailing signal AAUAAA and then in the shearing of its downstream 10-30 Nucleotide place to the hundreds of unequal length, mainly be the albumen of guarding at the evolution camber by a kind of, promptly shear and finish with polyadenylic acid specific factor (CPSF).CPSF in the Mammals is respectively 160kD by 4 apparent molecular weights, 100kD, and 73kD, the subunit of 30kD is formed (S.Bienroth, etal, J.Biol.Chem.266,19768; K.G.K Murthy, et al, J.Biol.Chem.267,14804).Wherein, the CPSF-73kD subunit gene of ox is by clone (Andrea s.J, et al Science274:1514).And people's CPSF-73kD subunit gene has only been cloned partial sequence (GenBank AccessionNo.AAB70268).The invention provides a kind of people's CPSF-73kD subunit gene, its gene order has 684 proteic open reading frame of amino-acid residue of a coding therebetween by shown in the SEQ IDNO:1, and its sequence is made up of the aminoacid sequence shown in the SEQID NO:2 basically.The length of this new gene coded protein is consistent with the CPSF-73kD protein subunit length of ox, and homology shows that relatively both have 99% homology (see figure 1).And the sequence in the nucleotide sequence of gene and all the open gene databases does not have high homology.Therefore, can think that the feature of CPSF-73kD subunit polypeptide of new coded by said gene provided by the invention is an albumen that has with the CPSF-73kD protein subunit said function of ox.

An object of the present invention is to provide the shearing of isolating new polypeptide-human and polyadenylic acid specific factor subunit 66 with and fragment, analogue and derivative.

Another object of the present invention provides the polynucleotide of this polypeptide of coding.

Another object of the present invention provides the recombinant vectors of the polynucleotide of the shearing that contains the people that encodes and polyadenylic acid specific factor subunit 66.

Another object of the present invention provides the genetically engineered host cell of the polynucleotide of the shearing that contains the people that encodes and polyadenylic acid specific factor subunit 66.

Another object of the present invention provides production people's the shearing and the method for polyadenylic acid specific factor subunit 66.

Another object of the present invention provides the antibody at the shearing of polypeptide-human of the present invention and polyadenylic acid specific factor subunit 66.

Another object of the present invention has provided simulated compound, antagonist, agonist, the inhibitor at the shearing of polypeptide-human of the present invention and polyadenylic acid specific factor subunit 66.

Another object of the present invention provides the method for the diagnoses and treatment disease relevant unusually with the polyadenylic acid specific factor subunit 66 with people's shearing.

In a first aspect of the present invention, the isolated people's of novelty shearing and polyadenylic acid specific factor subunit 66 are provided, this polypeptide is the people source, and it comprises: have the polypeptide of SEQ ID NO:2 aminoacid sequence or its conservative property variation polypeptide or its active fragments or its reactive derivative, analogue.Preferably, this polypeptide is the polypeptide with SEQ ID NO:2 aminoacid sequence.

In a second aspect of the present invention, the polynucleotide of isolating these polypeptide of coding are provided, these polynucleotide comprise a nucleotide sequence, and this nucleotide sequence is shown at least 99% homogeny with a kind of nucleotides sequence that is selected from down group: (a) the above-mentioned people's of coding the shearing and the polynucleotide of polyadenylic acid specific factor subunit 66; (b) with polynucleotide (a) complementary polynucleotide.Preferably, this polynucleotide encoding has the polypeptide of aminoacid sequence shown in the SEQ ID NO:2.More preferably, the sequence of these polynucleotide is be selected from down group a kind of: the sequence that (a) has 129-2183 position among the SEQ ID NO:1; (b) has the sequence of 1-2234 position among the SEQ ID NO:1.

In a third aspect of the present invention, the carrier that contains above-mentioned polynucleotide is provided, and has been transformed or host cell of transduceing or the host cell that is directly transformed or transduce by above-mentioned polynucleotide by this carrier.

Others of the present invention are because disclosing of the technology of this paper is conspicuous to those skilled in the art.

As used herein, " isolating " are meant that material separates (if natural substance, primal environment promptly is a natural surroundings) from its primal environment.Do not have separation and purification as polynucleotide under the native state in the active somatic cell and polypeptide, but same polynucleotide or polypeptide as from native state with in other materials that exist separately, then for separation and purification.

As used herein, " isolating people's shearing and polyadenylic acid specific factor subunit 66 " is meant that people's shearing and polyadenylic acid specific factor subunit 66 are substantially free of natural relative other albumen, lipid, carbohydrate or other material.Those skilled in the art can use the purified technology of protein purifying people's of standard shearing and polyadenylic acid specific factor subunit 66.Basically pure polypeptide can produce single master tape on non-reduced polyacrylamide gel.The purity of people's shearing and polyadenylic acid specific factor subunit 66 polypeptide can be used amino acid sequence analysis.

The invention provides a kind of shearing and polyadenylic acid specific factor subunit 66 of new polypeptide-human, it is made up of the aminoacid sequence shown in the SEQ ID NO:2 basically.Polypeptide of the present invention can be recombinant polypeptide, natural polypeptides, synthetic polypeptide, preferred recombinant polypeptide.Polypeptide of the present invention can be the product of natural purifying, or the product of chemosynthesis, or uses recombinant technology to produce from protokaryon or eucaryon host (for example, bacterium, yeast, higher plant, insect and mammalian cell).The host used according to the recombinant production scheme, polypeptide of the present invention can be glycosylated, maybe can be nonglycosylated.Polypeptide of the present invention also can comprise or not comprise initial methionine residues.

The present invention also comprises people's the shearing and fragment, derivative and the analogue of polyadenylic acid specific factor subunit 66.As used herein, term " fragment ", " derivative " are meant shearing biological function or the active polypeptide identical with the polyadenylic acid specific factor subunit 66 that keeps people of the present invention basically with " analogue ".The fragment of polypeptide of the present invention, derivative or analogue can be: (I) is a kind of like this, wherein one or more amino-acid residues are replaced by conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the amino acid that replaces can be also can not encoded by genetic codon; Perhaps (II) is a kind of like this, and certain group on wherein one or more amino-acid residues is replaced by other group and comprises substituting group; Perhaps (III) is a kind of like this, and wherein mature polypeptide and another kind of compound (such as the compound that prolongs the polypeptide transformation period, for example polyoxyethylene glycol) merge; Perhaps (IV) is a kind of like this, wherein additional aminoacid sequence is integrated into mature polypeptide and the peptide sequence that forms (as leader sequence or secretion sequence or be used for the sequence or the proteinogen sequence of this polypeptide of purifying) by the elaboration of this paper, such fragment, derivative and analogue are considered within those skilled in the art's ken.

The invention provides isolating nucleic acid (polynucleotide), substantially the polynucleotide that have a polypeptide of SEQ ID NO:2 aminoacid sequence by coding are formed.Polynucleotide sequence of the present invention comprises the nucleotide sequence of SEQ ID NO:1.Polynucleotide of the present invention are to find from the cDNA library of people's fetal brain tissue.The polynucleotide sequence total length that it comprises is 2234 bases, its open reading frame (129--2183) 684 amino acid of having encoded.Relatively find according to amino acid sequence homologous, the CPSF-73kD protein subunit of this polypeptide and ox has 99% homology, and the shearing that deducibility goes out this people and polyadenylic acid specific factor subunit 66 have the similar 26S Proteasome Structure and Function of CPSF-73kD protein subunit of ox.

Polynucleotide of the present invention can be dna form or rna form.Dna form comprises the DNA of cDNA, genomic dna or synthetic.DNA can be strand or double-stranded.DNA can be coding strand or noncoding strand.The coding region sequence of encoding mature polypeptide can be identical with the coding region sequence shown in the SEQ ID NO:1 or the varient of degeneracy.As used herein, " varient of degeneracy " are meant that in the present invention coding has protein or the polypeptide of SEQ ID NO:2, but with the differentiated nucleotide sequence of coding region sequence shown in the SEQ ID NO:1.

The polynucleotide of the mature polypeptide of coding SEQ ID NO:2 comprise: the encoding sequence that has only mature polypeptide; The encoding sequence of mature polypeptide and various additional code sequence; Encoding sequence of mature polypeptide (with optional additional code sequence) and non-coding sequence.

Term " polynucleotide of coded polypeptide " is meant polynucleotide that comprise this polypeptide of encoding and the polynucleotide that comprise additional code and/or non-coding sequence.

The invention still further relates to the varient of foregoing description polynucleotide, its coding has the polypeptide of identical aminoacid sequence or segment, analogue and the derivative of polypeptide with the present invention.The varient of these polynucleotide can be the allelic variant of natural generation or the varient that non-natural takes place.These nucleotide diversity bodies comprise and replace varient, deletion mutation body and insert varient.As known in the art, allelic variant is the replacement form of polynucleotide, and it may be replacement, disappearance or the insertion of one or more Nucleotide, but can be from not changing the function of its encoded polypeptides in fact.

The invention still further relates to and the polynucleotide (have at least 50% between two sequences, preferably have 70% homogeny) of sequence hybridization described above.The present invention be more particularly directed under stringent condition and the interfertile polynucleotide of polynucleotide of the present invention.In the present invention, " stringent condition " is meant: (1) than hybridization under low ionic strength and the comparatively high temps and wash-out, as 0.2 * SSC, and 0.1%SDS, 60 ℃; Or (2) hybridization the time adds and to use denaturing agent, as 50% (v/v) methane amide, 0.1% calf serum/0.1%Ficoll, 42 ℃ etc.; Or (3) only at the homogeny between the two sequences at least more than 95%, be more preferably 97% and just hybridize when above.And the polypeptide of interfertile polynucleotide encoding has identical biological function and activity with the mature polypeptide shown in the SEQ ID NO:2.

The invention still further relates to nucleic acid fragment with sequence hybridization described above.As used herein, the length of " nucleic acid fragment " contain 10 Nucleotide at least, better are 20-30 Nucleotide at least, are more preferably 50-60 Nucleotide at least, preferably more than at least 100 Nucleotide.Nucleic acid fragment also can be used for the amplification technique (as PCR) of nucleic acid to determine and/or separation coding people's the shearing and the polynucleotide of polyadenylic acid specific factor subunit 66.

Polypeptide among the present invention and polynucleotide preferably provide with isolating form, more preferably are purified to homogeneous.

The coding people's of the present invention shearing and the special polynucleotide sequence of polyadenylic acid specific factor subunit 66 can obtain with several different methods.For example, separate polynucleotide with hybridization technique well known in the art.These technology including, but not limited to: 1) with probe and genome or the hybridization of cDNA library to detect homologous polynucleotide sequence and 2) antibody screening of expression library to be to detect the polynucleotide passage of the clone with common structure feature.

Sequence dna fragment of the present invention also can obtain with following method: 1) separate double chain DNA sequence from genomic dna; 2) the chemical synthesising DNA sequence is to obtain the double-stranded DNA of described polypeptide.

In the above-mentioned method of mentioning, isolation of genomic DNA is least commonly used.The direct chemical of dna sequence dna is synthetic to be the method for often selecting for use.The more frequent method of selecting for use is the separation of cDNA sequence.The standard method that separates interested cDNA is from the donorcells separating mRNA of this gene of high expression level and carries out reverse transcription, forms plasmid or phage cDNA library.Extract the existing multiple proven technique of method of mRNA, test kit also can obtain (Qiagene) from commercial channels.And the construction cDNA library also is usual method (Sambrook, et a1., MolecularCloning, A Laboratory Manual, Cold Spring Harbor Laboratory.New York, 1989).Also can obtain the cDNA library of commercial offers, as the different cDNA library of Clontech company.When being used in combination the polymeric enzyme reaction technology, even few expression product also can be cloned.

Available ordinary method is screened gene of the present invention from these cDNA libraries.These methods include, but is not limited to: (1) DNA-DNA or DNA-RNA hybridization; (2) appearance of marker gene function or forfeiture; (3) level of the transcript of mensuration people's shearing and polyadenylic acid specific factor subunit 66; (4), detect the protein product of genetic expression by immunological technique or mensuration biologic activity.Aforesaid method can singly be used, but also several different methods combined utilization.

In (1) kind method, hybridizing used probe is and any a part of homology of polynucleotide of the present invention that at least 10 Nucleotide of its length better are at least 30 Nucleotide, are more preferably at least 50 Nucleotide, preferably at least 100 Nucleotide.In addition, within 2000 Nucleotide, preferable is within 1000 Nucleotide to the length of probe usually.Probe used herein is the dna sequence dna of chemosynthesis on the basis of gene order information of the present invention normally.Gene of the present invention itself or fragment are certainly as probe.The mark of dna probe can be used radio isotope, fluorescein or enzyme (as alkaline phosphatase) etc.

In (4) kind method, detect people's the shearing and the protein product of polyadenylic acid specific factor subunit 66 genetic expression and can use immunological technique such as Western blotting, radioimmunoprecipitation, enzyme-linked immunosorbent assay (ELISA) etc.

Use method (Sai ki, the et al.Science1985 of round pcr DNA amplification/RNA; 230:1350-1354) be optimized for acquisition gene of the present invention.When particularly being difficult to from the library, obtain the cDNA of total length, can preferably use RACE method (the terminal rapid amplifying method of RACE-cDNA), the primer that is used for PCR can suitably be selected according to polynucleotide sequence information of the present invention disclosed herein, and available ordinary method is synthetic.Available ordinary method is as the DNA/RNA fragment by gel electrophoresis separation and purifying amplification.

The gene of the present invention that obtains as mentioned above, perhaps the polynucleotide sequence of various dna fragmentations etc. can with ordinary method such as dideoxy chain termination (Sanger et al.PNAS, 1977,74:5463-5467) measure.This class polynucleotide sequence is measured also available commercial sequencing kit etc.In order to obtain the cDNA sequence of total length, order-checking need be carried out repeatedly.Sometimes need to measure a plurality of clones' cDNA sequence, just can be spliced into the cDNA sequence of total length.

The present invention also relates to comprise the carrier of polynucleotide of the present invention, and with shearing and the polyadenylic acid specific factor subunit 66 encoding sequence of carrier of the present invention or directly personnel selection host cell, and the method that produces polypeptide of the present invention through recombinant technology through the genetically engineered generation.

Among the present invention, coding people's the shearing and the polynucleotide sequence of polyadenylic acid specific factor subunit 66 can be inserted in the carrier, contain the recombinant vectors of polynucleotide of the present invention with formation.Term " carrier " refers to that bacterial plasmid well known in the art, phage, yeast plasmid, vegetable cell virus, mammalian cell virus are as adenovirus, retrovirus or other carrier.The carrier of Shi Yonging includes but not limited in the present invention: and the expression vector based on the T7 promotor of in bacterium, expressing (Rosenberg, et a1.Gene, 1987,56:125); The pMSXND expression vector of in mammalian cell, expressing (Lee and Nathans, J Bio Chem.263:3521,1988) and at the carrier that derives from baculovirus of expressed in insect cells.In a word, as long as can duplicate in host and stablize, any plasmid and carrier may be used to make up recombinant expression vector.A key character of expression vector is to contain replication origin, promotor, marker gene and translational control element usually.

Method well-known to those having ordinary skill in the art can be used to make up shearing and the dna sequence dna of polyadenylic acid specific factor subunit 66 and the expression vector of suitable transcribing/translational control element that contains the people that encodes.These methods comprise (Sambroook, et al.Molecular Cloning, a Laboratory Manual, cold Spring Harbor Laboratory.NewYork, 1989) such as extracorporeal recombinant DNA technology, DNA synthetic technology, the interior recombinant technologys of body.Described dna sequence dna can effectively be connected on the suitable promotor in the expression vector, and is synthetic to instruct mRNA.The representative example of these promotors has: colibacillary lac or trp promotor; The PL promotor of lambda particles phage; Eukaryotic promoter comprises LTRs and some other known may command gene expression promoter in prokaryotic cell prokaryocyte or eukaryotic cell or its virus of CMV immediate early promoter, HSV thymidine kinase promoter, early stage and late period SV40 promotor, retrovirus.Expression vector also comprises ribosome bind site that translation initiation is used and transcription terminator etc.Inserting enhancer sequence in carrier will make its transcribing in higher eucaryotic cells be enhanced.Enhanser is the cis acting factor that DNA expresses, and nearly 10 to 300 base pairs act on promotor transcribing with enhancing gene usually.Can for example be included in the SV40 enhanser of 100 to 270 base pairs of replication origin side in late period one, strengthen in the polyoma of replication origin side in late period one and give and adenovirus enhanser etc.

In addition, expression vector preferably comprises one or more selected markers, to be provided for selecting the phenotypic character of transformed host cells, cultivate Tetrahydrofolate dehydrogenase, neomycin resistance and the green fluorescent protein (GFP) of usefulness as eukaryotic cell, or be used for colibacillary tsiklomitsin or amicillin resistance etc.

Persons skilled in the art all know how to select appropriate carriers/transcriptional regulatory element (as promotor, enhanser etc.) and selected marker.

Among the present invention, the polynucleotide of coding people's shearing and polyadenylic acid specific factor subunit 66 or the recombinant vectors that contains these polynucleotide can transform or transduce into host cell, contain the genetically engineered host cell of these polynucleotide or recombinant vectors with formation.Term " host cell " refers to prokaryotic cell prokaryocyte, as bacterial cell; Or eukaryotic cell such as low, as yeast cell; Or higher eucaryotic cells, as mammalian cell.Representative example has: intestinal bacteria, streptomyces; Bacterial cell such as Salmonella typhimurium; Fungal cell such as yeast; Vegetable cell; Insect cell such as fruit bat S2 or Sf9; Zooblast such as CHO, COS or Bowes melanoma cells etc.

Can carry out with routine techniques well known to those skilled in the art with dna sequence dna of the present invention or the recombinant vectors transformed host cell that contains described dna sequence dna.When the host was prokaryotic organism such as intestinal bacteria, the competent cell that can absorb DNA can be used CaCl in exponential growth after date results ₂Method is handled, and used step is well-known in this area.Alternative is to use MgCl ₂If desired, transforming also the method for available electroporation carries out.When the host is an eukaryote, can select following DNA transfection method for use: coprecipitation of calcium phosphate method, perhaps conventional mechanical method such as microinjection, electroporation, liposome packing etc.

By the recombinant DNA technology of routine, utilize polynucleotide sequence of the present invention to can be used to express or produce the people's of reorganization shearing and polyadenylic acid specific factor subunit 66 (Science, 1984; 224:1431).In general following steps are arranged:

(1). with the polynucleotide (or varient) of everybody shearing of coding of the present invention and polyadenylic acid specific factor subunit 66, or transform or the transduction proper host cell with the recombinant expression vector that contains these polynucleotide;

(2). in suitable medium, cultivate host cell;

(3). separation, protein purification from substratum or cell.

In step (2), according to used host cell, used substratum can be selected from various conventional substratum in the cultivation.Under the condition that is suitable for the host cell growth, cultivate.After host cell grows into suitable cell density, induce the promotor of selection with suitable method (as temperature transition or chemical induction), cell is cultivated for some time again.

In step (3), recombinant polypeptide can wrap and be expressed or be secreted into the extracellular in cell or on cytolemma.If desired, can utilize its physics, the separating by various separation methods with other characteristic and the albumen of purification of Recombinant of chemistry.These methods are well-known to those skilled in the art.These methods include, but are not limited to: conventional renaturation is handled, protein precipitant is handled (salt analysis method), centrifugal, the broken bacterium of infiltration, the combination of ultrasonication, super centrifugal, sieve chromatography (gel-filtration), adsorption chromatography, ion exchange chromatography, high performance liquid chromatography (HPLC) and other various liquid chromatography (LC) technology and these methods.

The antagonist of polypeptide of the present invention and this polypeptide, agonist and inhibitor can be directly used in disease treatment, for example, can treat malignant tumour, adrenal gland defect, tetter, all kinds of inflammation, HIV infection and immunological disease etc.

The present invention also provides SCREENED COMPOUND to improve (agonist) or check (antagonist) people's shearing and the method for the medicament of polyadenylic acid specific factor subunit 66 to identify.Agonist improves people's shearing and polyadenylic acid specific factor subunit 66 biological function such as stimulate cellular proliferation, and antagonist prevention disorder such as the various cancer relevant with cell hyperproliferation with treatment.For example, can in the presence of medicine, the shearing of mammalian cell or expressing human be cultivated with the polyadenylic acid specific factor subunit 66 with the people's of mark shearing with the film preparation of polyadenylic acid specific factor subunit 66.Measure the medicine raising then or check this interactional ability.

The antagonist of people's shearing and polyadenylic acid specific factor subunit 66 comprises antibody, compound, acceptor disappearance thing and the analogue etc. that filter out.People's shearing can combine and eliminate its function with the polyadenylic acid specific factor subunit 66 with people's shearing with the antagonist of polyadenylic acid specific factor subunit 66, or suppress the generation of this polypeptide, or combine with the avtive spot of this polypeptide and to make this polypeptide can not bring into play biological function.

In screening during as the compound of antagonist, people's shearing and polyadenylic acid specific factor subunit 66 can be added during bioanalysis measures, interactional influence between people's shearing and polyadenylic acid specific factor subunit 66 and its acceptor be determined whether compound is antagonist by measuring compound.With the same quadrat method of above-mentioned SCREENED COMPOUND, can filter out the acceptor disappearance thing and the analogue of antagonist action.Can be incorporated into the rondom polypeptide storehouse that solid formation forms by the various amino acid that may make up by screening with people's shearing and polyadenylic acid specific factor subunit 66 bonded peptide molecule obtains.During screening, the shearing and the polyadenylic acid specific factor subunit 66 molecule of generally tackling the people carry out mark.

The invention provides and use polypeptide, and fragment, derivative, analogue or their cell are as the method for antigen with production antibody.These antibody can be polyclonal antibody or monoclonal antibody.The present invention also provides the antibody at people's shearing and polyadenylic acid specific factor subunit 66 antigenic determinant.These antibody include, but is not limited to: the fragment that polyclonal antibody, monoclonal antibody, chimeric antibody, single-chain antibody, Fab fragment and Fab expression library produce.

The method of shearing that the production of polyclonal antibody can be chosen and polyadenylic acid specific factor subunit 66 direct injection immune animal (as rabbit, mouse, rat etc.) obtains, and multiple adjuvant can be used for the enhancing immunity reaction, includes but not limited to freund's adjuvant etc.The technology of preparation people's the shearing and the monoclonal antibody of polyadenylic acid specific factor subunit 66 includes but not limited to hybridoma technology (Kohler and Milstein.Nature, 1975,256:495-497), three knurl technology, people B-quadroma technology, EBV-hybridoma technology etc.With the variable region bonded chimeric antibody in human constant region and inhuman source can with existing technology production (Morrison etal, PNAS, 1985,81:6851).And the technology of existing manufacture order chain antibody (U.S.Pat No.4946778) also can be used for producing anti-people's the shearing and the single-chain antibody of polyadenylic acid specific factor subunit 66.

The antibody of anti-people's shearing and polyadenylic acid specific factor subunit 66 can be used in the immunohistochemistry technology, detects shearing and the polyadenylic acid specific factor subunit 66 of the people in the biopsy specimen.

With people's shearing and the also available labelled with radioisotope of polyadenylic acid specific factor subunit 66 bonded monoclonal antibody, inject in the body and can follow the tracks of its position and distribution.This radiolabeled antibody can be used as a kind of atraumatic diagnostic method and is used for the location of tumour cell and has judged whether transfer.

Antibody also can be used for designing the immunotoxin at a certain privileged sites in the body.As the monoclonal antibody of people's shearing and polyadenylic acid specific factor subunit 66 high-affinity can with bacterium or plant poison (as diphtheria toxin, ricin, abrine etc.) covalent attachment.A kind of usual method is with sulfydryl linking agent such as SPDP, attacks the amino of antibody, by the exchange of disulfide linkage, toxin is incorporated on the antibody, and this hybrid antibody can be used for killing people's shearing and polyadenylic acid specific factor subunit 66 positive cells.

The disease that antibody among the present invention can be used for treating or prevention is relevant with the polyadenylic acid specific factor subunit 66 with people's shearing.The antibody that gives suitable dosage can stimulate or block people's the shearing and the generation or the activity of polyadenylic acid specific factor subunit 66.

The invention still further relates to quantitative and detection and localization people's the shearing and the diagnostic testing process of polyadenylic acid specific factor subunit 66 level.These tests are known in the art, and comprise that FISH measures and radioimmunoassay.The people's who is detected in the test shearing and polyadenylic acid specific factor subunit 66 level can and be used to diagnose people's shearing and the disease that the polyadenylic acid specific factor subunit 66 works with the people's that lays down a definition shearing and the importance of polyadenylic acid specific factor subunit 66 in various diseases.

Polypeptide of the present invention also can be used as the peptide spectrum analysis, for example, the polypeptide available physical, chemistry or enzyme carry out the specificity cutting, and carries out the two-dimentional or three-dimensional gel electrophoresis analysis of one dimension, be more preferably and carry out mass spectroscopy.

Coding people's the shearing and the polynucleotide of polyadenylic acid specific factor subunit 66 also can be used for multiple therapeutic purpose.Gene therapy technology can be used for treating because cell proliferation, growth or the metabolic disturbance due to the nothing expression of people's shearing and polyadenylic acid specific factor subunit 66 or the unusual/non-activity expression.The gene therapy vector (as virus vector) of reorganization can be designed for the people's who expresses variation shearing and polyadenylic acid specific factor subunit 66, with shearing and the polyadenylic acid specific factor subunit 66 activity that suppresses endogenic people.For example, a kind of people's of variation shearing and polyadenylic acid specific factor subunit 66 can be shearing and the polyadenylic acid specific factor subunit 66s that shortens, lacked the people in signal conduction function territory, though can combine with the substrate in downstream, lack signaling activity.Therefore the gene therapy vector of reorganization can be used for treating people's the shearing and the disease of expression of polyadenylic acid specific factor subunit 66 or active caused by abnormal.Deriving from viral expression vector such as retrovirus, adenovirus, adeno-associated virus (AAV), hsv, parvovirus etc. can be used for coding people's the shearing and the polynucleotide of polyadenylic acid specific factor subunit 66 are transferred in the cell.The method of recombinant viral vector that structure carries the polynucleotide of coding people's shearing and polyadenylic acid specific factor subunit 66 is found in existing document (Sambrook, et al.).The polynucleotide of reorganization coding people's shearing and polyadenylic acid specific factor subunit 66 can be packaged in the liposome and be transferred in the cell in addition.

Polynucleotide import tissue or intracellular method comprises: directly be injected into polynucleotide in the in-vivo tissue; Or external by carrier (as virus, phage or plasmid etc.) earlier with the polynucleotide transfered cell in, again cell is transplanted in the body etc.

Suppress the oligonucleotide (comprising sense-rna and DNA) of people's shearing and polyadenylic acid specific factor subunit 66 mRNA and ribozyme also within the scope of the invention.Ribozyme is the enzyme sample RNA molecule that a kind of energy specificity is decomposed specific RNA, and its mechanism of action is to carry out the endonuclease effect after ribozyme molecule and the hybridization of complementary target RNA-specific.The RNA of antisense and DNA and ribozyme can obtain with existing any RNA or DNA synthetic technology, as the technology widespread use of solid phase phosphoamide chemical synthesis synthetic oligonucleotide.Antisense rna molecule can be transcribed acquisition by the dna sequence dna of this RNA that encodes in external or body.This dna sequence dna has been incorporated into the downstream of rna polymerase promoter of carrier.In order to increase the stability of nucleic acid molecule, available several different methods is modified it, and as increasing the sequence length of both sides, the connection between the ribonucleoside is used phosphoric acid thioester bond or peptide bond but not phosphodiester bond.

The polynucleotide of coding people's shearing and polyadenylic acid specific factor subunit 66 can be used for the diagnosis with the relative disease of people's shearing and polyadenylic acid specific factor subunit 66.The expression that the polynucleotide of coding people's shearing and polyadenylic acid specific factor subunit 66 can be used for detecting people's shearing and polyadenylic acid specific factor subunit 66 people's shearing and unconventionality expression of polyadenylic acid specific factor subunit 66 whether or under morbid state.As the dna sequence dna of the people's that encodes shearing and polyadenylic acid specific factor subunit 66 can be used for biopsy specimen is hybridized with judgement people's the shearing and the expression situation of polyadenylic acid specific factor subunit 66.Hybridization technique comprises the Southern blotting, Northern blotting, in situ hybridization etc.These technological methods all are disclosed mature technologies, and relevant test kit all can obtain from commercial channels.Part or all of polynucleotide of the present invention can be used as probe stationary on microarray (Microarray) or DNA chip (being called " gene chip " again), is used for analyzing the differential expression analysis and the gene diagnosis of tissue gene.The special primer of the shearing of personnel selection and polyadenylic acid specific factor subunit 66 carries out RNA-polymerase chain reaction (RT-PCR) amplification in vitro and also can detect people's the shearing and the transcription product of polyadenylic acid specific factor subunit 66.

The shearing that detects the people and the sudden change of polyadenylic acid specific factor subunit 66 gene also can be used for diagnosing people's the shearing disease relevant with the polyadenylic acid specific factor subunit 66.The form of people's shearing and polyadenylic acid specific factor subunit 66 sudden change comprises that the point mutation compared with polyadenylic acid specific factor subunit 66 dna sequence dna with normal wild type people's shearing, transposition, disappearance, reorganization and other are any unusual etc.Available existing technology such as Southern blotting, dna sequence analysis, PCR and in situ hybridization detect sudden change.In addition, sudden change might influence proteic expression, therefore can judge indirectly that with Northern blotting, Western blotting gene has or not sudden change.

Sequence of the present invention identifies it also is valuable to karyomit(e).This sequence can be specifically at certain bar human chromosome particular location and and can with its hybridization.At present, need to identify the concrete site of each gene on the karyomit(e).Now, have only chromosomal marker thing seldom to can be used for the marker chromosomes position based on actual sequence data (repetition polymorphism).According to the present invention, for these sequences are associated with disease related gene, its important the first step is positioned these dna sequence dnas on the karyomit(e) exactly.

In brief, prepare PCR primer (preferred 15-35bp), sequence can be positioned on the karyomit(e) according to cDNA.Then, these primers are used for the somatocyte hybrid cell that the PCR screening contains each bar human chromosome.Have only those hybrid cells that contain corresponding to the people's gene of primer can produce the fragment of amplification.

The PCR localization method of somatocyte hybrid cell is that DNA is navigated to concrete chromosomal quick method.Use Oligonucleolide primers of the present invention,, can utilize one group to realize inferior location from specific chromosomal fragment or a large amount of genomic clone by similar approach.Other the similar strategy that can be used for chromosomal localization comprises in situ hybridization, uses the karyomit(e) prescreen and the hybridization preliminary election of the airflow classification of mark, thereby makes up the special cDNA storehouse of karyomit(e).

The cDNA clone is carried out fluorescence in situ hybridization (FISH) with Metaphase Chromosome, can in a step, accurately carry out chromosomal localization.The summary of this technology is referring to Verma etc., Human Chromosomes:a Manualof Basic Techniques, Pergamon Press, New York (1988).

In case sequence is positioned to chromosome position accurately, the physical location of this sequence on karyomit(e) just can be associated with the gene map data.These data for example are found in, V.Mckusick, MendelianInheritance in Man (can by with the online acquisition of Johns Hopkins University Welch Medical Library).Can pass through linkage analysis then, determine gene and navigated to relation between the disease on the chromosomal region already.

Then, need to measure ill and not cDNA between diseased individuals or genome sequence difference.If observe certain sudden change in some or all of diseased individuals, and this sudden change is not observed in any normal individual, then this sudden change may be the cause of disease of disease.More ill and diseased individuals not is usually directed at first seek the variation of structure in the karyomit(e), as from the horizontal visible of karyomit(e) or use based on detectable disappearance of the PCR of cDNA sequence or transposition.Resolving power according to present physical mapping and assignment of genes gene mapping technology, being accurately positioned to the cDNA of the chromosomal region relevant with disease, can be a kind of (the supposing that 1 megabasse mapping resolving power and every 20kb are corresponding to a gene) between 50 to 500 potential Disease-causing genes.

Polypeptide of the present invention, polynucleotide and stand-in thereof, agonist, antagonist and inhibitor and suitable pharmaceutical carrier combination back can be used.These carriers can be water, glucose, ethanol, salt, damping fluid, glycerine and their combination.Composition comprises the polypeptide or the antagonist of safe and effective amount and carrier and the vehicle that does not influence effect of drugs.These compositions can be used as medicine and are used for disease treatment.

The present invention also provides medicine box or the test kit that contains one or more containers, and one or more medicinal compositions compositions of the present invention are housed in the container.With these containers, can have by the given indicative prompting of government authorities of making, using or selling medicine or biological products, the government authorities that this prompting reflects production, uses or sells permits it to use on human body.In addition, polypeptide of the present invention can be used in combination with other treatment compound.

Pharmaceutical composition can be with mode administration easily, as by in part, intravenously, intraperitoneal, intramuscular, subcutaneous, the nose or the route of administration of intracutaneous.People's shearing and polyadenylic acid specific factor subunit 66 come administration with the amount that treats and/or prevents concrete indication effectively.Be applied to patient's people's the shearing and the amount and the dosage range of polyadenylic acid specific factor subunit 66 and will depend on many factors, as administering mode, person's to be treated healthiness condition and diagnostician's judgement.

Following accompanying drawing is used to illustrate specific embodiments of the present invention, and is not used in qualification by the scope of the invention that claims defined.

Fig. 1 is the amino acid sequence homology comparison diagram of the CPSF-73kD protein subunit of the inventor's shearing and polyadenylic acid specific factor subunit 66 and ox.The top sequence is people's shearing and polyadenylic acid specific factor subunit 66, and the below sequence is the CPSF-73kD protein subunit of ox.Same amino acid represents with monocase amino acid between two sequences, similar amino acid with "+', expression.

Fig. 2 is isolating people's the shearing and the polyacrylamide gel electrophoresis figure (SDS-PAGE) of polyadenylic acid specific factor subunit 66.75.2kDa be proteinic molecular weight.The arrow indication is isolated protein band.

Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to people such as normal condition such as Sambrook, molecular cloning: laboratory manual (New York:ColdSpring Harbor Laboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.Embodiment 1: the clone of people's shearing and polyadenylic acid specific factor subunit 66

Extract the total RNA of people's tire brain with guanidinium isothiocyanate/phenol/chloroform single stage method.From total RNA, separate poly (A) mRNA with Quik mRNA Isolation Kit (Qiegene company product).2ug poly (A) mRNA forms cDNA through reverse transcription.CDNA fragment orientation is inserted on the multiple clone site of pBSK (+) carrier (Clontech company product) with Smart cDNA clone's test kit (available from Clontech), transforms DH5 α, bacterium forms the cDNA library.Measure the sequence of all clones' 5 ＇ and 3 ＇ ends with Dyeterminate cycle reaction sequencing kit (Perkin-Elmer company product) and ABI 377 automatic sequencers (Perkin-Elmer company).CDNA sequence and the existing public dna sequence data storehouse (Genebank) measured are compared, found that the cDNA sequence of one of them clone 0131c03 is new DNA.By synthetic a series of primers the contained insertion cDNA fragment of this clone is carried out two-way mensuration.The result shows, the contained full-length cDNA of 0131c03 clone is 2234bp (shown in Seq ID NO:1), from 129bp to 2183bp the open reading frame (ORF) of a 2054bp, the new protein (shown in Seq ID NO:2) of encoding arranged.We are with this clone's called after pBS-0131c03, and the name of encoded protein matter is people's shearing and polyadenylic acid specific factor subunit 66.

Embodiment 2:cDNA clone's homology retrieval

With the people's of the present invention shearing and the sequence and the encoded protein sequence thereof of polyadenylic acid specific factor subunit 66, with Blast program (Basiclocal Alignment search tool) [Altschul, SF et al.J.Mol.Biol.1990; 215:403-10], carry out the homology retrieval at databases such as Genbank, Swissport.The gene the highest with people's of the present invention shearing and polyadenylic acid specific factor subunit 66 homology is the CPSF-73kD protein subunit of a kind of known ox, and its encoded protein number is X95906 in the access of Genbank.Protein homology the results are shown in Fig. 1, both height homologies, and its homogeny is 98%.Embodiment 3: with RT-PCR method clones coding people's the shearing and the gene of polyadenylic acid specific factor subunit 66

Total RNA is a template with fetus brain cell, is that primer carries out the synthetic cDNA of reverse transcription reaction with oligo-dT, with behind the test kit purifying of Qiagene, carries out pcr amplification with following primer:

Primer1:?5’-GGAGTGACGGAAGTTGTGCTCTTGG-3’(SEQ?ID?NO:3)

Primer2:?5’-TAACAAAAGTAGAGTCAAGTATTTT-3’(SEQ?ID?NO:4)

Primer1 is the forward sequence that begins of 1bp that is positioned at the 5 ' end of SEQ ID NO:1;

Primer2 be SEQ ID NO:1 in 3 ' end reverse sequence.

The condition of amplified reaction: in the reaction volume of 50 μ l, contain 50mmol/L KCl, 10mmol/L Tris-Cl, (pH8.5), 1.5mmol/L MgCl ₂, 200 μ mol/L dNTP, 10pmol primer, the Taq archaeal dna polymerase of 1U (Clontech company product).Go up by 25 cycles of following conditioned response at PE9600 type DNA thermal cycler (Perkin-Elmer/ company): 94 ℃ of 30sec; 55 ℃ of 30sec; 72 ℃ of 2min.When RT-PCR, establish the blank negative contrast of positive contrast of β-actin and template simultaneously.Amplified production is connected to (Invitrogen company product) on the pCR carrier with the test kit purifying of QIAGEN company with TA clone test kit.The dna sequence analysis result shows that the dna sequence dna of PCR product and the 1-2234bp shown in the SEQ ID NO:1 are identical.Embodiment 4:Northern blotting analyst's shearing and polyadenylic acid specific factor subunit 66 expression of gene:

Extract total RNA[Anal.Biochem 1987,162,156-159 with single stage method].This method comprises acid guanidine thiocyanate phenol-chloroform extracting.Promptly use 4M guanidinium isothiocyanate-25mM Trisodium Citrate, 0.2M sodium acetate (pH4.0) carries out homogenate to tissue, adds the phenol of 1 times of volume and the chloroform-primary isoamyl alcohol (49: 1) of 1/5 volume, and is centrifugal after mixing.The sucking-off aqueous phase layer adds Virahol (0.8 volume) and with the centrifugal RNA precipitation that obtains of mixture.With RNA precipitation 70% washing with alcohol that obtains, dry and soluble in water.With 20 μ g RNA, on 1.2% sepharose that contains 20mM 3-(N-morpholino) propanesulfonic acid (pH7.0)-SmM sodium acetate-1mM EDTA-2.2M formaldehyde, carry out electrophoresis.Be transferred on the nitrocellulose filter then.With α- ³²P dATP prepares by random priming ³²The dna probe of p-mark.Used dna probe is the people's of pcr amplification shown in Figure 1 shearing and a polyadenylic acid specific factor subunit 66 coding region sequence (129bp to 2183bp).Probe (about 2 * 10 with the 32P-mark ⁶Cpm/ml) spend the night in 42 ℃ of hybridization in a solution with the nitrocellulose filter that has shifted RNA, this solution comprises 50% methane amide-25mM KH ₂PO ₄(pH7.4)-5 * SSC-5 * Denhardt ' s solution and 200 μ g/ml salmon sperm DNAs.After the hybridization, filter membrane is washed 30min in 55 ℃ in 1 * SSC-0.1%SDS.Then, analyze with quantitative with Phosphor Imager.Embodiment 5: the vivoexpression of the shearing of recombinant human and polyadenylic acid specific factor subunit 66, separate and purifying

According to SEQ ID NO:1 and coding region sequence shown in Figure 1, design a pair of specificity amplification primer, sequence is as follows:

Primer3:?5’-CCCGAATTCATGTCTGCGATTCCTGCTGAGGAG-3’?(Seq?ID?No:5)

Primer4:?5’-CATGCGGCCGCTCAGTGAACTGGCGTTAGGGCCT-3’(Seq?ID?No:6)

5 ' end of these two sections primers contains EcoR I and Not I restriction enzyme site respectively, be respectively the encoding sequence of target gene 5 ' end and 3 ' end thereafter, EcoR I and Not I restriction enzyme site are corresponding to expression vector plasmid pET-28b (+) (Novagen/ company product, Cat.No.69865.3) the selectivity restriction enzyme site on.With the pBS-0131c03 plasmid that contains the total length goal gene is template, carries out the PCR reaction.The PCR reaction conditions is: contain pBS-0131c03 plasmid 10pg, primer Primer-3 and Primer-4 among the cumulative volume 50 μ l and be respectively 10pmol, Advantage polymerase Mix (Clontech company product) 1 μ l.Loop parameter: 94 ℃ of 20s, 60 ℃ of 30s, 68 ℃ of 2min, totally 25 circulations.Respectively amplified production and plasmid pET-28 (+) are carried out double digestion with EcoR I and Not I, reclaim big fragment respectively, and connect with the T4 ligase enzyme.Connect product and transform, after the dull and stereotyped overnight incubation of the LB that contains kantlex (final concentration 30 μ g/ml), use the colony polymerase chain reaction (PCR) method screening positive clone, and check order with the big enterobacterial DH5 of Calcium Chloride Method α.Select the correct positive colony of sequence (pET-0131c03) with Calcium Chloride Method with recombinant plasmid transformed e. coli bl21 (DE3) plySs (Novagen company product).In the LB liquid nutrient medium that contains kantlex (final concentration 30 μ g/ml), host bacterium BL21 (pET-0131c03) is cultured to logarithmic phase at 37 ℃, adds IPTG to final concentration 1mmol/L, continues to cultivate 5 hours.Centrifugal collection thalline, through the broken bacterium of ultrasonic wave, centrifugal collection supernatant, with carrying out chromatography, obtained the target protein people's of purifying shearing and polyadenylic acid specific factor subunit 66 with 6 Histidines (6His-Tag) bonded affinity column His.Bind Quick Cartridge (Novagen company product).Through the SDS-PAGE electrophoresis, obtain a single band (Fig. 2) at the 75.2kDa place.This band is transferred on the pvdf membrane carries out the n terminal amino acid sequential analysis with the Edams hydrolysis method, 15 amino acid of N-end hold 15 amino-acid residues identical with the N-shown in the SEQ ID NO:2 as a result.Embodiment 6 anti-people's shearing and polyadenylic acid specific factor subunit 66 production of antibodies

Shearing and the specific polypeptide of polyadenylic acid specific factor subunit 66 with the synthetic following people of Peptide synthesizer (PE company product):

NH ₂-Met-Ser-Ala-Ile-Pro-Ala-Glu-Glu-Ser-Asp-Gln-Leu-Leu-Ile-Arg-COOH(SEQ?ID?NO:7)。Form compoundly with hemocyanin and bovine serum albumin coupling this polypeptide respectively, method is referring to Avrameas, et al.Immunochemistry, 1969; 6:43.Add the complete Freund's adjuvant immunizing rabbit with the above-mentioned hemocyanin polypeptide complex of 4mg, add the incomplete Freund's adjuvant booster immunization once with the hemocyanin polypeptide complex again after 15 days.Employing is done the titre that ELISA measures antibody in the rabbit anteserum through the titer plate of 15 μ g/ml bovine serum albumin polypeptide complex bag quilts.From the rabbit anteserum of antibody positive, separate total IgG with albumin A-Sepharose.Polypeptide is incorporated on the Sepharose4B post of cyanogen bromide-activated, from total IgG, separates anti-peptide antibody with affinity chromatography.Immuno-precipitation proof antibody purified can combine with the polyadenylic acid specific factor subunit 66 with people's shearing specifically.

Sequence table (1) general information: (ⅱ) denomination of invention: people's shearing and polyadenylic acid specific factor subunit 66 and encoding sequence (ⅲ) sequence number thereof: the information of 7 (2) SEQ ID NO:1: (ⅰ) sequence signature:

(A) length: 2234bp

(B) type: nucleic acid

(C) chain: two strands

( D ) ： ( ⅱ ) ：cDNA ( ⅹⅰ ) ：SEQ ID NO:1: 1 GGAGTGACGGAAGTTGTGCTCTTGGTGAATGGGGTTCTTCCTTTTTTATTTACCGGTGGC 61 TGTGCTTCCAATTTAGGAAGACCCCGGCGACCTGTTCCTCACCCCCGCTTCGCCCTCACA121 CTTTCGGGATGTCTGCGATTCCTGCTGAGGAGAGCGACCAGCTGCTGATCCGACCCCTTG181 GAGCTGGGCAAGAAGTAGGAAGATCATGTATTATTCTCGAGTTCAAAGGAAGAAAAATAA241 TGCTCGACTGTGGGATCCACCCTGGCCTAGAAGGAATGGATGCTCTTCCTTATATTGATT301 TAATTGACCCAGCTGAGATTGATCTCCTATTAATTAGTCATTTCCATTTGGATCACTGTG361 GAGCTCTGCCCTGGTTTCTACAGAAGACAAGTTTCAAAGGAAGAACATTTATGACTCATG421 CCACAAAAGCTATTTATAGATGGCTTCTTTCTGATTATGTCAAAGTTAGTAACATATCAG481 CAGACGACATGCTGTATACCGAGACAGATTTGGAAGAAAGCATGGACAAAATTGAAACTA541 TCAACTTTCATGAAGTTAAGGAAGTTGCGGGAATCAAGTTTTGGTGTTACCATGCAGGTC601 ACGTCCTAGGAGCCGCCATGTTCATGATTGAGATCGCAGGCGTGAAGCTTTTGTACACTG661 GTGATTTCTCAAGACAAGAAGATAGGCACTTAATGGCAGCTGAAATTCCTAATATTAAGC721 CTGATATTCTTATCATTGAATCTACTTATGGGACCCATATCCATGAGAAACGTGAAGAGC781 GAGAAGCAAGATTCTGTAACACTGTCCACGATATTGTAAACAGAGGAGGCAGGGGTCTCA841 TTCCTGTCTTTGCTCTTGGAAGGGCTCAGGAGCTGCTCTTGATTCTAGATGAGTACTGGC901 AGAATCACCCAGAACTACATGACATTCCAATATACTATGCATCATCTTTGGCCAAGAAGT961 GTATGGCAGTGTACCAGACATATGTAAATGCCATGAATGACAAAATCCGCAAACAGATCA1021 ACATCAATAATCCCTTTGTTTTCAAACACATTAGTAACCTCAAGAGCATGGATCATTTTG1081 ATGACATTGGTCCCAGTGTTGTAATGGCCTCCCCAGGCATGATGCAAAGTGGCTTATCCA1141 GAGAATTATTTGAAAGCTGGTGTACTGATAAGAGGAATGGTGTCATTATAGCGGGATACT1201 GTGTAGAAGGGACACTTGCCAAGCACATCATGTCTGAACCTGAAGAAATCACTACTATGT1261 CTGGACAGAAGTTACCACTGAAAATGTCTGTTGATTACATTTCTTTCTCAGCTCACACGG1321 ATTACCAGCAAACCAGTGAATTTATTCGTGCTTTGAAACCGCCTCATGTGATTTTAGTCC1381 ATGGAGAACAGAATGAAATGGCCAGATTGAAAGCAGCACTGATTCGAGAATATGAAGATA1441 ACGATGAAGTTCACATAGAGGTTCATAATCCTCGGAATACAGAAGCAGTGACCTTAAACT1501 TCAGAGGAGAAAAACTAGCCAAGGTTATGGGATTTTTAGCAGACAAAAAACCAGAACAAG1561 GCCAGCGGGTCTCAGGAATACTTGTTAAAAGAAACTTTAATTATCACATACTTTCTCCTT1621 GCGACCTGTCCAATTATACTGACCTGGCCATGAGCACGGTGAAGCAGACCCAAGCCATTC1681 CATATACTGGTCCCTTTAATTTGCTCTGTTACCAGCTGCAGAAATTGACAGGTGATGTGG1741 AAGAATTAGAAATTCAAGAAAAACCTGCTCTGAAAGCGTTCAAAAATATTACTGTAATAC1801 AAGAACCAGGCATGGTGGTATTAGAATGGCTGGCAAACCCTTCTAATGATATGTATGCAG1861 ATACAGTAACAACTGTGATATTGGAAGTTCAGTCAAATCCCAAAATAAGAAAAGGTGCAG1921 TACAGAAGGTTTCTAAAAAATTAGAAATGCACGTTTACAGCAAGAGGTTGGAGATCATGC1981 TCCAGGACATATTTGGAGAAGACTGTGTAAGTGTAAAGGATGGCTCTATTCTTAGCGTCA2041 CAGTGGACGGGAAAACTGCCAACCTTAACTTGGAGACACGGACTGTAGAATGTGAAGAGG2101 GAAGTGAAGACGATGAATCCCTCCGAGAAATGGTGGAGCTGGCTGCACAGAGACTGTACG2161 AGGCCCTAACGCCAGTTCACTGAGACTGTGCCTGTATATGAACTTTGAAAAAATACTTGA2221 CTCTACTTTTGTTA ( 3 ) SEQ ID NO:2： ( ⅰ ) ：

(A) length: 684 amino acid

(B) type: amino acid

( D ) ： ( ⅱ ) ： ( ⅹi ) ：SEQ ID NO:2: 1 Met Ser Ala Ile Pro Ala Glu Glu Ser Asp Gln Leu Leu Ile Arg16 Pro Leu Gly Ala Gly Gln Glu Val Gly Arg Ser Cys Ile Ile Leu31 Glu Phe Lys Gly Arg Lys Ile Met Leu Asp Cys Gly Ile His Pro 46 Gly Leu Glu Gly Met Asp Ala Leu Pro Tyr Ile Asp Leu Ile Asp 61 Pro Ala Glu Ile Asp Leu Leu Leu Ile Ser His Phe His Leu Asp 76 His Cys Gly Ala Leu Pro Trp Phe Leu Gln Lys Thr Ser Phe Lys 91 Gly Arg Thr Phe Met Thr His Ala Thr Lys Ala Ile Tyr Arg Trp106 Leu Leu Ser Asp Tyr Val Lys Val Ser Asn Ile Ser Ala Asp Asp121 Met Leu Tyr Thr Glu Thr Asp Leu Glu Glu Ser Met Asp Lys Ile136 Glu Thr Ile Asn Phe His Glu Val Lys Glu Val Ala Gly Ile Lys151 Phe Trp Cys Tyr His Ala Gly His Val Leu Gly Ala Ala Met Phe166 Met Ile Glu Ile Ala Gly Val Lys Leu Leu Tyr Thr Gly Asp Phe181 Ser Arg Gln Glu Asp Arg His Leu Met Ala Ala Glu Ile Pro Asn196 Ile Lys Pro Asp Ile Leu Ile Ile Glu Ser Thr Tyr Gly Thr His211 Ile His Glu Lys Arg Glu Glu Arg Glu Ala Arg Phe Cys Asn Thr226 Val His Asp Ile Val Asn Arg Gly Gly Arg Gly Leu Ile Pro Val241 Phe Ala Leu Gly Arg Ala Gln Glu Leu Leu Leu Ile Leu Asp Glu256 Tyr Trp Gln Asn His Pro Glu Leu His Asp Ile Pro Ile Tyr Tyr271 Ala Ser Ser Leu Ala Lys Lys Cys Met Ala Val Tyr Gln Thr Tyr286 Val Asn Ala Met Asn Asp Lys Ile Arg Lys Gln Ile Asn Ile Asn301 Asn Pro Phe Val Phe Lys His Ile Ser Asn Leu Lys Ser Met Asp316 His Phe Asp Asp Ile Gly Pro Ser Val Val Met Ala Ser Pro Gly331 Met Met Gln Ser Gly Leu Ser Arg Glu Leu Phe Glu Ser Trp Cys346 Thr Asp Lys Arg Asn Gly Val Ile Ile Ala Gly Tyr Cys Val Glu361 Gly Thr Leu Ala Lys His Ile Met Ser Glu Pro Glu Glu Ile Thr376 Thr Met Ser Gly Gln Lys Leu Pro Leu Lys Met Ser Val Asp Tyr391 Ile Ser Phe Ser Ala His Thr Asp Tyr Gln Gln Thr Ser Glu Phe406 Ile Arg Ala Leu Lys Pro Pro His Val Ile Leu Val His Gly Glu421 Gln Asn Glu Met Ala Arg Leu Lys Ala Ala Leu Ile Arg Glu Tyr436 Glu Asp Asn Asp Glu Val His Ile Glu Val His Asn Pro Arg Asn451 Thr Glu Ala Val Thr Leu Asn Phe Arg Gly Glu Lys Leu Ala Lys466 Val Met Gly Phe Leu Ala Asp Lys Lys Pro Glu Gln Gly Gln Arg481 Val Ser Gly Ile Leu Val Lys Arg Asn Phe Asn Tyr His Ile Leu496 Ser Pro Cys Asp Leu Ser Asn Tyr Thr Asp Leu Ala Met Ser Thr511 Val Lys Gln Thr Gln Ala Ile Pro Tyr Thr Gly Pro Phe Asn Leu526 Leu Cys Tyr Gln Leu Gln Lys Leu Thr Gly Asp Val Glu Glu Leu541 Glu Ile Gln Glu Lys Pro Ala Leu Lys Ala Phe Lys Asn Ile Thr556 Val Ile Gln Glu Pro Gly Met Val Val Leu Glu Trp Leu Ala Asn571 Pro Ser Asn Asp Met Tyr Ala Asp Thr Val Thr Thr Val Ile Leu586 Glu Val Gln Ser Asn Pro Lys Ile Arg Lys Gly Ala Val Gln Lys601 Val Ser Lys Lys Leu Glu Met His Val Tyr Ser Lys Arg Leu Glu616 Ile Met Leu Gln Asp Ile Phe Gly Glu Asp Cys Val Ser Val Lys631 Asp Gly Ser Ile Leu Ser Val Thr Val Asp Gly Lys Thr Ala Asn646 Leu Asn Leu Glu Thr Arg Thr Val Glu Cys Glu Glu Gly Ser Glu661 Asp Asp Glu Ser Leu Arg Glu Met Val Glu Leu Ala Ala Gln Arg676 Leu Tyr Glu Ala Leu Thr Pro Val His ( 4 ) SEQ ID NO:3 ( ⅱ )

(A) length: 25 bases

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linear (ⅱ) molecule type: oligonucleotide (ⅹ ⅰ) sequence description: information (ⅱ) sequence signature of SEQ ID NO:3:GGAGTGACGGAAGTTGTGCTCTTGG 25 (5) SEQ ID NO:4

(A) length: 25 bases

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linear (ⅱ) molecule type: oligonucleotide (ⅹ ⅰ) sequence description: information (ⅱ) sequence signature of SEQ ID NO:4:TAACAAAAGTAGAGTCAAGTATTTT 25 (6) SEQ ID NO:5

(A) length: 33 bases

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linear (ⅱ) molecule type: oligonucleotide (ⅹ ⅰ) sequence description: information (ⅰ) sequence signature of SEQ ID NO:5:CCCGAATTCATGTCTGCGATTCCTGCTGAGGAG 33 (7) SEQ ID NO:6

(A) length: 34 bases

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linear (ⅱ) molecule type: oligonucleotide (ⅹ ⅰ) sequence description: the information of SEQ ID NO:6:CATGCGGCCGCTCAGTGAACTGGCGTTAGGGCCT 34 (8) SEQ ID NO:7:

(ⅰ) sequence signature:

(A) length: 15 amino acid

(B) type: amino acid

(D) topological framework: linear (ⅱ) molecule type: polypeptide (ⅹ ⅰ) sequence description: SEQ ID NO:7:NH ₂-Met-Ser-Ala-Ile-Pro-Ala-Glu-Glu-Ser-Asp-Gln-Leu-Leu-Ile-Arg-COOH

Claims (18)

1, a kind of isolated polypeptide-people's shearing and polyadenylic acid specific factor subunit 66 is characterized in that it includes: the polypeptide of the aminoacid sequence shown in the SEQ ID NO:2 or active fragments, analogue or the derivative of its polypeptide.

2, polypeptide as claimed in claim 1, the aminoacid sequence that it is characterized in that described polypeptide, analogue or derivative has the homogeny with the aminoacid sequence at least 95% shown in the SEQ ID NO:2.

3, polypeptide as claimed in claim 2 is characterized in that it comprises the polypeptide with the aminoacid sequence shown in the SEQ ID NO:2.

4, a kind of isolating polynucleotide, it is characterized in that described polynucleotide comprise be selected from down the group in a kind of:

(a) coding has the polynucleotide of the polypeptide of aminoacid sequence shown in the SEQ ID NO:2 or its fragment, analogue, derivative;

(b) with polynucleotide (a) complementary polynucleotide; Or

(c) with (a) or the polynucleotide of at least 99% homogeny (b) are arranged.

5, polynucleotide as claimed in claim 4 is characterized in that described polynucleotide comprise the polynucleotide that coding has aminoacid sequence shown in the SEQID NO:2.

6, polynucleotide as claimed in claim 4, the sequence that it is characterized in that described polynucleotide include the sequence of 1-2234 position among the sequence of 129-2183 position among the SEQ IDNO:1 or the SEQ ID NO:1.

7, a kind of recombinant vectors that contains exogenous polynucleotide is characterized in that it is the recombinant vectors that is formed by the described polynucleotide of arbitrary claim among the claim 4-6 and plasmid, virus or vehicle expression vector establishment.

8, a kind of genetically engineered host cell that contains exogenous polynucleotide is characterized in that it is to be selected from following a kind of host cell:

(a) host cell that transforms or transduce with the described recombinant vectors of claim 7; Or

(b) host cell that transforms or transduce with the described polynucleotide of the arbitrary claim among the claim 4-6.

9, a kind of have people's the shearing and a preparation method of the active polypeptide of polyadenylic acid specific factor subunit 66, it is characterized in that described method comprises:

(a) under the shearing and polyadenylic acid specific factor subunit 66 condition of expressing human, cultivate the described through engineering approaches host cell of claim 8;

(b) from culture, isolate shearing and the active polypeptide of polyadenylic acid specific factor subunit 66 with people.

10, a kind of can with polypeptide bonded antibody, it is characterized in that described antibody be can with people's shearing and polyadenylic acid specific factor subunit 66 specificity bonded antibody.

11, the compound of an analoglike or adjusting polypeptide active or expression is characterized in that they are simulation, promotion, antagonism or suppress people's the shearing and the active compound of polyadenylic acid specific factor subunit 66.

12, compound as claimed in claim 11 is characterized in that it is the polynucleotide sequence shown in the SEQ ID NO:1 or its segmental antisense sequences.

13, the described application of compound of a kind of claim 11, it is characterized in that described compound be used for mediator's shearing and polyadenylic acid specific factor subunit 66 in vivo, the method for external activity.

14, a kind of disease relevant or method of disease susceptibility of detecting with the described polypeptide of arbitrary claim among the claim 1-3, it is characterized in that it comprises the described polypeptide expression amount that detects, perhaps detect the activity of described polypeptide, perhaps detect and cause described expression of polypeptides amount or active unusual nucleotide diversity in the polynucleotide.

15, as the application of polypeptide as described in the arbitrary claim among the claim 1-3, it is characterized in that it is applied to screen people's the shearing and stand-in, the agonist of polyadenylic acid specific factor subunit 66, antagonist or inhibitor; Perhaps be used for the peptide finger print identification.

16, as the application of the described nucleic acid molecule of arbitrary claim among the claim 4-6, it is characterized in that it is used for nucleic acid amplification reaction as primer, perhaps be used for hybridization, perhaps be used to make gene chip or microarray as probe.

17,, it is characterized in that forming pharmaceutical composition with safe and effective dosage and pharmaceutically acceptable carrier as diagnosis or treatment and people's the shearing disease relevant unusually with the polyadenylic acid specific factor subunit 66 with described polypeptide, polynucleotide or its stand-in, agonist, antagonist or inhibitor as the described polypeptide of arbitrary claim, polynucleotide or application of compound in claim 1-6 and 11.

18, the described polypeptide of arbitrary claim, polynucleotide or the application of compound among the claim 1-6 and 11, it is characterized in that being used for the treatment of malignant tumour with described polypeptide, polynucleotide or compound, hemopathy, the medicine of HIV infection and immunological disease and all kinds of inflammation.

Images