CN1299824A - New human coupling acceptor and its code sequence - Google Patents

Abstract

The present invention discloses a novel human G-protein coupled receptor, called BioGPCR31 for short, polynucleotide for coding said polypeptide and method for producing said polypeptide by using recombination technology. Said invention also discloses the method using said polypeptide and polynucleotide to cure diseases of nervous system disturbance, endocrine system disturbance and angiocardiopathy. Said invention also discloses the antagonist for resisting said polypeptide and its therapeutic effect. Said invention also discloses the diagnostic determination method based on identification of mutation in said nucleic acid sequence and change of said polypeptide expressino level, and the application of polynucleotide coding said novel BioGPCR 31.

Description

A kind of new people's coupling acceptor and encoding sequence thereof

The invention belongs to biological technical field and field of genetic engineering, specifically, the present invention relates to a kind of new polypeptide-human G-protein coupled receptor (Novel Human G Protein Coupled Receptor is called for short " BioGPCR31 "), and the polynucleotide sequence of this polypeptide of encoding.The invention still further relates to the preparation method and the application of these polynucleotide and polypeptide.

The G-protein linked receptor all has discovery in mammalian body, have to its characteristic seven hydrophobicity membrane spaning domains, and these structural domains are across plasma membrane [Schoneberg T.et al., Mol Cell Endocrinol 1999; 151:181-93].The G-protein linked receptor comprises the bioactive acceptor of quite a few tool, as hormone, virus, somatomedin, neuroreceptor etc.G-protein linked receptor family comprise as with the Antipsychotic drug bonded Dopamine Receptors of treatment psychosis and nervous system disease, other members such as calcitonin, suprarenin, adenosine, histamine, cytomegalovirus acceptor, endothelial differentiation gene 1 acceptor, opsin, zymoplasm etc.

Heterotrimer G-albumen composition reacts to each other in activatory G-protein linked receptor and the born of the same parents, participate in various intracellular signal activity, usually with interaction [Baldwin such as guanine nucleotide binding protein, second messenger's product such as cyclisation AMP, lecithinase C, triphosphoric acid inositol, ionophorous proteins, J.M.et al., Curr.Opin.Cell Biol.6:180-190].

The conserved domain of G-protein linked receptor is membrane spaning domain and preceding two kytoplasm rings.Preceding two born of the same parents' outer shrouds of most of G-protein linked receptors all have single conserved cysteine residue.Stride diaphragm area called after TM1, TM2, TM3, TM4, TM5, TM6, TM7 for 7, wherein TM3 may be relevant with signal transduction.The phosphorylation of cysteine residues and lipid turn into the signal transduction that can influence some G-protein linked receptors.Contain phosphorylation site in ring or the carbochain end in the 3rd born of the same parents of most of G-protein linked receptors.The ligand-binding site point of G-protein linked receptor contains a wetting ability sack, and this wetting ability sack is made of membrane spaning domain usually, and is surrounded by hydrophobic amino acid residues.

Discover that the G-protein linked receptor works in many physiological processs, comprise vision, sense of smell, neurotransmission, hormone reaction etc.The sudden change of G-protein linked receptor can cause the numerous disease of human body, as diseases such as neurological disorder, endocrine system disorder, cardiovascular systems disorders.Therefore, significant for therapeutic purpose research and development human G-protein coupled receptor.

An object of the present invention is to provide isolating new polypeptide--human G-protein coupled receptor (abbreviating " BioGPCR31 " as) with and fragment, analogue and derivative.

Another object of the present invention provides the polynucleotide of this BioGPCR31 polypeptide of coding.

Another object of the present invention provides the recombinant vectors of the polynucleotide that contain the BioGPCR31 that encodes.

Another object of the present invention provides the genetically engineered host cell of the polynucleotide that contain the BioGPCR31 that encodes.

Another object of the present invention provides the method for producing BioGPCR31.

Another object of the present invention provides the antibody at BioGPCR31 polypeptide of the present invention.

Another object of the present invention has provided at the simulated compound of BioGPCR31 polypeptide of the present invention, antagonist, agonist, inhibitor.

Another object of the present invention provides the method for the diagnosis disease relevant unusually with BioGPCR31 with treatment.

In a first aspect of the present invention, novel isolated human G-protein coupled receptor (BioGPCR31) is provided, this polypeptide is the people source, and it comprises: have the polypeptide of SEQ ID NO:2 aminoacid sequence or its conservative property variation polypeptide or its active fragments or its reactive derivative, analogue.Preferably, this polypeptide is that polypeptide or its amino acid variation with SEQ ID NO:2 aminoacid sequence is no more than 5% derivative.

In a second aspect of the present invention, the polynucleotide of these polypeptide of separated coding are provided, these polynucleotide comprise a nucleotide sequence, and this nucleotide sequence is shown at least 70% homogeny with a kind of nucleotides sequence that is selected from down group: (a) polynucleotide of the above-mentioned BioGPCR31 of coding; (b) with polynucleotide (a) complementary polynucleotide.Preferably, this polynucleotide encoding has the polypeptide of aminoacid sequence shown in the SEQ ID NO:2.More preferably, the sequence of these polynucleotide is be selected from down group a kind of: the sequence that (a) has 34-873 position among the SEQ ID NO:1; (b) has the sequence of 1-3199 position among the SEQ ID NO:1.

In a third aspect of the present invention, the carrier that contains above-mentioned polynucleotide is provided, and has been transformed or host cell of transduceing or the host cell that is directly transformed or transduce by above-mentioned polynucleotide by this carrier.

Others of the present invention are because disclosing of the technology of this paper is conspicuous to those skilled in the art.

Following accompanying drawing is used to illustrate specific embodiments of the present invention, and is not used in qualification by basis that claims defined

Invention scope.

Fig. 1 is the amino acid sequence homology comparison diagram of the G-protein linked receptor (Q91178) of G-protein linked receptor of the present invention (BioGPCR31) and Oryzias latipes.Same amino acid represents with monocase amino acid that between two sequences similar amino acid is represented with "+".

As used herein, " separation " refer to material from its primal environment, separate (if crude, Primal environment namely is natural surroundings). For example, the polynucleotide under the native state in the active somatic cell and polypeptide are not divide From purifying, but same polynucleotide or polypeptide as from native state with in other materials that exist separately, then be Separation and purification.

As used herein, " BioGPCR31 albumen or the polypeptide of separation " refer to BioGPCR31 be substantially free of natural with Other albumen, lipid, carbohydrate or other material that it is relevant. Those skilled in the art can use the protein purification of standard Technology purifying BioGPCR31. Basically pure polypeptide can produce single master tape on non-reduced polyacrylamide gel. The purity of BioGPCR31 polypeptide can be determined with amino acid analysis.

The invention provides a kind of new polypeptide--BioGPCR31 polypeptide, it is by shown in the SEQ ID NO:2 basically Amino acid sequence form. Polypeptide of the present invention can be recombinant polypeptide, natural polypeptides, synthetic polypeptide, preferred restructuring Polypeptide. Polypeptide of the present invention can be the product of natural purifying, or the product of chemical synthesis, or use recombinant technique from Produce in protokaryon or the eucaryon host (for example, bacterium, yeast, higher plant, insect and mammalian cell). According to heavy The used host of group production decision, polypeptide of the present invention can be glycosylated, maybe can be nonglycosylated. The present invention Polypeptide also can comprise or not comprise initial methionine residues.

The present invention also comprises fragment, derivative and the analog of BioGPCR31. As used herein, term " fragment ", " derivative " and " analog " refer to basically keep the identical biological function of the natural BioGPCR31 of the present invention or Active polypeptide. The fragment of polypeptide of the present invention, derivative or analog can be: one or more conservative or non-guarantors (ⅰ) are arranged Keep the substituted polypeptide of acidic amino acid residue (preferred conservative amino acid residue), and the amino acid residue of such replacement can Be also can be by the genetic code coding, or (ⅱ) in one or more amino acid residues, have a substituted radical Polypeptide, or (ⅲ) mature polypeptide and another compound (such as the compound that prolongs the polypeptide half-life, for example polyethylene glycol) Merge formed polypeptide, or (ⅳ) additional amino acid sequence be fused to this peptide sequence and the polypeptide that forms (such as leading order Row or secretion sequence or be used for sequence or the proteinogen sequence of this polypeptide of purifying). According to the instruction of this paper, these fragments, spread out Biological and analog belongs to the known range of those skilled in the art.

The present invention also provides the nucleic acid (polynucleotides) that separates, and these polynucleotides have SEQ ID NO:2 ammonia by coding substantially The polynucleotides of the polypeptide of base acid sequence form. Preferably, polynucleotide sequence of the present invention has SEQ ID NO:1's Nucleotide sequence.

Polynucleotides of the present invention can be dna form or rna form. Dna form comprises cDNA, genomic DNA Or artificial synthetic DNA. DNA can be strand or double-stranded. DNA can be coding strand or noncoding strand. Coding The coding region sequence of mature polypeptide can be identical with the coding region sequence shown in the SEQ ID NO:1 or the variant of degeneracy. As used herein, " variant of degeneracy " the protein with SEQ ID NO:2 or many that refers in the present invention encode Peptide, but with the differentiated nucleotide sequence of coding region sequence shown in the SEQ ID NO:1.

The polynucleotides of the mature polypeptide of coding SEQ ID NO:2 comprise: the coded sequence that only has mature polypeptide; Maturation is many The coded sequence of peptide and various additional code sequence; The coded sequence of mature polypeptide (with optional additional code sequence) and Non-coding sequence.

Term " polynucleotides of coded polypeptide " refer to comprise encode this polypeptide polynucleotides and comprise additional code and/ Or the polynucleotides of non-coding sequence.

The invention still further relates to the variant of above-mentioned polynucleotides, it is encoded the polypeptide of identical amino acid sequence with the present invention Or the fragment of polypeptide, analog and derivative. The variant of these polynucleotides can be natural generation allelic variant or The variant that non-natural takes place. These nucleotide diversity bodies comprise and replace variant, deletion mutation body and insert variant. As known in the art, allelic variant is a kind of replacement form of polynucleotides, and it may be one or more nucleotides Replacement, disappearance or insertion, but can be from the function of the polypeptide that changes in fact its coding.

The invention still further relates to and the polynucleotides of sequence hybridization described above (have at least 50% between two sequences, excellent Choosing has 70% homogeny). The present invention be more particularly directed under stringent condition interfertile many with polynucleotides of the present invention Nucleotides. In the present invention, " stringent condition " refers to: (1) is than the hybridization under LIS and the higher temperature with wash Take off, such as 0.2 * SSC, 0.1%SDS, 60 ℃; Or (2) hybridization the time is added with denaturant, and such as 50% (v/v) formamide, 0.1% is little Cow's serum/0.1%Ficoll, 42 ℃ etc.; Or (3) only at the homogeny between the two sequences at least more than 95%, be more preferably 97% just hybridizes when above. And, the polypeptide of interfertile polynucleotide encoding and becoming shown in the SEQ ID NO:2 Ripe polypeptide has identical biological function and activity.

The invention still further relates to the nucleic acid fragment with sequence hybridization described above. As used herein, " nucleic acid fragment " Length contain at least 10 nucleotides, better be at least 30 nucleotides, be more preferably at least 50 nucleotides, preferably More than at least 100 nucleotides. Nucleic acid fragment also can be used for the amplification technique (such as PCR) of nucleic acid to determine and/or to separate and compile The polynucleotides of code BioGPCR31.

Polypeptide among the present invention preferably provides with the form of separating with polynucleotides, more preferably is purified to homogeneous.

The special polynucleotide sequence of coding BioGPCR31 of the present invention can obtain with several different methods. For example, use ability The hybridization technique that the territory is known is separated polynucleotides. These technology including, but not limited to: 1) with probe and genome or cDNA The polynucleotide sequence and 2 of homology is hybridized to detect in the library) antibody screening of expression library has the common structure spy to detect The clone's who levies polynucleotide passage.

Sequence dna fragment of the present invention also can obtain with following method: 1) separate double chain DNA sequence from genomic DNA; 2) the chemical synthesising DNA sequence is to obtain the double-stranded DNA of described polypeptide.

In the above-mentioned method of mentioning, isolation of genomic DNA is least commonly used.The direct chemical of dna sequence dna is synthetic to be the method for often selecting for use.The more frequent method of selecting for use is the separation of cDNA sequence.The standard method that separates interested cDNA is from the donorcells separating mRNA of this gene of high expression level and carries out reverse transcription, forms plasmid or phage cDNA library.Extract the existing multiple proven technique of method of mRNA, test kit also can obtain (Qiagene) from commercial channels.And the construction cDNA library also is usual method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, ColdSpring Harbor Laboratory.New York, 1989).Also can obtain the cDNA library of commercial offers, as the different cDNA library of Clontech company.When being used in combination polymerase chain reaction technique, even few expression product also can be cloned.

Available ordinary method is screened gene of the present invention from these cDNA libraries.These methods include, but is not limited to: (1) DNA-DNA or DNA-RNA hybridization; (2) appearance of marker gene function or forfeiture; (3) level of mensuration BioGPCR31 transcript; (4), detect the protein product of genetic expression by immunological technique or mensuration biologic activity.Aforesaid method can singly be used, but also several different methods combined utilization.In (1) kind method, hybridizing used probe is and any a part of homology of polynucleotide of the present invention that at least 10 Nucleotide of its length better are at least 3 Nucleotide, are more preferably at least 50 Nucleotide, preferably at least 100 Nucleotide.In addition, within 2000 Nucleotide, preferable is within 1000 Nucleotide to the length of probe usually.Probe used herein is the dna sequence dna of chemosynthesis on the basis of gene order information of the present invention normally.Gene of the present invention itself or fragment are certainly as probe.Dna probe can carry out mark with radio isotope, fluorescein or enzyme (as alkaline phosphatase) etc.

In (4) kind method, detect the protein product of BioGPCR31 genetic expression and can use immunological technique such as Western blotting, radioimmunoprecipitation, enzyme-linked immunosorbent assay (ELISA) etc.

Use method (Saiki, the et al.Science 1985 of round pcr DNA amplification/RNA; 230:1350-1354) be optimized for acquisition gene of the present invention.When particularly being difficult to from the library, obtain the cDNA of total length, can preferably use RACE method (the terminal rapid amplifying method of RACE-cDNA).The primer that is used for PCR can suitably be selected according to polynucleotide sequence information of the present invention disclosed herein, and available ordinary method is synthetic.Available ordinary method is as the DNA/RNA fragment by gel electrophoresis separation and purifying amplification.

The gene of the present invention that obtains as mentioned above or the nucleotide sequence of its various dna fragmentations, and available ordinary method such as dideoxy chain termination (Sanger et al.PNAS, 1977,74:5463-5467) measure.This class polynucleotide sequence is measured also available commercial sequencing kit.In order to obtain the cDNA sequence of total length, order-checking need be carried out repeatedly.Sometimes need to measure a plurality of clones' cDNA sequence, just can be spliced into the cDNA sequence of total length.

The present invention also relates to comprise the carrier of polynucleotide of the present invention, and with carrier of the present invention or directly with the host cell of BioGPCR31 encoding sequence through the genetically engineered generation, and the method that produces polypeptide of the present invention through recombinant technology.

Among the present invention, the polynucleotide sequence of coding BioGPCR31 can be inserted in the carrier, contains the recombinant vectors of polynucleotide of the present invention with formation.Term " carrier " refers to that bacterial plasmid well known in the art, phage, yeast plasmid, vegetable cell virus, mammalian cell virus are as adenovirus, retrovirus or other carrier.The carrier of Shi Yonging includes but not limited in the present invention; The expression vector based on the T7 promotor of in bacterium, expressing (Rosenberg, et al.Gene, 1987,56:125); The pMSXND expression vector of in mammalian cell, expressing (Lee and Nathans, J Bio Chem.263:3521,1988) and at the carrier that derives from baculovirus of expressed in insect cells.In a word, as long as can duplicate in host and stablize, any plasmid and carrier may be used to make up recombinant expression vector.A key character of expression vector is to contain replication origin, promotor, marker gene and translational control element usually.

Available method well-known to those having ordinary skill in the art makes up the dna sequence dna that contains the BioGPCR31 that encodes and the expression vector of suitable transcribing/translational control element.These methods comprise (Sambroook, et al.Molecular Cloning, a Laboratory Manual, Cold SpringHarbor Laboratory.New York, 1989) such as extracorporeal recombinant DNA technology, DNA synthetic technology, the interior recombinant technologys of body.Described dna sequence dna can effectively be connected on the suitable promotor in the expression vector, and is synthetic to instruct mRNA.The representative example of these promotors has: colibacillary lac or trp promotor; The PL promotor of lambda particles phage; Eukaryotic promoter comprises LTRs and some other known may command gene expression promoter in prokaryotic cell prokaryocyte or eukaryotic cell or its virus of CMV immediate early promoter, HSV thymidine kinase promoter, early stage and late period SV40 promotor, retrovirus.Expression vector also comprises ribosome bind site that translation initiation is used and transcription terminator etc.Inserting enhancer sequence in carrier will make its transcribing in higher eucaryotic cells be enhanced.Enhanser is the cis acting factor that DNA expresses, and nearly 10 to 300 base pairs act on promotor transcribing with enhancing gene usually.Can for example be included in the SV40 enhanser of 100 to 270 base pairs of replication origin side in late period one, at the polyoma enhanser of replication origin side in late period one and adenovirus enhanser etc.

In addition, expression vector preferably comprises one or more selected markers, to be provided for selecting the phenotypic character of transformed host cells, cultivate Tetrahydrofolate dehydrogenase, neomycin resistance and the green fluorescent protein (GFP) of usefulness as eukaryotic cell, or be used for colibacillary tsiklomitsin or amicillin resistance etc.

Persons skilled in the art all know how to select appropriate carriers/transcriptional regulatory element (as promotor, enhanser etc.) and selected marker.

Among the present invention, the polynucleotide of coding BioGPCR31 or the recombinant vectors that contains these polynucleotide can transform or transduce into host cell, contain the genetically engineered host cell of these polynucleotide or recombinant vectors with formation.Term " host cell " refers to prokaryotic cell prokaryocyte, as bacterial cell; Or eukaryotic cell such as low, as yeast cell; Or higher eucaryotic cells, as mammalian cell.The representative example of host cell has: intestinal bacteria, streptomyces; Bacterial cell such as Salmonella typhimurium; Fungal cell such as yeast; Vegetable cell; Insect cell such as fruit bat S2 or Sf9; Zooblast such as CHO, COS or Bowes melanoma cells etc.

Can carry out with routine techniques well known to those skilled in the art with dna sequence dna of the present invention or the recombinant vectors transformed host cell that contains described dna sequence dna.When the host was prokaryotic organism such as intestinal bacteria, the competent cell that can absorb DNA can be used CaCl in exponential growth after date results ₂Method is handled, and used step is well-known in this area.Also available MgCl2 carries out.If desired, transforming also the method for available electroporation carries out.When the host is an eukaryote, can select following DNA transfection method for use: coprecipitation of calcium phosphate method, perhaps conventional mechanical method such as microinjection, electroporation, liposome packing etc.

Recombinant DNA technology (Science, 1984 by routine; 224:1431), utilize polynucleotide sequence of the present invention to can be used to express or produce the BioGPCR31 of reorganization.In general following steps are arranged:

(1). with the polynucleotide (or varient) of coding of the present invention people BioGPCR31, or with the recombinant expression vector that contains these polynucleotide proper host cell that transforms or transduce;

(2). in suitable medium, cultivate the host cell that transforms or transduce;

(3). separation, protein purification from substratum or cell.

In step (2), according to used host cell, used substratum can be selected from various conventional substratum in the cultivation.Under the condition that is suitable for the host cell growth, cultivate.After host cell grows into suitable cell density, induce the promotor of selection with suitable method (as temperature transition or chemical induction), cell is cultivated for some time again.

In step (3), recombinant polypeptide can wrap and be expressed or be secreted into the extracellular in cell or on cytolemma.If desired, can utilize its physics, the separating by various separation methods with other characteristic and the albumen of purification of Recombinant of chemistry.These methods are well-known to those skilled in the art.These methods include, but are not limited to: conventional renaturation is handled, protein precipitant is handled (salt analysis method), centrifugal, the broken bacterium of infiltration, the combination of ultrasonication, super centrifugal, sieve chromatography (gel-filtration), adsorption chromatography, ion exchange chromatography, high performance liquid chromatography (HPLC) and other various liquid chromatography (LC) technology and these methods.

Human G protein-coupled receptor of the present invention all has expression in endocrine tissue, unstriated muscle, cardiac muscle, nervous tissue, and relevant with the intracellular signal activity, and works in endocrine system, neural system and cardiovascular systems disorder.

The antagonist of g protein coupled receptor or fragment or derivative can be used to treatment or prevention endocrine system disorder disease, and these endocrine system disorder diseases comprise but (being not limited to): innocent tumour, diabetes, hyperglycemia, hypoglycemia, hyperaldosteronism, thyroiditis, pheochromocytoma, internal secretion diversity deficiency symptoms, Graves disease, A Disenshi disease etc.

The antagonist of g protein coupled receptor or fragment or derivative can be used to treatment or prevention neurological disorder disease, and the neurological disorder disease includes (but are not limited to): dementia, Heng Tingdunshi disease, Parkinson's disease, epileptics, Down's syndrome, diversity sclerosis, amnesia, bradykinesia disfunction, tumour, paranoia, diversity sclerosis, schizophrenia, multiple neurofibromatosis, myodystonia, melancholia etc.

The antagonist of g protein coupled receptor or fragment or derivative can be used to treatment or prevention sympathetic nervous system disorders, and the sympathetic nervous system disorders includes (but are not limited to); Anaphylactic shock, arrhythmia, asthma, hypertension, hypoglycemia, myocardial infarction, migraine, pheochromocytoma, cardiovascular shock etc.

The antagonist of g protein coupled receptor or fragment or derivative can be used to treatment or prevention cardiovascular systems disorders, and the cardiovascular systems disorders includes (but are not limited to): arteriosclerosis, pericarditis, rheumatic heart disease, myocardial infarction, primary cardiomyopathy, myocardial ischaemia disease, coronary artery disease etc.

The present invention also provides SCREENED COMPOUND to identify the method that improves (agonist) or check the medicament of (antagonist) BioGPCR31.Agonist improves BioGPCR31 biological function such as stimulate cellular proliferation, and antagonist prevention disorder such as the various cancer relevant with cell hyperproliferation with treatment.For example, in the presence of medicine, the BioGPCR31 with mark cultivates with mammalian cell, measures the ability that medicine improves or check the BioGPCR31 effect then, thereby identifies agonist or antagonist.

The antagonist of BioGPCR31 comprises antibody, compound, acceptor disappearance thing and the analogue etc. that filter out.The antagonist of BioGPCR31 can combine and eliminate its function with the BioGPCR31 polypeptide, or suppresses the generation of this polypeptide, or combines with the avtive spot of this polypeptide and to make this polypeptide can not bring into play biological function.

In screening during as the compound of antagonist, BioGPCR31 can be added during bioanalysis measures, by measuring compound interactional influence between BioGPCR31 and its acceptor is determined whether compound is antagonist.With the same quadrat method of above-mentioned SCREENED COMPOUND, can filter out the acceptor disappearance thing and the analogue of antagonist action.Can be incorporated into the rondom polypeptide storehouse that solid formation forms by the various amino acid that may make up by screening with BioGPCR31 bonded peptide molecule obtains.During screening, generally tackle the BioGPCR31 molecule and carry out mark.

The invention provides and use polypeptide, and fragment, derivative, analogue or their cell are as the method for antigen with production antibody.These antibody can be polyclonal antibody or monoclonal antibody.The present invention also provides the antibody at the BioGPCR31 antigenic determinant.These antibody include, but is not limited to: the fragment that polyclonal antibody, monoclonal antibody, chimeric antibody, single-chain antibody, Fab fragment and Fab expression library produce.

The method of the available BioGPCR31 direct injection of the production of polyclonal antibody immune animal (as rabbit, mouse, rat etc.) obtains.Have multiple adjuvant to can be used for enhancing immunity reaction, comprising but be not limited to freund's adjuvant etc.The technology of the monoclonal antibody of preparation BioGPCR31 includes, but is not limited to: and hybridoma technology (Kohler and Milstein.Nature, 1975,256:495-497), three knurl technology, people B-quadroma technology, EBV-hybridoma technology etc.With the variable region bonded chimeric antibody in human constant region and inhuman source can with existing technology production (Morrison et al, PNAS, 1985,81:6851).And the technology of existing manufacture order chain antibody (U.S.Pat No.496778) also can be used for producing the single-chain antibody of anti-BioGPCR31.

The antibody of anti-BioGPCR31 can be used in the immunohistochemistry technology, detects the BioGPCR31 in the biopsy specimen.With the also available labelled with radioisotope of BioGPCR31 bonded monoclonal antibody, inject in the body and can follow the tracks of its position and distribution.This radiolabeled antibody can be used as a kind of atraumatic diagnostic method and is used for the location of tumour cell and has judged whether transfer.

Antibody also can be used for designing the immunotoxin at a certain privileged sites in the body.As the monoclonal antibody of BioGPCR31 high-affinity can with bacterium or plant poison (as diphtheria toxin, ricin, abrine etc.) covalent attachment.A kind of usual method is with sulfydryl linking agent such as SPDP, attacks the amino of antibody, by the exchange of disulfide linkage, toxin is incorporated on the antibody, and this hybrid antibody can be used for killing the BioGPCR31 positive cells.

The disease that antibody among the present invention can be used for treating or prevention is relevant with BioGPCR31.The antibody that gives suitable dosage can stimulate or block generation or the activity of BioGPCR31.

The invention still further relates to the diagnostic testing process of quantitative and detection and localization BioGPCR31 level.These tests are known in the art, and comprise that FISH measures and radioimmunoassay.The BioGPCR31 level that is detected in the test can be with laying down a definition the importance of BioGPCR31 in various diseases and be used to the disease of diagnosing BioGPCR31 to work.

Polypeptide of the present invention also can be used as the peptide spectrum analysis.For example, the polypeptide available physical, chemistry or enzyme carry out the specificity cutting, and carries out the two-dimentional or three-dimensional gel electrophoresis analysis of one dimension, be more preferably and carry out mass spectroscopy.

The polynucleotide of coding BioGPCR31 also can be used for multiple therapeutic purpose.Gene therapy technology can be used for treating because cell proliferation, growth or the metabolic disturbance due to the nothing expression of BioGPCR31 or the unusual/non-activity expression.The gene therapy vector (as virus vector) of reorganization can be designed for the BioGPCR31 that expresses variation, to suppress endogenic BioGPCR31 activity.For example, a kind of BioGPCR31 of variation can be the BioGPCR31 that shortens, lacked signal conduction function territory, though can combine with the substrate in downstream, lacks signaling activity.Therefore the gene therapy vector of reorganization can be used for treating the disease of BioGPCR31 expression or active caused by abnormal.Deriving from viral expression vector such as retrovirus, adenovirus, adeno-associated virus (AAV), hsv, parvovirus etc. can be used for the polynucleotide of coding BioGPCR31 are transferred in the cell.The method of recombinant viral vector that structure carries the polynucleotide of coding BioGPCR31 is found in existing document (Sambrook, et al.).The polynucleotide of reorganization coding BioGPCR31 can be packaged in the liposome and then be transferred in the cell in addition.

Polynucleotide import tissue or intracellular method comprises: directly be injected into polynucleotide in the in-vivo tissue; Or external by carrier (as virus, phage or plasmid etc.) earlier with the polynucleotide transfered cell in, again cell is transplanted in the body etc.

Suppress the oligonucleotide (comprising sense-rna and DNA) of BioGPCR31 mRNA and ribozyme also within the scope of the invention.Ribozyme is the enzyme sample RNA molecule that a kind of energy specificity is decomposed specific RNA, and its mechanism of action is to carry out the endonuclease effect after ribozyme molecule and the hybridization of complementary target RNA-specific.The RNA of antisense and DNA and ribozyme can obtain with existing any RNA or DNA synthetic technology, as the technology widespread use of solid phase phosphoamide chemical synthesis synthetic oligonucleotide.Antisense rna molecule can be transcribed acquisition by the dna sequence dna of this RNA that encodes in external or body.This dna sequence dna has been incorporated into the downstream of rna polymerase promoter of carrier.In order to increase the stability of nucleic acid molecule, available several different methods is modified it, and as increasing the sequence length of both sides, the connection between the ribonucleoside is used phosphoric acid thioester bond or peptide bond but not phosphodiester bond.

The polynucleotide of coding BioGPCR31 can be used for diagnosing the disease relevant with BioGPCR31.The unconventionality expression of the expression that the polynucleotide of coding BioGPCR31 can be used for detecting BioGPCR31 BioGPCR31 whether or under morbid state.As the dna sequence dna of the BioGPCR31 that encodes can be used for biopsy specimen is hybridized to judge the expression situation of BioGPCR31.Hybridization technique comprises the Southern blotting, Northern blotting, in situ hybridization etc.These technological methods all are disclosed mature technologies, and relevant test kit all can obtain from commercial channels.Part or all of polynucleotide of the present invention can be used as probe stationary on microarray (microarray) or DNA chip (being called " gene chip " again), is used for analyzing the differential expression analysis and the gene diagnosis of tissue gene.Carry out the transcription product that RNA-polymerase chain reaction (RT-PCR) amplification in vitro also can detect BioGPCR31 with the special primer of BioGPCR31.

The sudden change that detects the BioGPCR31 gene also can be used for the disease of diagnosing BioGPCR31 relevant.The form of BioGPCR31 sudden change comprises that the point mutation compared with normal wild type BioGPCR31 dna sequence dna, transposition, disappearance, reorganization and other are any unusual etc.Available existing technology such as Southern blotting, dna sequence analysis, PCR and in situ hybridization detect sudden change.In addition, sudden change might influence proteic expression, therefore can judge indirectly that with Northern blotting, Western blotting gene has or not sudden change.

Sequence of the present invention identifies it also is valuable to karyomit(e).This sequence can be specifically at certain bar human chromosome particular location and and can with its hybridization.At present, need to identify the concrete site of each gene on the karyomit(e).Yet, have only chromosomal marker thing seldom to can be used for the marker chromosomes position now based on actual sequence data (repetition polymorphism).According to the present invention, for these sequences are associated with disease related gene, its important the first step is positioned these dna sequence dnas on the karyomit(e) exactly.

In brief, prepare PCR primer (preferred 15-35bp), sequence can be positioned on the karyomit(e) according to cDNA.Then, these primers are used for the somatocyte hybrid cell that the PCR screening contains each bar human chromosome.Have only those hybrid cells that contain corresponding to the people's gene of primer can produce the fragment of amplification.

The PCR localization method of somatocyte hybrid cell is that DNA is navigated to concrete chromosomal quick method.Use Oligonucleolide primers of the present invention,, can utilize one group to realize inferior location from specific chromosomal fragment or a large amount of genomic clone by similar approach.Other the similar strategy that can be used for chromosomal localization comprises in situ hybridization, uses the karyomit(e) prescreen and the hybridization preliminary election of the airflow classification of mark, thereby makes up the special cDNA storehouse of karyomit(e).

The cDNA clone is carried out fluorescence in situ hybridization (FISH) with Metaphase Chromosome, can in a step, accurately carry out chromosomal localization.The summary of this technology is referring to Verma etc., Human Chromosomes:a Manual of BasicTechniques, Pergamon Press, New York (1988).

In case sequence is positioned to chromosome position accurately, the physical location of this sequence on karyomit(e) just can be associated with the gene map data.These data for example are found in, V.Mckusick, Mendelian Inheritance in Man (can by with the online acquisition of Johns Hopkins University Welch Medical Library).Can pass through linkage analysis then, determine gene and navigated to relation between the disease on the chromosomal region already.

Then, measure ill and not cDNA between diseased individuals or genome sequence difference.If observe certain sudden change in some or all of diseased individuals, and this sudden change is not observed in any normal individual, then this sudden change may be the cause of disease of disease.More ill and diseased individuals not is usually directed at first seek the variation of structure in the karyomit(e), as from the horizontal visible of karyomit(e) or use based on detectable disappearance of the PCR of cDNA sequence or transposition.Resolving power according to present physical mapping and assignment of genes gene mapping technology, being accurately positioned to the cDNA of the chromosomal region relevant with disease, can be a kind of (the supposing that 1 megabasse mapping resolving power and every 20kb are corresponding to a gene) between 50 to 500 potential Disease-causing genes.

Polypeptide of the present invention, polynucleotide and stand-in thereof, agonist, antagonist and inhibitor and suitable pharmaceutical carrier (pharmaceutically acceptable carrier) combination back can be used.These carriers can be water, glucose, ethanol, salt, damping fluid, glycerine and their combination.Composition comprises the polypeptide of the present invention or the antagonist of safe and effective amount and carrier and the vehicle that does not influence effect of drugs.These compositions can be used as medicine and are used for disease treatment.

The present invention also provides medicine box or the test kit that contains one or more containers, and one or more medicinal compositions compositions of the present invention are housed in the container.With these containers, can have by the given indicative prompting of government authorities of making, using or selling medicine or biological products, the government authorities that this prompting reflects production, uses or sells permits it to use on human body.In addition, polypeptide of the present invention can be used in combination with other treatment compound.

Pharmaceutical composition can be with mode administration easily, as by in part, intravenously, intraperitoneal, intramuscular, subcutaneous, the nose or the route of administration of intracutaneous etc.BioGPCR31 comes administration with the amount that treats and/or prevents concrete indication effectively.The amount and the dosage range that are applied to patient's BioGPCR31 will depend on many factors, as administering mode, person's to be treated healthiness condition and diagnostician's judgement.

In an example of the present invention, a kind of isolating polynucleotide are provided, its coding has the mature polypeptide of aminoacid sequence shown in the SEQ ID NO:2.These polynucleotide are to find from the cDNA library of people's fetal brain tissue, and the polynucleotide sequence total length is 3199 bases, its open reading frame (34-873) 279 amino acid of having encoded.Find relatively that according to amino acid sequence homologous the G-protein linked receptor of this polypeptide and Oryzias latipes has 46% homology, infer that thus the new people BioGPCR31 of the present invention has the similar 26S Proteasome Structure and Function of G-protein linked receptor gene family.

The cDNA of people BioGPCR31 provided by the present invention, oligonucleotide, polypeptide and antibody etc. have important value for diseases related, screening inhibitor or these diseases of pharmacological agent of the effect of G-protein linked receptor in research different tissues and the cell, the imbalance of diagnosis G-protein linked receptor.

In addition, because people BioGPCR31 albumen of the present invention has the natural acid sequence that is derived from the people, therefore, compare with the albumen of the same clan that derives from other species, estimate to have higher active and/or lower side effect (for example in the intravital immunogenicity of people lower or do not have) being applied to man-hour.

Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to people such as normal condition such as Sambrook, molecular cloning: laboratory manual (New York:Cold Spring Harbor LaboratoryPress, 1989) condition described in, or the condition of advising according to manufacturer.

The clone of embodiment 1:BioGPCR31 cDNA

Extract the total RNA of people's tire brain with guanidinium isothiocyanate/phenol/chloroform single stage method.From total RNA, separate poly (A) mRNA with Quick mRNA separating kit (Qiegene company product).2ug poly (A) mRNA forms cDNA through reverse transcription.CDNA fragment orientation is inserted on the multiple clone site of pBSK (+) carrier (Clontech company product) with Smart cDNA clone's test kit (available from Clontech), transforms DH5 α bacterium and form the cDNA library.Measure the sequence of all clones' 5 ' and 3 ' end with dyestuff termination circulating reaction sequencing kit (Perkin-Elmer company product) and ABI 377 automatic sequencings views (Perkin-Elmer company).CDNA sequence and the existing public dna sequence data storehouse (Genbank) measured are compared, and the cDNA sequence that found that one of them clone (1008g06) is new DNA.By synthetic a series of primers the contained insertion cDNA fragment of this clone is carried out two-way mensuration.The result shows, the contained full-length cDNA of 1008g06 clone is 3199bp (shown in SEQ ID NO:1), from 34bp to 873bp the open reading frame (ORF) of a 840bp, the new protein (shown in SEQ ID NO:2) of encoding arranged.This clone is named as pBS-1008g06, its encoded protein matter called after G-protein linked receptor (abbreviating " BioGPCR31 " as).

Embodiment 2:cDNA clone's homology retrieval

With the nucleotide sequence and the encoded protein sequence thereof of people BioGPCR31 gene of the present invention, with Blast program (Basic local Alignment search tool) [Altschul, SF et al.J.Mol.Biol.1990; 215:403-10], carry out the homology retrieval at databases such as Genbank, Swissport.The gene the highest with people BioGPCR31 dna homolog of the present invention is the gene of the G-protein linked receptor of a kind of known Oryzias latipes, and its encoded protein number is Q91178 in the access of Genbank.The protein homology comparative result is shown in Fig. 1, both height homologies, and its homogeny is 46%; Similarity is 64%.This shows that novel polypeptide of the present invention has the 26S Proteasome Structure and Function of G-protein linked receptor.

Embodiment 3: with RT-PCR method clone BioGPCR31 gene

Total RNA is a template with fetus brain cell, is that primer carries out the synthetic cDNA of reverse transcription reaction with oligo-dT, with behind the test kit purifying of Qiagene, carries out pcr amplification with following primer:

Primer 1:5 '-GTGCTGGTGGGTGTGTGGGT-3 ' (SEQ ID NO.3)

Primer 2: 5 '-AGCATAATAAAAGAGAAATT-3 ' (SEQ ID NO.4)

Primer 1 is corresponding to the forward sequence that begins of 1bp of the 5 ' end of SEQ ID NO:1; Primer 2 is corresponding to the end of 3 ' among SEQ ID NO:1 reverse sequence.

The condition of amplified reaction: in the reaction volume of 50 μ l, contain 50mmol/L KCl, 10mmol/L Tris-Cl, (pH8.5), 1.5mmol/L MgCl ₂, 200 μ mol/L dNTP, 10pmol primer, the Taq archaeal dna polymerase of 1U (Clontech company product).Go up by 25 cycles of following conditioned response at PE9600 type DNA thermal cycler (Perkin-Elmer company): 94 ℃ of 30sec; 55 ℃, 30sec; 72 ℃ of 2min.When RT-PCR, establish the blank negative contrast of positive contrast of beta-actin and template simultaneously.Amplified production is connected to (Invitrogen company product) on the pCR carrier with the test kit purifying of QIAGEN company with TA clone test kit.Dna sequence analysis is the result show, the 1-3199bp shown in the dna sequence dna of PCR product and the SEQID NO:1 is identical.

Embodiment 4:Northern blotting is analyzed the BioGPCR31 expression of gene:

Extract total RNA[Anal.Biochem 1987,162,156-159 with single stage method].This method comprises acid guanidine thiocyanate phenol-chloroform extracting.Promptly use 4M guanidinium isothiocyanate-25mM Trisodium Citrate, 0.2M sodium acetate (pH4.0) carries out homogenate to tissue, adds the phenol of 1 times of volume and the chloroform-primary isoamyl alcohol (49: 1) of 1/5 volume, and is centrifugal after mixing.The sucking-off aqueous phase layer adds Virahol (0.8 volume) and with the centrifugal RNA precipitation that obtains of mixture.With RNA precipitation 70% washing with alcohol that obtains, dry and soluble in water.

With 20 μ g RNA, on 1.2% sepharose that contains 20mM 3-(N-morpholino) propanesulfonic acid (pH7.0)-5mM sodium acetate-1mM EDTA-2.2M formaldehyde, carry out electrophoresis.Be transferred on the nitrocellulose filter then.With α- ³²P dATP prepares by random priming ³²The dna probe of p-mark.Used dna probe is the BioGPCR31 coding region sequence (34bp to 873bp) of the pcr amplification shown in the SEQ 1.Will ³²The probe of p-mark (about 2 * 10 ⁶Cpm/ml) spend the night in 42 ℃ of hybridization in solution with the nitrocellulose filter that has shifted RNA, this solution comprises 50% methane amide-25mMK H ₂PO ₄(pH7.4)-5 * SSC-5 * Denhardt ' s solution and 200 μ g/ml salmon sperm DNAs.After the hybridization, filter membrane is washed 30min in 55 ℃ in 1 * SSC-0.1%SDS.Then, analyze with quantitative with Phosphor Imager.

Embodiment 5: vivoexpression, separation and the purifying of reorganization BioGPCR31

According to the coding region sequence (34-873 position) of SEQ ID NO:1, design a pair of specificity amplification primer, sequence is as follows:

Primer 3:5 '-CCCGGATCCATGGCTTCTGTGCCAGTGTT-3 ' (SEQ ID No 5)

Primer 4:5 '-CCCGCGGCCGCTCATGACTCCAGCCGGGGTG-3 ' (SEQ ID No 6)

5 ' end of these two sections primers contains BamH I and Not I restriction enzyme site respectively, be respectively the encoding sequence of target gene 5 ' end and 3 ' end thereafter, BamH I and Not I restriction enzyme site are corresponding to expression vector plasmid pET-28b (+) (Novagen company product, Cat.No.69865.3) the selectivity restriction enzyme site on.With the pBS-1008g06 plasmid that contains the total length goal gene is template, carries out the PCR reaction.The PCR reaction conditions is: contain pBS-1008g06 plasmid 10pg, primer 3 and primer 4 among the cumulative volume 50 μ l and be respectively 10pmmol, Advantage polymerase Mix (Clontech company product) 1 μ l.Loop parameter: 94 ℃ of 20s, 60 ℃ of 30s, 68 ℃ of 2min, totally 25 circulations.Respectively amplified production and plasmid pET-28 (+) are carried out double digestion with BamH I and Not I, reclaim big fragment respectively, and connect with the T4 ligase enzyme.Connect product and transform, after the dull and stereotyped overnight incubation of the LB that contains kantlex (final concentration 30 μ g/ml), use the colony polymerase chain reaction (PCR) method screening positive clone, and check order with the big enterobacterial DH5 of Calcium Chloride Method α.Select the correct positive colony of sequence (pET-1008g06) with Calcium Chloride Method with recombinant plasmid transformed e. coli bl21 (DE3) plySs (Novagen company product).In the LB liquid nutrient medium that contains kantlex (final concentration 30 μ g/ml), host bacterium BL21 (pET-1008g06) is cultured to logarithmic phase at 37 ℃, adds IPTG to final concentration 1mmol/L, continues to cultivate 5 hours.Centrifugal collection thalline, through the broken bacterium of ultrasonic wave, centrifugal collection supernatant with carrying out chromatography with 6 Histidines (6His-Tag) bonded affinity column His.BindQuick Cartridge (Novagen company product), has obtained the target protein BioGPCR31 of purifying.Through the SDS-PAGE electrophoresis, obtain a single band at the 31kDa place.This band is transferred on the pvdf membrane carries out the n terminal amino acid sequential analysis with the Edams hydrolysis method, 15 amino acid of N-end hold 15 amino-acid residues identical with the N-shown in the SEQ ID NO:2 as a result.

Embodiment 6: anti-BioGPCR31 production of antibodies is synthesized the specific polypeptide of following BioGPCR31: Met-Ala-Ser-Val-Pro-Val-Leu-Gly-Arg-Val-Ser-Trp-Glu--Glu-Gly (SEQ ID NO:7) with Peptide synthesizer (PE company product).This polypeptide formed mixture with the coupling of hemocyanin and bovine serum albumin respectively, and method is referring to Avrameas, et al.Immunochemistry, 1969; 6:43.Add the complete Freund's adjuvant immunizing rabbit with the above-mentioned hemocyanin polypeptide complex of 4mg, add the incomplete Freund's adjuvant booster immunization once with the hemocyanin polypeptide complex again after 15 days.Employing is done the titre that ELISA measures antibody in the rabbit anteserum through the titer plate of 15 μ g/ml bovine serum albumin polypeptide complex bag quilts.From the rabbit anteserum of antibody positive, separate total IgG with albumin A-Sepharose.Polypeptide is incorporated on the Sepharose 4B post of cyanogen bromide-activated, from total IgG, separates anti-peptide antibody with affinity chromatography.Immuno-precipitation proof antibody purified can combine with BioGPCR31 specifically.

All quote in this application as a reference at all documents that the present invention mentions, just quoted as a reference separately as each piece document.Should be understood that in addition those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims institute restricted portion equally.

Sequence table (1) general information:

(ⅰ) denomination of invention: new human G-protein coupled receptor and encoding sequence thereof

(ⅱ) sequence number: the information of 7 (2) SEQ ID NO:1:

(ⅰ) sequence signature:

(A) length: 3199bp

(B) type: nucleic acid

(C) chain: two strands

( D ) ： ( ⅱ ) ：cDNA ( ⅲ ) ：SEQ ID NO：1：1 GTGCTGGTGGGTGTGTGGGTGAAGGCCTTGGCCATGGCTTCTGTGCCAGTGTTGGGAAGG 61 GTCTCCTGGGAGGAAGGAGCTCCCAGTGTCCCCCCAGGCTGTTCACTCCAGTGGAGCCAC 121 AGTGCCTACTGCCAGCTTTTTGTGGTGGTCTTTGCTGTCCTTTACTTTCTGTTGCCCCTG 181 CTCCTCATACTTGTGGTCTACTGCAGCATGTTCCGAGTGGCCCGCGTGGCTGCCATGCAG 241 CACGGGCCGCTGCCCACGTGGATGGAGACACCCCGGCAACGCTCCGAATCTCTCAGCAGC 301 CGCTCCACGATGGTCACCAGCTCGGGGGCCCCCCAGACCACCCCACACCGGACGTTTGGG 361 GGAGGGAAAGCAGCAGTGGTTCTCCTGGCTGTGGGGGGACAGTTCCTGCTCTGTTGGTTG 421 CCCTACTTCTCTTTCCACCTCTATGTTGCCCTGAGTGCTCAGCCCATTTCAACTGGGCAG 481 GTGGAGAGTGTGGTCACCTGGATTGGCTACTTTTGCTTCACTTCCAACCCTTTCTTCTAT 541 GGATGTCTCAACCGGCAGATCCGGGGGGAGCTCAGCAAGCAGTTTGTCTGCTTCTTCAAG 601 CCAGCTCCAGAGGAGGAGCTGAGGCTGCCTAGCCGGGAGGGCTCCATTGAGGAGAACTTC 661 CTGCAGTTCCTTCAGGGGACTGGCTGTCCTTCTGAGTCCTGGGTTTCCCGACCCCTACCC 721 AGCCCCAAGCAGGAGCCACCTGCTGTTGACTTTCGAATCCCAGGCCAGATAGCTGAGGAG 781 ACCTCTGAGTTCCTGGAGCAGCAACTCACCAGCGACATCATCATGTCAGACAGCTACCTC 841 CGTCCTGCCGCCTCACCCCGGCTGGAGTCATGATGGGCCGCTGGACACTCGGAGGGATAT 901 GGGGCTGGGGCCAGTTATGATTGCAAGGACCACCTTGTGGGATCACCTTTTCCCAGCTGG 961 CTAGGGCTGAGGCTGGGGTCTCTGCACACAGCTTTTGCTTAGTGTTTCCTGGGTCAGGAA1021 CAGAGCCAACAGGATGAACGTGTGCAAAAGCCTTGGACTTGGCTGTGATCTTTGACTGCT1081 AGGGGAGGGAACCTGGGTATGGTGAGACGGTGACGAGAGAAAAGGGTCACAAAGGTGAGG1141 TGAAACCTCTCAATTGGTGAAATTTCCATGCTTCCAGAAGCAGGGAATTCTCTAAGGGTA1201 GGAGTTGGAGGATACAGGGCAGCAGGCCAGGTTTGGAGTTATTCTAGGGGCCATTTAGGA1261 TATTTTATTTTTCAGTGTAATTGTCCAGGGCAGTAATTGCACCCAAGCAGGGTAAGAAAA1321 TGACCCATGTTTTCTCATTTCCTTGCTAGGTTTAAAAAGAACTAAATTATAGCCAAGTGT1381 TTCCACTTGAGTTAATAGATCATTTTTCTGGTTTTATACCTGAGATTTCCTTAAAATGAG1441 AGGACCAGTAGGGTGTATTCCTTTACTGAGTTTGGCCAGAAACAAGGCAAAATAGAAATT1501 AGGGTACATGGAGTAGAAGATAGGAAAGCTGACTGCAGCTCTCTCTCTCCCACCCTTCAG1561 GAAAAGCCCTTCTGTTCTATTTTTCTGTCTCTCTCCTGCACACAGGAGATCAAGGGTAGA1621 GCCTGATCTTAGCAGAGACAAGAATAAGGCAGGATGGCTTTCCTCTCTTTTAGGAGGAAG1681 AATTAGAATGACTGGGGGTCAGACGGGCGAGGGTGGAGGTTAGCATTTGAATTGGTAAAG1741 TAGCTGGAAACAGAGAGGCCAGGTAATCAGCCTGATCAATAATACTGCGAATCTTTTCTT1801 TCCAGGACTGGCCTCCCTGATCTCTCTCCTCATGGCAGCGACCCACCTCCAGTCCCCTGG1861 ACAATCGGGTACAAGAGACTTAAGGTTGGGCATGGGAAGGGTGGGGTTTCCATGATCCAT1921 TAAATGCCTTCCTACTCCCATTCATCGCTCTCAAAATTAGCTTCAGTGACAAAGACTTAA1981 ATCTCTCTCCTATCTGCAGCACTGGGTTGGAGAGAGGGCACGGGAGTTGGTCTTGGCTGT2041 TCATTGATTGAGACTGTAGGAACTGTGTTGGTTGGTATTGGTGGTGGTATTTTCAACAAA2101 CAGGGAATAACTGCAAACTGGACAGGACACCCATCTGGGACCACCTGTCCATCCTACTTC2161 CCTCAATTGAATCAGGTAACACTAACGGATCAAGGCAGGGCCAGAGGGTGGTGTGGTCTC2221 TATTTGAACAAATTCCTGGCTCACTGAGCATCAAAAGGGGAAATGGGCTGGTGGGAGTGG2281 GATAGTCTCCCATTTAAGCAGCTAATAAATAATTTTTATGATAAAAGGTTATACTGATAA2341 CAACATTGACTCCTTTAGTTCAATTCAGTGCATAATAGTTGAACACCCACTAGTCCCTGG2401 GACCCACACAGGGCGTGTGGTCATTGCTTTTAAGGAGTTCATAGTCTAAGTTGATGAGAT2461 ACCTTATATTTTCACAAAGCACTTTGATTTGATAAAGCACTACAGAATGTGCTTGAGAAA2521 TATATTGGAGAATATGTCCATGGCTCTAACTTCTGAGAGTTCAGCCCGTGGCAGCAAGAT2581 GCATACCTTGAAGCTTCCTGCAGATTGTGGAAAGCATAGGGGTTGTAAATGAAACTCTCT2641 AATGAAGAAAAAAAATTAAATGAAACTGGGCAAACAGCTTTCCCCCTTTGTTCTAGGAAA2701 ATTTCTAGGTTGTCTTCCTACCACTAGATTATTATACCAGTCTAGTGCCTATTACATTGT2761 GGAAGTTCCCTATTAAAATAAATGCATACAGAGGAATCAATCATTCCTAGACAGGGAAAA2821 AACTCTTCTTTCAAACACCACTGATCAGCTATTAGATCCAAGGAATTGCCAGCAGGTGGC2881 AGTGTGAGCCCAATGGAAGGAGGAAAGGCGAGTGTACGTGGTGGGAGGAGGAAGGGGAGG2941 GCATTAAACATTGCCTGGCAGCCATTTTGTTAATTTATTTTGCCTTTTCCTTTGACTTTG3001 CCCTCCAGCCCTTCCTTCACATACATCAAAGAAGAAAGTTTTAAGAGCAAGGGTATCTTT3061 AATTCAGGCTGAAATTTCCTGACACTGTGATCTCACTGGTGTTTATTACAGAGTTTGACA3121 TACATGGGTTCATTTGCCATTTATTTTTCCCTGTAGGAGTGGATCATGAAGGAAATAAAA3181 ATTTCTCTTTTATTATGCT ( 2 ) SEQ ID NO：2：

(ⅰ) sequence signature:

(A) length: 279 amino acid

(B) type: amino acid

( D ) ： ( ⅱ ) ： ( ⅲ ) ：SEQ ID NO：2： 1 Met Ala Ser Val Pro Val Leu Gly Arg Val Ser Trp Glu Glu Gly16 Ala Pro Ser Val Pro Pro Gly Cys Ser Leu Gln Trp Ser His Ser31 Ala Tyr Cys Gln Leu Phe Val Val Val Phe Ala Val Leu Tyr Phe46 Leu Leu Pro Leu Leu Leu Ile Leu Val Val Tyr Cys Ser Met Phe61 Arg Val Ala Arg Val Ala Ala Met Gln His Gly Pro Leu Pro Thr76 Trp Met Glu Thr Pro Arg Gln Arg Ser Glu Ser Leu Ser Ser Arg91 Ser Thr Met Val Thr Ser Ser Gly Ala Pro Gln Thr Thr Pro His106 Arg Thr Phe Gly Gly Gly Lys Ala Ala Val Val Leu Leu Ala Val121 Gly Gly Gln Phe Leu Leu Cys Trp Leu Pro Tyr Phe Ser Phe His136 Leu Tyr Val Ala Leu Ser Ala Gln Pro Ile Ser Thr Gly Gln Val151 Glu Ser Val Val Thr Trp Ile Gly Tyr Phe Cys Phe Thr Ser Ash166 Pro Phe Phe Tyr Gly Cys Leu Ash Arg Gln Ile Arg Gly Glu Leu181 Ser Lys Gln Phe Val Cys Phe Phe Lys Pro Ala Pro Glu Glu Glu196 Leu Arg Leu Pro Ser Arg Glu Gly Ser Ile Glu Glu Ash Phe Leu211 Gln Phe Leu Gln Gly Thr Gly Cys Pro Ser Glu Ser Trp Val Ser226 Arg Pro Leu Pro Ser Pro Lys Gln Glu Pro Pro Ala Val Asp Phe241 Arg Ile Pro Gly Gln Ile Ala Glu Glu Thr Ser Glu Phe Leu Glu256 Gln Gln Leu Thr Ser Asp Ile Ile Met Ser Asp Ser Tyr Leu Arg271 Pro Ala Ala Ser Pro Arg Leu Glu Ser ( 2 ) SEQ ID NO：3

(ⅰ) sequence signature

(A) length: 20 bases

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linear (ⅱ) molecule type: oligonucleotide (ⅲ) sequence description: the information of SEQ ID NO:3:GTGCTGGTGGGTGTGTGGGT 20 (2) SEQ ID NO:4

(ⅰ) sequence signature

(A) length: 20 bases

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linear (ⅱ) molecule type: oligonucleotide (ⅲ) sequence description: information (ⅰ) sequence signature (A) length of SEQ ID NO:4:AGCATAATAAAAGAGAAATT 20 (2) SEQ ID NO:5: 29 bases

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linear (ⅱ) molecule type: oligonucleotide (ⅲ) sequence description: SEQ ID NO:5:CCCGGATCCATGGCTTCTGTGCCAGTGTT 29

(2) information of SEQ ID NO:6

(ⅰ) sequence signature

(A) length: 31 bases

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linear (ⅱ) molecule type: oligonucleotide (ⅲ) sequence description: SEQ ID NO:6:CCCGCGGCCGCTCATGACTCCAGCCGGGGTG 31

(2) information of SEQ ID NO:7:

(ⅰ) sequence signature:

(A) length: 15 amino acid

(B) type: amino acid

(D) topological framework: linear (ⅱ) molecule type: polypeptide (ⅲ) sequence description: SEQ ID NO:7:Met-Ala-Ser-Val-Pro-Val-Leu-Gly-Arg-Val-Ser-Trp-Glu--Glu-Gly 15

Claims (18)

1, a kind of isolating people BioGPCR31 polypeptide is characterized in that it comprises: have the polypeptide of the aminoacid sequence shown in the SEQ ID NO.2 or fragment, analogue or the derivative of its polypeptide.

2, polypeptide as claimed in claim 1 is characterized in that, it is that polypeptide or its amino acid variation with the aminoacid sequence shown in the SEQ ID NO.2 are no more than 5% derivative.

3, polypeptide as claimed in claim 2 is characterized in that, it is the polypeptide with the aminoacid sequence shown in the SEQ ID NO.2.

4, a kind of isolating polynucleotide is characterized in that, described polynucleotide are to be selected from down group:

(a) coding has the polynucleotide of the polypeptide of aminoacid sequence shown in the SEQ ID NO.2 or its fragment, analogue, derivative;

(b) with polynucleotide (a) complementary polynucleotide;

(c) with (a) or the polynucleotide of at least 70% homogeny (b) are arranged.

5, polynucleotide as claimed in claim 4 is characterized in that, described polynucleotide are polynucleotide that coding has aminoacid sequence shown in the SEQ ID NO.2.

6, polynucleotide as claimed in claim 4 is characterized in that, the sequence of described polynucleotide is the sequences that have the sequence of 34-873 position among the SEQ IDNO.1 or have 1-3199 position among the SEQ ID NO.1.

7, a kind of recombinant vectors that contains exogenous polynucleotide is characterized in that, it is the recombinant vectors that is formed by the described polynucleotide of claim 4 and plasmid, virus or expression vector establishment.

8, a kind of genetically engineered host cell that contains exogenous polynucleotide is characterized in that, it is to be selected from following a kind of host cell:

(a) host cell that transforms or transduce with the described recombinant vectors of claim 7;

(b) host cell that transforms or transduce with the described polynucleotide of claim 4.

9, a kind of preparation method with the active polypeptide of BioGPCR31 is characterized in that, described method comprises:

(a) being fit to express under the BioGPCR31 condition, cultivate the described through engineering approaches host cell of claim 8;

(b) from culture, isolate and have the active polypeptide of BioGPCR31.

10, a kind of can with polypeptide bonded antibody, it is characterized in that, described antibody be can with BioGPCR31 specificity bonded antibody.

11, the compound of an analoglike or adjusting polypeptide active or expression, it is characterized in that it is the active compound of simulation BioGPCR31, or promote the active compound of BioGPCR31, or the active compound of antagonism BioGPCR31, or the active compound of inhibition BioGPCR31.

12, compound as claimed in claim 11 is characterized in that, it is the polynucleotide sequence shown in the SEQ ID NO.1 or its segmental antisense sequences.

13, the described application of compound of a kind of claim 11 is characterized in that, described compound be used to regulate BioGPCR31 in vivo, the method for external activity.

14, a kind of disease relevant with the described BioGPCR31 polypeptide of claim 1 or method of disease susceptibility of detecting is characterized in that, is to detect the relevant disease or the susceptibility of disease by the method that is selected from down group:

Whether (a) detect described expression of polypeptides amount indirectly or directly unusual;

Whether (b) detect described polypeptide active indirectly or directly unusual;

(c) directly or indirectly detect and cause described expression of polypeptides amount or active unusual nucleotide diversity in the polynucleotide.

15, the application of polypeptide according to claim 1 is characterized in that, it is applied to screen stand-in, agonist, antagonist or the inhibitor of BioGPCR31; Perhaps be used for the peptide finger print identification.

16, the application of nucleic acid molecule as claimed in claim 4 is characterized in that, it is used for nucleic acid amplification reaction as primer, perhaps is used for hybridization as probe, perhaps is used to make gene chip or microarray.

17, a kind of pharmaceutical composition is characterized in that, it contains the described polypeptide of claim 1 and/or the described polynucleotide of claim 4 and the pharmaceutically acceptable carrier of safe and effective amount.

18, the application of polypeptide as claimed in claim 1 is characterized in that, is used to be used for the treatment of the medicine of diseases such as neurological disorder, endocrine system disorder, cardiovascular systems disorder with described polypeptide preparation.

Images