CN1293248A - Human shear and adenylation specific factor protein and its coding sequence - Google Patents

Abstract

A new polypeptide-novel human cleavage and polyadenylation specificity factor protein (BioOPSF), the polynucleotide for coding it, the process for preparing it by recombination, its medical action in treating immune disorder and cancers, its antogon to resist it and its medical action, and coding the new applications of said polynucleotide are disclosed.

Description

New NOVEL HUMAN CLEAVAGE AND POLYADENYLATION SPECIFICITY FACTOR PROTEIN and encoding sequence thereof

The invention belongs to biological technical field and field of genetic engineering, specifically, having the present invention relates to a kind of new polypeptide-human shears and poly-adenosine specificity factor (Novel Human Cleavage and PolyadenylationSpecificity Factor protein, be called for short " BioCPSF "), and the polynucleotide sequence of this polypeptide of encoding.The invention still further relates to the preparation method and the application of these polynucleotide and polypeptide.

Mammiferous shearing and poly-adenosine specificity factor (CPSF) they are the kytoplasm factors of regulating poly-adenosine, identification and in conjunction with the poly-adenosine signal AAUAAA of mRNA precursor, and CPSF is essential in the extension of the shearing of mRNA precursor and tail end.The reaction of kytoplasm poly-adenosine can intensify translates.CPSF comprises four subunits, is respectively 160kDa, 100kDa, 73kDa, 30kDa.Wherein the 160kDa subunit can with poly-adenosine signal AAUAAA interact [Jenny A, et al.Nucleic Acids Res 1995; 23:2629-35]; The 100kDa subunit can make the enhancing that combines of CPSF and Poly (A); The 30kDa subunit is that the key of mechanism is sheared in 3 of mammalian rna ' end processing.The CPSF sequence comprises 5 C3H-zinc fingers fragments and a RNA refers to Knuckle motif [Barabino SM, et al.Genes Dev 1997 in conjunction with zinc; 11:1703-16].

The AAUAAA sequence is a shear signal in specific ripe mRNA precursor, is positioned at the upstream in Poly (A) site, and high conservative, and its upstream and downstream sequence is also very important for site identification.CPSF shears stimulating factor (CstF) and substrate mRNA precursor and forms a stabilized complex, activates 3 of mRNA precursor ' terminal shearing processing.Shear back CPSF and continue to combine, make the poly-adenosine enzyme energy specific Poly of extending to (A) tail with AAUAAA.

The shortage of CPSF or sudden change, its active attenuating or increase, the effect of bonded correlation factor can cause that all functional transcription is not normal with it, causes immunologic derangement and cancer etc.For example influenza virus NS1 albumen can react with the 30kDa subunit of CPSF, stops CPSF bound substrates mRNA, suppresses 3 ' terminal shearing and poly-adenosine [Dickson KS, et al.Mol Cell Biol 1999 of the mRNA precursor of host cell; 19:5707-17].

Show, shear and poly-adenosine specificity factor and some diseases closely related, influenza illness for example, metabolism disorder, AID illness and cancer etc.Therefore, the people shears and the poly-adenosine specificity factor is significant for therapeutic purpose are researched and developed.

An object of the present invention is to provide that isolating new polypeptide-human shears and poly-adenosine specificity factor (abbreviating " BioCPSF " as) with and fragment, analogue and derivative.

Another object of the present invention provides the polynucleotide of this BioCPSF polypeptide of coding.

Another object of the present invention provides the recombinant vectors of the polynucleotide that contain the BioCPSF that encodes.

Another object of the present invention provides the genetically engineered host cell of the polynucleotide that contain the BioCPSF that encodes.

Another object of the present invention provides the method for producing BioCPSF.

Another object of the present invention provides the antibody at BioCPSF polypeptide of the present invention.

Another object of the present invention has provided at the simulated compound of BioCPSF polypeptide of the present invention, antagonist, agonist, inhibitor.

Another object of the present invention provides the method for the diagnosis disease relevant unusually with BioCPSF with treatment.

In a first aspect of the present invention, provide novel isolated people to shear and poly-adenosine specificity factor (BioCPSF), this polypeptide is the people source, and it comprises: have the polypeptide of SEQ ID NO:2 aminoacid sequence or its conservative property variation polypeptide or its active fragments or its reactive derivative, analogue.Preferably, this polypeptide is that polypeptide or its amino acid variation with SEQ IDNO:2 aminoacid sequence is no more than 5% derivative.

In a second aspect of the present invention, the polynucleotide of isolating these polypeptide of coding are provided, these polynucleotide comprise a nucleotide sequence, and this nucleotide sequence is shown at least 70% homogeny with a kind of nucleotides sequence that is selected from down group: (a) polynucleotide of the above-mentioned BioCPSF of coding; (b) with polynucleotide (a) complementary polynucleotide.Preferably, this polynucleotide encoding has the polypeptide of aminoacid sequence shown in the SEQ ID NO:2.More preferably, the sequence of these polynucleotide is be selected from down group a kind of: the sequence that (a) has 652-1680 position among the SEQ ID NO:1; (b) has the sequence of 1-1938 position among the SEQ ID NO:1.

In a third aspect of the present invention, the carrier that contains above-mentioned polynucleotide is provided, and has been transformed or host cell of transduceing or the host cell that is directly transformed or transduce by above-mentioned polynucleotide by this carrier.

Others of the present invention are because disclosing of the technology of this paper is conspicuous to those skilled in the art.

Following accompanying drawing is used to illustrate specific embodiments of the present invention, and is not used in qualification by the scope of the invention that claims defined.

Fig. 1 is that people of the present invention shears and the shearing of poly-adenosine specificity factor BioCPSF and B.taurus and the amino acid sequence homology comparison diagram of poly-adenosine specificity factor (Z98551).Same amino acid represents with monocase amino acid that between two sequences similar amino acid is represented with "+".

As used herein, " separation " refer to material from its primal environment, separate (if crude, Primal environment namely is natural surroundings). For example, the polynucleotide under the native state in the active somatic cell and polypeptide are not divide From purifying, but same polynucleotide or polypeptide as from native state with in other materials that exist separately, then be Separation and purification.

As used herein, " BioGPSF albumen or the polypeptide of separation " refers to that BioCPSF is substantially free of natural and its phase Other albumen, lipid, carbohydrate or other material that close. Those skilled in the art can use the purified technology of protein of standard Purifying BioCPSF. Basically pure polypeptide can produce single master tape on non-reduced polyacrylamide gel. BioCPSF The purity of polypeptide can be used amino acid sequence analysis.

The invention provides a kind of new polypeptide-BioCPSF polypeptide, it is basically by shown in the SEQ ID NO:2 Amino acid sequence forms. Polypeptide of the present invention can be recombinant polypeptide, natural polypeptides, synthetic polypeptide, and preferred restructuring is many Peptide. Polypeptide of the present invention can be the product of natural purifying, or the product of chemical synthesis, or uses recombinant technique from former Produce in nuclear or the eucaryon host (for example, bacterium, yeast, higher plant, insect and mammalian cell). According to restructuring The host that production decision is used, polypeptide of the present invention can be glycosylated, maybe can be nonglycosylated. Of the present invention Polypeptide also can comprise or not comprise initial methionine residues.

The present invention also comprises fragment, derivative and the analog of BioCPSF. As used herein, " spreads out at term " fragment " Biological " and " analog " refer to basically to keep the identical biological function of the natural BioCPSF of the present invention or activity Polypeptide. The fragment of polypeptide of the present invention, derivative or analog can be: (I) so a kind of, and wherein one or more amino The acid residue is guarded or non-conservative amino acid residues (preferably conservative amino acid residues) replaces, and the amino acid that replaces Can be also can not encoded by genetic codon; Perhaps (II) is so a kind of, and wherein one or more amino acid are residual Certain group on the base is replaced by other group and comprises substituting group; Perhaps (III) is so a kind of, wherein mature polypeptide and another Planting compound (such as the compound that prolongs the polypeptide half-life, for example polyethylene glycol) merges; Perhaps (IV) is so a kind of, its In additional amino acid sequence be integrated into mature polypeptide and the peptide sequence that forms (such as targeting sequencing or secretion sequence or be used for pure Change sequence or the proteinogen sequence of this polypeptide). By the elaboration of this paper, such fragment, derivative and analog are considered to Within those skilled in the art's ken.

The present invention also provides the nucleic acid (polynucleotides) that separates, and these polynucleotides have SEQ ID NO:2 ammonia by coding substantially The polynucleotides of the polypeptide of base acid sequence form. Preferably, polynucleotide sequence of the present invention has SEQ ID NO:1's Nucleotide sequence.

Polynucleotides of the present invention can be dna form or rna form. Dna form comprises cDNA, genomic DNA Or artificial synthetic DNA. DNA can be strand or double-stranded. DNA can be coding strand or noncoding strand. Coding The coding region sequence of mature polypeptide can be identical with the coding region sequence shown in the SEQ ID NO:1 or the variant of degeneracy. As used herein, " variant of degeneracy " refer in the present invention encode and have protein or the polypeptide of SEQ ID NO:2, But with the differentiated nucleotide sequence of coding region sequence shown in the SEQ ID NO:1.

The polynucleotides of the mature polypeptide of coding SEQ ID NO:2 comprise: the coded sequence that only has mature polypeptide; Maturation is many The coded sequence of peptide and various additional code sequence; The coded sequence of mature polypeptide (with optional additional code sequence) and Non-coding sequence.

Term " polynucleotides of coded polypeptide " refer to comprise encode this polypeptide polynucleotides and comprise additional code and/ Or the polynucleotides of non-coding sequence.

The invention still further relates to the variant of foregoing description polynucleotides, its coding has identical amino acid sequence with the present invention The segment of polypeptide or polypeptide, analog and derivative. The variant of these polynucleotides can be the allelic variation of natural generation The variant that body or non-natural take place. These nucleotide diversity bodies comprise and replace variant, deletion mutation body and insert variation Body. As known in the art, allelic variant is a kind of replacement form of polynucleotides, and it may be one or more nuclears The replacement of thuja acid, disappearance or insertion, but can be from the function of the polypeptide that changes in fact its coding.

The invention still further relates to and the polynucleotides of sequence hybridization described above (have at least 50% between two sequences, excellent Choosing has 70% homogeny). The present invention be more particularly directed under stringent condition interfertile many with polynucleotides of the present invention Nucleotides. In the present invention, " stringent condition " refers to: (1) is than the hybridization under LIS and the higher temperature with wash Take off, such as 0.2 * SSC, 0.1%SDS, 60 ℃; Or (2) when hybridization add and use denaturant, such as 50% (v/v) formamide, 0.1% is little Cow's serum/0.1%Ficoll, 42 ℃ etc.; Or (3) only at the homogeny between the two sequences at least more than 95%, be more preferably 97% just hybridizes when above. And, the polypeptide of interfertile polynucleotide encoding and becoming shown in the SEQ ID NO:2 Ripe polypeptide has identical biological function and activity.

The invention still further relates to the nucleic acid fragment with sequence hybridization described above. As used herein, " nucleic acid fragment " Length contains 10 nucleotides at least, better is 20-30 nucleotides at least, is more preferably at least 50-60 nucleotides, Well more than at least 100 nucleotides. Nucleic acid fragment also can be used for the amplification technique (such as PCR) of nucleic acid to determine and/or to divide Polynucleotides from coding BioCPSF.

Polypeptide among the present invention preferably provides with the form of separating with polynucleotides, more preferably is purified to homogeneous.

The special polynucleotide sequence of coding BioCPSF of the present invention can obtain with several different methods. For example, use this area The hybridization technique of knowing is separated polynucleotides. These technology including, but not limited to: 1) with probe and genome or cDNA literary composition The polynucleotide sequence and 2 of homology is hybridized to detect in the storehouse) antibody screening of expression library has the common structure feature to detect Clone's polynucleotide passage.

Sequence dna fragment of the present invention also can obtain with following method: 1) separate double chain DNA sequence from genomic dna; 2) the chemical synthesising DNA sequence is to obtain the double-stranded DNA of described polypeptide.

In the above-mentioned method of mentioning, isolation of genomic DNA is least commonly used.The direct chemical of dna sequence dna is synthetic to be the method for often selecting for use.The more frequent method of selecting for use is the separation of cDNA sequence.The standard method that separates interested cDNA is from the donorcells separating mRNA of this gene of high expression level and carries out reverse transcription, forms plasmid or phage cDNA library.Extract the existing multiple proven technique of method of mRNA, test kit also can obtain (Qiagene) from commercial channels.And the construction cDNA library also is usual method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, ColdSpring Harbor Laboratory.New York, 1989).Also can obtain the cDNA library of commercial offers, as the different cDNA library of Clontech company.When being used in combination the polymeric enzyme reaction technology, even few expression product also can be cloned.

Available ordinary method is screened gene of the present invention from these cDNA libraries.These methods include, but is not limited to: (1) DNA-DNA or DNA-RNA hybridization; (2) appearance of marker gene function or forfeiture; (3) level of the transcript of mensuration BioCPSF; (4), detect the protein product of genetic expression by immunological technique or mensuration biologic activity.Aforesaid method can singly be used, but also several different methods combined utilization.

In (1) kind method, hybridizing used probe is and any a part of homology of polynucleotide of the present invention that at least 10 Nucleotide of its length better are at least 30 Nucleotide, are more preferably at least 50 Nucleotide, preferably at least 100 Nucleotide.In addition, within 2000 Nucleotide, preferable is within 1000 Nucleotide to the length of probe usually.Probe used herein is the dna sequence dna of chemosynthesis on the basis of gene order information of the present invention normally.Gene of the present invention itself or fragment are certainly as probe.The mark of dna probe can be used radio isotope, fluorescein or enzyme (as alkaline phosphatase) etc.

In (4) kind method, detect the protein product of BioCPSF genetic expression and can use immunological technique such as Western blotting, radioimmunoprecipitation, enzyme-linked immunosorbent assay (ELISA) etc.

Use method (Saiki, the et al.Science 1985 of round pcr DNA amplification/RNA; 230:1350-1354) be optimized for acquisition gene of the present invention.When particularly being difficult to from the library, obtain the cDNA of total length, can preferably use RACE method (the terminal rapid amplifying method of RACE-cDNA), the primer that is used for PCR can suitably be selected according to polynucleotide sequence information of the present invention disclosed herein, and available ordinary method is synthetic.Available ordinary method is as the DNA/RNA fragment by gel electrophoresis separation and purifying amplification.

The gene of the present invention that obtains as mentioned above, perhaps the polynucleotide sequence of various dna fragmentations etc. can with ordinary method such as dideoxy chain termination (Sanger et al.PNAS, 1977,74:5463-5467) measure.This class polynucleotide sequence is measured also available commercial sequencing kit etc.In order to obtain the cDNA sequence of total length, order-checking need be carried out repeatedly.Sometimes need to measure a plurality of clones' cDNA sequence, just can be spliced into the cDNA sequence of total length.

The present invention also relates to comprise the carrier of polynucleotide of the present invention, and with carrier of the present invention or directly with the host cell of BioCPSF encoding sequence through the genetically engineered generation, and the method that produces polypeptide of the present invention through recombinant technology.

Among the present invention, the polynucleotide sequence of coding BioCPSF can be inserted in the carrier, contains the recombinant vectors of polynucleotide of the present invention with formation.Term " carrier " refers to that bacterial plasmid well known in the art, phage, yeast plasmid, vegetable cell virus, mammalian cell virus are as adenovirus, retrovirus or other carrier.The carrier of Shi Yonging includes but not limited in the present invention: and the expression vector based on the T7 promotor of in bacterium, expressing (Rosenberg, et al.Gene, 1987,56:125); The pMSXND expression vector of in mammalian cell, expressing (Lee and Nathans, J Bio Chem.263:3521,1988) and at the carrier that derives from baculovirus of expressed in insect cells.In a word, as long as can duplicate in host and stablize, any plasmid and carrier may be used to make up recombinant expression vector.A key character of expression vector is to contain replication origin, promotor, marker gene and translational control element usually.

Available method well-known to those having ordinary skill in the art makes up the dna sequence dna that contains the BioCPSF that encodes and the expression vector of suitable transcribing/translational control element.These methods comprise (Sambroook, et al.Molecular Cloning, a Laboratory Manual, cold SpringHarbor Laboratory.New York, 1989) such as extracorporeal recombinant DNA technology, DNA synthetic technology, the interior recombinant technologys of body.Described dna sequence dna can effectively be connected on the suitable promotor in the expression vector, and is synthetic to instruct mRNA.The representative example of these promotors has: colibacillary lac or trp promotor; The PL promotor of lambda particles phage; Eukaryotic promoter comprises LTRs and some other known may command gene expression promoter in prokaryotic cell prokaryocyte or eukaryotic cell or its virus of CMV immediate early promoter, HSV thymidine kinase promoter, early stage and late period SV40 promotor, retrovirus.Expression vector also comprises ribosome bind site that translation initiation is used and transcription terminator etc.Inserting enhancer sequence in carrier will make its transcribing in higher eucaryotic cells be enhanced.Enhanser is the cis acting factor that DNA expresses, and nearly 10 to 300 base pairs act on promotor transcribing with enhancing gene usually.Can for example be included in the SV40 enhanser of 100 to 270 base pairs of replication origin side in late period one, at the polyoma enhanser of replication origin side in late period one and adenovirus enhanser etc.

In addition, expression vector preferably comprises one or more selected markers, to be provided for selecting the phenotypic character of transformed host cells, cultivate Tetrahydrofolate dehydrogenase, neomycin resistance and the green fluorescent protein (GFP) of usefulness as eukaryotic cell, or be used for colibacillary tsiklomitsin or amicillin resistance etc.

Persons skilled in the art all know how to select appropriate carriers/transcriptional regulatory element (as promotor, enhanser etc.) and selected marker.

Among the present invention, the polynucleotide of coding BioCPSF or the recombinant vectors that contains these polynucleotide can transform or transduce into host cell, contain the genetically engineered host cell of these polynucleotide or recombinant vectors with formation.Term " host cell " refers to prokaryotic cell prokaryocyte, as bacterial cell; Or eukaryotic cell such as low, as yeast cell; Or higher eucaryotic cells, as mammalian cell.The representative example of host cell has: intestinal bacteria, streptomyces; Bacterial cell such as Salmonella typhimurium; Fungal cell such as yeast; Vegetable cell; Insect cell such as fruit bat S2 or Sf9; Zooblast such as CHO, COS or Bowes melanoma cells etc.

Can carry out with routine techniques well known to those skilled in the art with dna sequence dna of the present invention or the recombinant vectors transformed host cell that contains described dna sequence dna.When the host was prokaryotic organism such as intestinal bacteria, the competent cell that can absorb DNA can be used CaCl in exponential growth after date results ₂Method is handled, and used step is well-known in this area.Also available MgCl ₂Carry out.If desired, transforming also the method for available electroporation carries out.When the host is an eukaryote, can select following DNA transfection method for use: coprecipitation of calcium phosphate method, perhaps conventional mechanical method such as microinjection, electroporation, liposome packing etc.

By the recombinant DNA technology of routine, utilize polynucleotide sequence of the present invention to can be used to express or produce BioCPSF (Science, 1984 of reorganization; 224:1431).In general following steps are arranged:

(1). with the polynucleotide (or varient) of coding of the present invention people BioCPSF, or with the recombinant expression vector that contains these polynucleotide proper host cell that transforms or transduce;

(2). in suitable medium, cultivate host cell;

(3). separation, protein purification from substratum or cell.

In step (2), according to used host cell, used substratum can be selected from various conventional substratum in the cultivation.Under the condition that is suitable for the host cell growth, cultivate.After host cell grows into suitable cell density, induce the promotor of selection with suitable method (as temperature transition or chemical induction), cell is cultivated for some time again.

In step (3), recombinant polypeptide can wrap and be expressed or be secreted into the extracellular in cell or on cytolemma.If desired, can utilize its physics, the separating by various separation methods with other characteristic and the albumen of purification of Recombinant of chemistry.These methods are well-known to those skilled in the art.These methods include, but are not limited to: conventional renaturation is handled, protein precipitant is handled (salt analysis method), centrifugal, the broken bacterium of infiltration, the combination of ultrasonication, super centrifugal, sieve chromatography (gel-filtration), adsorption chromatography, ion exchange chromatography, high performance liquid chromatography (HPLC) and other various liquid chromatography (LC) technology and these methods.

The antagonist of polypeptide of the present invention and this polypeptide, agonist and inhibitor can be directly used in disease treatment.BioCPSF albumen or polypeptide can be as the diseases due to pharmacological agent shearing and poly-adenosine specificity factor hypofunction or the forfeiture.The antagonist of BioCPSF can be used to treatment or epidemic prevention disorder, and immunologic derangement comprises but (being not limited to): AIDS, adult respiratory distress syndrome, allergy, asthma, bronchitis, cholecystitis, ulcerative colitis, allergic dermatitis, diabetes, pulmonary emphysema, atrophic gastritis, glomerulonephritis, gout, lupus erythematosus, myasthenia gravis, myocarditis, osteoarthritis, pancreatitis, polymyositis, rheumatic arthritis, scleroderma, Sjogren ' s syndromes, autoimmunization thyroiditis; The cancer complication; Virus, bacterium, fungi infestation etc.Can directly be used as antagonist with BioCPSF specificity bonded antibody, or with target or pass through mechanism medicament be taken in the cell or tissue of expressing BioCPSF indirectly.

The antagonist of BioCPSF or fragment or derivative can be used to treatment or preventing cancer, and cancer includes (but are not limited to): gland cancer, leukemia, lymphoma, melanoma, myelomatosis, sarcoma, lopsided cancer, especially suprarenal gland, bladder, bone, brain, breast, uterus, heart, kidney, liver, lung, muscle, ovary, sialisterium, skin, testis, thymus gland, uterine cervix, pancreas, cancers such as Tiroidina etc.Can directly be used as antagonist with BioCPSF specificity bonded antibody, or with target or pass through mechanism medicament be taken in the cell or tissue of expressing BioCPSF indirectly.The antagonist of BioCPSF or fragment or derivative can be used to treatment or preventing cancer immunologic derangement.

The present invention also provides SCREENED COMPOUND to identify the method that improves (agonist) or check the medicament of (antagonist) BioCPSF.Agonist improves BioCPSF biological function such as stimulate cellular proliferation, and antagonist prevention disorder such as the various cancer relevant with cell hyperproliferation with treatment.For example, in the presence of medicine, the BioCPSF with mark cultivates with mammalian cell or the film preparation of expressing BioCPSF, measures medicine then and improves or check this interactional ability, thereby identify agonist or antagonist.

The antagonist of BioCPSF comprises antibody, compound, acceptor disappearance thing and the analogue etc. that filter out.The antagonist of BioCPSF can combine and eliminate its function with BioCPSF, or suppresses the generation of this polypeptide, or combines with the avtive spot of this polypeptide and to make this polypeptide can not bring into play biological function.

In screening during as the compound of antagonist, BioCPSF can be added during bioanalysis measures, by measuring compound interactional influence between BioCPSF and its acceptor is determined whether compound is antagonist.With the same quadrat method of above-mentioned SCREENED COMPOUND, can filter out the acceptor disappearance thing and the analogue of antagonist action.Can be incorporated into the rondom polypeptide storehouse that solid formation forms by the various amino acid that may make up by screening with BioCPSF bonded peptide molecule obtains.During screening, generally tackle the BioCPSF molecule and carry out mark.

The invention provides and use polypeptide, and fragment, derivative, analogue or their cell are as the method for antigen with production antibody.These antibody can be polyclonal antibody or monoclonal antibody.The present invention also provides the antibody at the BioCPSF antigenic determinant.These antibody include, but is not limited to: the fragment that polyclonal antibody, monoclonal antibody, chimeric antibody, single-chain antibody, Fab fragment and Fab expression library produce.

The method of the available BioCPSF direct injection of the production of polyclonal antibody immune animal (as rabbit, mouse, rat etc.) obtains, and multiple adjuvant can be used for enhancing immunity reaction, comprising but be not limited to freund's adjuvant etc.The technology of the monoclonal antibody of preparation BioCPSF includes, but is not limited to: and hybridoma technology (Kohler and Milstein.Nature, 1975,256:495-497), three knurl technology, people B-quadroma technology, EBV-hybridoma technology etc.With the variable region bonded chimeric antibody in human constant region and inhuman source can with existing technology production (Morrison etal, PNAS, 1985,81:6851).And the technology of existing manufacture order chain antibody (U.S.Pat No.4946778) also can be used for producing the single-chain antibody of anti-BioCPSF.

The antibody of anti-BioCPSF can be used in the immunohistochemistry technology, detects the BioCPSF in the biopsy specimen.With the also available labelled with radioisotope of BioCPSF bonded monoclonal antibody, inject in the body and can follow the tracks of its position and distribution.This radiolabeled antibody can be used as a kind of atraumatic diagnostic method and is used for the location of tumour cell and has judged whether transfer.

Antibody also can be used for designing the immunotoxin at a certain privileged sites in the body.As the monoclonal antibody of BioCPSF high-affinity can with bacterium or plant poison (as diphtheria toxin, ricin, abrine etc.) covalent attachment.A kind of usual method is with sulfydryl linking agent such as SPDP, attacks the amino of antibody, by the exchange of disulfide linkage, toxin is incorporated on the antibody, and this hybrid antibody can be used for killing the BioCPSF positive cells.

The disease that antibody among the present invention can be used for treating or prevention is relevant with BioCPSF.The antibody that gives suitable dosage can stimulate or block generation or the activity of BioCPSF.

The invention still further relates to the diagnostic testing process of quantitative and detection and localization BioCPSF level.These tests are known in the art, and comprise that FISH measures and radioimmunoassay.The BioCPSF level that is detected in the test can be with laying down a definition the importance of BioCPSF in various diseases and be used to the disease of diagnosing BioCPSF to work.

Polypeptide of the present invention also can be used as the peptide spectrum analysis, for example, the polypeptide available physical, chemistry or enzyme carry out the specificity cutting, and carries out the two-dimentional or three-dimensional gel electrophoresis analysis of one dimension, be more preferably and carry out mass spectroscopy.

The polynucleotide of coding BioCPSF also can be used for multiple therapeutic purpose.Gene therapy technology can be used for treating because cell proliferation, growth or the metabolic disturbance due to the nothing expression of BioCPSF or the unusual/non-activity expression.The gene therapy vector (as virus vector) of reorganization can be designed for the BioCPSF that expresses variation, to suppress endogenic BioCPSF activity.For example, a kind of BioCPSF of variation can be the BioCPSF that shortens, lacked signal conduction function territory, though can combine with the substrate in downstream, lacks signaling activity.Therefore the gene therapy vector of reorganization can be used for treating the disease of BioCPSF expression or active caused by abnormal.Deriving from viral expression vector such as retrovirus, adenovirus, adeno-associated virus (AAV), hsv, parvovirus etc. can be used for the polynucleotide of coding BioCPSF are transferred in the cell.The method of recombinant viral vector that structure carries the polynucleotide of coding BioCPSF be found in existing document (Sambrook, etal.).The polynucleotide of reorganization coding BioCPSF can be packaged in the liposome and be transferred in the cell in addition.

Polynucleotide import tissue or intracellular method comprises: directly be injected into polynucleotide in the in-vivo tissue; Or external by carrier (as virus, phage or plasmid etc.) earlier with the polynucleotide transfered cell in, again cell is transplanted in the body etc.

Suppress the oligonucleotide (comprising sense-rna and DNA) of BioCPSF mRNA and ribozyme also within the scope of the invention.Ribozyme is the enzyme sample RNA molecule that a kind of energy specificity is decomposed specific RNA, and its mechanism of action is to carry out the endonuclease effect after ribozyme molecule and the hybridization of complementary target RNA-specific.The RNA of antisense and DNA and ribozyme can obtain with existing any RNA or DNA synthetic technology, as the technology widespread use of solid phase phosphoamide chemical synthesis synthetic oligonucleotide.Antisense rna molecule can be transcribed acquisition by the dna sequence dna of this RNA that encodes in external or body.This dna sequence dna has been incorporated into the downstream of rna polymerase promoter of carrier.In order to increase the stability of nucleic acid molecule, available several different methods is modified it, and as increasing the sequence length of both sides, the connection between the ribonucleoside is used phosphoric acid thioester bond or peptide bond but not phosphodiester bond.

The polynucleotide of coding BioCPSF can be used for the diagnosis with the relative disease of BioCPSF.The unconventionality expression of the expression that the polynucleotide of coding BioCPSF can be used for detecting BioCPSF BioCPSF whether or under morbid state.As the dna sequence dna of the BioCPSF that encodes can be used for biopsy specimen is hybridized to judge the expression situation of BioCPSF.Hybridization technique comprises the Southern blotting, Northern blotting, in situ hybridization etc.These technological methods all are disclosed mature technologies, and relevant test kit all can obtain from commercial channels.Part or all of polynucleotide of the present invention can be used as probe stationary on microarray (Microarray) or DNA chip (being called " gene chip " again), is used for analyzing the differential expression analysis and the gene diagnosis of tissue gene.Carry out the transcription product that RNA-polymerase chain reaction (RT-PCR) amplification in vitro also can detect BioCPSF with the special primer of BioCPSF.

The sudden change that detects the BioCPSF gene also can be used for the disease of diagnosing BioCPSF relevant.The form of BioCPSF sudden change comprises that the point mutation compared with normal wild type BioCPSF dna sequence dna, transposition, disappearance, reorganization and other are any unusual etc.Available existing technology such as Southern blotting, dna sequence analysis, PCR and in situ hybridization detect sudden change.In addition, sudden change might influence proteic expression, therefore can judge indirectly that with Northern blotting, Western blotting gene has or not sudden change.

Sequence of the present invention identifies it also is valuable to karyomit(e).This sequence can be specifically at certain bar human chromosome particular location and and can with its hybridization.At present, need to identify the concrete site of each gene on the karyomit(e).Now, have only chromosomal marker thing seldom to can be used for the marker chromosomes position based on actual sequence data (repetition polymorphism).According to the present invention, for these sequences are associated with disease related gene, its important the first step is positioned these dna sequence dnas on the karyomit(e) exactly.

In brief, prepare PCR primer (preferred 15-35bp), sequence can be positioned on the karyomit(e) according to cDNA.Then, these primers are used for the somatocyte hybrid cell that the PCR screening contains each bar human chromosome.Have only those hybrid cells that contain corresponding to the people's gene of primer can produce the fragment of amplification.

The PCR localization method of somatocyte hybrid cell is that DNA is navigated to concrete chromosomal quick method.Use Oligonucleolide primers of the present invention,, can utilize one group to realize inferior location from specific chromosomal fragment or a large amount of genomic clone by similar approach.Other the similar strategy that can be used for chromosomal localization comprises in situ hybridization, uses the karyomit(e) prescreen and the hybridization preliminary election of the airflow classification of mark, thereby makes up the special cDNA storehouse of karyomit(e).

The cDNA clone is carried out fluorescence in situ hybridization (FISH) with Metaphase Chromosome, can in a step, accurately carry out chromosomal localization.The summary of this technology is referring to Verma etc., Human Chromosomes:a Manual of BasicTechniques, Pergamon Press, New York (1988).

In case sequence is positioned to chromosome position accurately, the physical location of this sequence on karyomit(e) just can be associated with the gene map data.These data for example are found in, V.Mckusick, Mendelian Inheritance in Man (can by with the online acquisition of Johns Hopkins University Welch Medical Library).Can pass through linkage analysis then, determine gene and navigated to relation between the disease on the chromosomal region already.

Then, need to measure ill and not cDNA between diseased individuals or genome sequence difference.If observe certain sudden change in some or all of diseased individuals, and this sudden change is not observed in any normal individual, then this sudden change may be the cause of disease of disease.More ill and diseased individuals not is usually directed at first seek the variation of structure in the karyomit(e), as from the horizontal visible of karyomit(e) or use based on detectable disappearance of the PCR of cDNA sequence or transposition.Resolving power according to present physical mapping and assignment of genes gene mapping technology, being accurately positioned to the cDNA of the chromosomal region relevant with disease, can be a kind of (the supposing that 1 megabasse mapping resolving power and every 20kb are corresponding to a gene) between 50 to 500 potential Disease-causing genes.

Polypeptide of the present invention, polynucleotide and stand-in thereof, agonist, antagonist and inhibitor and suitable pharmaceutical carrier (pharmaceutically acceptable carrier) combination back can be used.These carriers can be water, glucose, ethanol, salt, damping fluid, glycerine and their combination.Composition comprises the polypeptide of the present invention or the antagonist of safe and effective amount and carrier and the vehicle that does not influence effect of drugs.These compositions can be used as medicine and are used for disease treatment.

The present invention also provides medicine box or the test kit that contains one or more containers, and one or more medicinal compositions compositions of the present invention are housed in the container.With these containers, can have by the given indicative prompting of government authorities of making, using or selling medicine or biological products, the government authorities that this prompting reflects production, uses or sells permits it to use on human body.In addition, polypeptide of the present invention can be used in combination with other treatment compound.

Pharmaceutical composition can be with mode administration easily, as by in part, intravenously, intraperitoneal, intramuscular, subcutaneous, the nose or the route of administration of intracutaneous.BioCPSF comes administration with the amount that treats and/or prevents concrete indication effectively.The amount and the dosage range that are applied to patient's BioCPSF will depend on many factors, as administering mode, person's to be treated healthiness condition and diagnostician's judgement.

In an example of the present invention, a kind of isolating polynucleotide are provided, its coding has the mature polypeptide of aminoacid sequence shown in the SEQ ID NO:2.These polynucleotide are to find from the cDNA library of people's fetal brain tissue, and the polynucleotide sequence total length is 1938 bases, its open reading frame (652-1680) 342 amino acid of having encoded.Relatively find according to amino acid sequence homologous, the shearing of this polypeptide and B.taurus and poly-adenosine specific factor protein (Z98551) have 42% homology, infer that thus the new people BioCPSF of the present invention has shearing and the similar 26S Proteasome Structure and Function of poly-adenosine specific factor protein gene family.

The cDNA of people BioCPSF provided by the present invention, oligonucleotide, polypeptide and antibody etc., for shear in research different tissues and the cell and effect, the diagnosis of poly-adenosine specific factor protein sheared and the imbalance of poly-adenosine specific factor protein diseases related, screen inhibitor or these diseases of pharmacological agent have important value.

Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to people such as normal condition such as Sambrook, molecular cloning: laboratory manual (New York:Cold Spring Harbor Laboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.The clone of embodiment 1:BioCPSF cDNA

Extract the total RNA of people's tire brain with guanidinium isothiocyanate/phenol/chloroform single stage method.From total RNA, separate poly (A) mRNA with Quik mRNA Isolation Kit (Qiegene company product).2ug poly (A) mRNA forms cDNA through reverse transcription.CDNA fragment orientation is inserted on the multiple clone site of pBSK (+) carrier (Clontech company product) with Smart cDNA clone's test kit (available from Clontech), transforms DH5 α bacterium and form the cDNA library.Measure the sequence of all clones' 5 ' and 3 ' end with dyestuff termination circulating reaction sequencing kit (Perkin-Elmer company product) and ABI 377 automatic sequencings views (Perkin-Elmer company).CDNA sequence and the existing public dna sequence data storehouse (Genebank) measured are compared, and the cDNA sequence that found that one of them clone (0130b07) is new DNA.By synthetic a series of primers the contained insertion cDNA fragment of this clone is carried out two-way mensuration.The result shows, the contained full-length cDNA of 0130b07 clone is 1938bp (shown in SEQ ID NO:1), from 652bp to 1680bp the open reading frame (ORF) of a 477bp, the new protein (shown in SEQ ID NO:2) of encoding arranged.This clone is named as pBS-0130b07, and its encoded protein matter name is sheared and poly-adenosine specificity factor (abbreviating " BioCPSF " as) for the people.Embodiment 2:cDNA clone's homology retrieval

With the sequence and the encoded protein sequence thereof of people BioCPSF gene of the present invention, with Blast program (Basic localAlignment search tool) [Altschul, SF et al.J.Mol.Biol.1990; 215:403-10], carry out the homology retrieval at databases such as Genbank, Swissport.The gene the highest with people BioCPSF dna homolog of the present invention is the shearing of a kind of known B.taurus and the gene of poly-adenosine specificity factor, and its encoded protein number is Z98551 in the access of Genbank.The protein homology comparative result is shown in Fig. 1, both height homologies, and its homogeny is 43%; Similarity is 65%.This shows that novel polypeptide of the present invention has the 26S Proteasome Structure and Function of shearing and poly-adenosine specificity factor.Embodiment 3: with RT-PCR method clone BioCPSF gene

Total RNA is a template with fetus brain cell, is that primer carries out the synthetic cDNA of reverse transcription reaction with oligo-dT, with behind the test kit purifying of Qiagene, carries out pcr amplification with following primer:

Primer 1:5 '-TAAGTAGGCTGAGGTGTCTT-3 ' (SEQ ID NO.3)

Primer 2: 5 '-CTTTTGTTCAGCTTTTACTG-3 ' (SEQ ID NO.4)

The forward sequence that primer 1 begins for the 1bp that is positioned at 5 of SEQ ID NO:1 ' end; Primer 2 is 3 among a SEQ ID NO:1 ' end reverse sequence.

The condition of amplified reaction: in the reaction volume of 50 μ l, contain 50mmol/L KCl, 10mmol/LTris-Cl, (pH8.5), 1.5mmol/L MgCl ₂, 200 μ mol/L dNTP, l0pmol primer, the Taq archaeal dna polymerase of 1U (Clontech company product).Go up by 25 cycles of following conditioned response at PE9600 type DNA thermal cycler (Perkin-Elmer company): 94 ℃ of 30sec; 55 ℃, 30sec; 72 ℃ of 2min.When RT-PCR, establish the blank negative contrast of positive contrast of beta-actin and template simultaneously.Amplified production is connected to (Invitrogen company product) on the pCR carrier with the test kit purifying of QIAGEN company with TA clone test kit.Dna sequence analysis is the result show, the 1-1938bp shown in the dna sequence dna of PCR product and the SEQ IDNO:1 is identical.Embodiment 4:Northern blotting is analyzed the BioCPSF expression of gene:

Extract total RNA[Anal.Biochem 1987,162,156-159 with single stage method].This method comprises acid guanidine thiocyanate phenol-chloroform extracting.Promptly use 4M guanidinium isothiocyanate-25mM Trisodium Citrate, 0.2M sodium acetate (pH4.0) advances ground homogenate to tissue, adds the phenol of 1 times of volume and the chloroform-primary isoamyl alcohol (49: 1) of 1/5 volume, and is centrifugal after mixing.The sucking-off aqueous phase layer adds Virahol (0.8 volume) and with the centrifugal RNA precipitation that obtains of mixture.With RNA precipitation 70% washing with alcohol that obtains, dry and soluble in water.

With 20 μ g RNA, on 1.2% sepharose that contains 20mM 3-(N-morpholino) propanesulfonic acid (pH7.0)-5mM sodium acetate-1mM EDTA-2.2M formaldehyde, carry out electrophoresis.Be transferred on the nitrocellulose filter then.With α- ³²P dATP prepares by random priming ³²The dna probe of P-mark.Used dna probe is a BioCPSF coding region sequence shown in the SEQ 1, pcr amplification (652bp to 1680bp).Will ³²The probe of P-mark (about 2 * 10 ⁶Cpm/ml) spend the night in 42 ℃ of hybridization in solution with the nitrocellulose filter that has shifted RNA, this solution comprises 50% methane amide-25mM KH ₂PO ₄(pH7.4)-5 * SSC-5 * Denhardt ' s solution and 200 μ g/ml salmon sperm DNAs.After the hybridization, filter membrane is washed 30min in 55 ℃ in 1 * SSC-0.1%SDS.Then, analyze with quantitative with Phosphor Imager.Embodiment 5: vivoexpression, separation and the purifying of reorganization BioCPSF

According to SEQ ID NO:1 and coding region sequence shown in Figure 1, design a pair of specificity amplification primer, sequence is as follows:

Primer 3:5 '-CCCGAATTCTGAACCTGAAGGTGCCCATC-3 ' (SEQ ID No 5)

Primer 4:5 '-CCCGCGGCCGCTCAGCTGGGGGCCTGGGGGA-3 ' (SEQ ID No 6)

5 ' end of these two sections primers contains EcoRI and NotI restriction enzyme site respectively, be respectively the encoding sequence of target gene 5 end and 3 ' end thereafter, EcoRI and NotI restriction enzyme site are corresponding to expression vector plasmid pET-28b (+) (Novagen company product, Cat.No.69865.3) the selectivity restriction enzyme site on.With the pBS-0130b07 plasmid that contains the total length goal gene is template, carries out the PCR reaction.The PCR reaction conditions is: contain pBS-0130b07 plasmid 10pg, primer 3 and primer 4 among the cumulative volume 50 μ l and be respectively 10pmmol, Advantage polymerase Mix (Clontech company product) 1 μ l.Loop parameter: 94 ℃ of 20s, 60 ℃ of 30s, 68 ℃ of 2 min, totally 25 circulations.Respectively amplified production and plasmid pET-28 (+) are carried out double digestion with EcoRI and NotI, reclaim big fragment respectively, and connect with the T4 ligase enzyme.Connect product and transform, after the dull and stereotyped overnight incubation of the LB that contains kantlex (final concentration 30 μ g/ml), use the colony polymerase chain reaction (PCR) method screening positive clone, and check order with the big enterobacterial Dh5 of Calcium Chloride Method α.Select the correct positive colony of sequence (pET-0130b07) with Calcium Chloride Method with recombinant plasmid transformed e. coli bl21 (DE3) plySs (Novagen company product).In the LB liquid nutrient medium that contains kantlex (final concentration 30 μ g/ml), host bacterium BL21 (pET-0130b07) is cultured to logarithmic phase at 37 ℃, adds IPTG to final concentration 1mmol/L, continues to cultivate 5 hours.Centrifugal collection thalline, through the broken bacterium of ultrasonic wave, centrifugal collection supernatant with carrying out chromatography with 6 Histidines (6His-Tag) bonded affinity column His.BindQuick Cartridge (Novagen company product), has obtained the target protein BioCPSF of purifying.Through the SDS-PAGE electrophoresis, obtain a single band at the 38kDa place.This band is transferred on the pvdf membrane carries out the n terminal amino acid sequential analysis with the Edams hydrolysis method, 15 amino acid of N-end hold 15 amino-acid residues identical with the N-shown in the SEQ ID NO:2 as a result.Embodiment 6: anti-BioCPSF production of antibodies

With the synthetic specific polypeptide of following BioCPSF: the Met-Asn-Leu-Lys-Val-Pro-Ile-Tyr-Phe-Ser-Thr-Gly-Leu-Thr-Glu (SEQ ID NO:7) of Peptide synthesizer (PE company product).Form compoundly with hemocyanin and bovine serum albumin coupling this polypeptide respectively, method is referring to Avrameas, et al.Immunochemistry, 1969; 6:43.Add the complete Freund's adjuvant immunizing rabbit with the above-mentioned hemocyanin polypeptide complex of 4mg, add the incomplete Freund's adjuvant booster immunization once with the hemocyanin polypeptide complex again after 15 days.Employing is done the titre that ELISA measures antibody in the rabbit anteserum through the titer plate of 15 μ g/ml bovine serum albumin polypeptide complex bag quilts.From the rabbit anteserum of antibody positive, separate total IgG with albumin A-Sepharose.Polypeptide is incorporated on the Sepharose4B post of cyanogen bromide-activated, from total IgG, separates anti-peptide antibody with affinity chromatography.Immuno-precipitation proof antibody purified can combine with BioCPSF specifically.

Sequence table

(1) general information:

(i) denomination of invention: new people shears and poly-adenosine specificity factor and encoding sequence thereof

(ii) sequence number: 7

(2) information of SEQ ID NO:1:

(i) sequence signature:

(A) length: 1938bp

(B) type: nucleic acid

(C) chain: two strands

(D) topological framework: linearity

(ii) molecule type: cDNA

( iii ) ：SEQ ID NO：1： 1 TAAGTAGGCTGAGGTGTCTTTTTGTCCCGTGGGCCCCCCTGGAGCTCAGGACCCTTGCAG 61 GTGTCAGGGTGCCAGCCCTTGAGTGGCCAGCCTGGCAGTGTCTCCCATGTCCTGTGCGGC121 CTGGAGAGCCCCCTTCGTTCTGGGCCCAAATGCGCGAAGGCACAGGGTCCAGGCAGGGGC181 CTCTGTCCCTCCTTCTCTCTCTTCCCAAGTCTCTGGGTGGGTGCCTCTGTCTCGCTCTTC241 CGAAGTGTCTGGGTGGGTGCCTCTGTCTCTCCTCTCTCTTCCCAAGTGTGCTGCCCACAG301 CATTTTACCAGCTGGCTCTTTCCAGCCAGAGTGACCTAGGAAGGCGGCTGGGCGTGGTAC361 TGGGGTCCAGCTTGTCACACCCAGCCCTGCAACCGTGGGGACAGTGCATCGTGGCTCACA421 CCCCCACCCCCGTGTTCCAGAGCTGCCTGGATTGACAAGTGCCGCCCCAACCTGCTCATC481 ACAGAGTCCACGTACGCCACGACCATCCGTGACTCCAAGCGCTGCCGGGAGCGAGACTTC541 CTGAAGAAAGTCCACGAGACCGTGGAGCGTGGTGGGAAGGTGCTGATACCTGTGTTCGCG601 CTGGGCCGCGCCCAGGAGCTCTGCATCCTCCTGGAGACCTTCTGGGAGCGCATGAACCTG661 AAGGTGCCCATCTACTTCTCCACGGGGCTGACCGAGAAGGCCAACCACTACTACAAGCTG 721 TTCATCCCCTGGACCAACCAGAAGATCCGCAAGACTTTCGTGCAGAGGAACATGTTTGAG 781 TTCAAGCACATCAAGGCCTTCGGCCGGGCTTTTGCTGACAACCCAGGACCGATGGTTGTG 841 TTTGCCACGCCAGGAATGCTGCACGCTGGGCAGTCCCTGCAGATCTTCCGGAAATGGGCC 901 GGAAACGAAAAGAACATGGTCATCATGCCCGGCTACTGCGTGCAGGGCACCGTCGGCCAC 961 AAGATCCTCAGCGGGCAGCGGAAGCTCGAGATGGAGGGGCGGCAGGTGCTGGAGGTCAAG1021 ATGCAGGTGGAGTACATGTCATTCAGCGCACACGCGGACGCCAAGGGCATCATGCAGCTG1081 GTGGGCCAGGCAGAGCCGGAGAGCGTGCTGCTGGTGCATGGCGAGGCCAAGAAGATGGAG1141 TTCCTGAAGCAGAAGATCGAGCAGGAGCTCCGGGTCAACTGCTACATGCCGGCCAATGGC1201 GAGACGGTGACGCTGCCCACAAGCCCCAGCATCCCCGTAGGCATCTCGCTGGGGCTGCTG1261 AAGCGGGAGATGGCGCAGGGGCTGCTCCCTGAGGCCAAGAAGCCTCGGCTCCTGCACGGC1321 ACCCTGATCATGAAGGACAGCAACTTCCGGCTGGTGTCCTCAGAGCAAGCCCTCAAAGAG1381 CTGGGTCTGGCTGAGCACCAGCTGCGCTTCACCTGCCGCGTGCACCTGCATGACACACGC1441 AAGGAGCAGGAGACGGCATTGCGCGTCTACAGCCACCTCAAGAGCGTCCTGAAGGACCAC1501 TGTGTGCAGCACCTCCCAGACGGCTCTGTGACTGTGGAGTCCGTCCTCCTCCAGGCCGCC1561 GCCCCTTCTGAGGACCCAGGCACCAAGGTGCTGCTGGTCTCCTGGACCTACCAGGACGAG1621 GAGCTGGGGAGCTTCCTCACATCTCTGCTGAAGAAGGGCCTCCCCCAGGCCCCCAGCTGA1681 GGCCGGCAACTCACCCAGCCGCCACCTCTGCCCTCTCCCAGCTGGACAGACCCTGGGCCT1741 GCACTTCAGGACTGTGGGTGCCCTGGGTGAACAGACCCTGCAGGTCCCATCCCTGGGGAC1801 AGAGGCCTTGTGTCACCTGCCTGCCCAGGCAGCTGTTTGCAGCTGAAGAAACAAACTGGT1861 CTCCAGGCTGTCTTGCCTTTATTCCTGGTTAGGGCAGGTGGTCCTAGACAGCAGTTTCCA1921 GTAAAAGCTGAACAAAAG

(3) information of SEQ ID NO:2:

(i) sequence signature:

(A) length: 342 amino acid

(B) type: amino acid

(D) topological framework: linearity

(ii) molecule type: polypeptide

( iii ) ：SEQ ID NO：2： 1 Met Asn Leu Lys Val Pro Ile Tyr Phe Ser Thr Gly Leu Thr Glu16 Lys Ala Asn His Tyr Tyr Lys Leu Phe Ile Pro Trp Thr Asn Gln31 Lys Ile Arg Lys Thr Phe Val Gln Arg Asn Met Phe Glu Phe Lys46 His Ile Lys Ala Phe Gly Arg Ala Phe Ala Asp Asn Pro Gly Pro61 Met Val Val Phe Ala Thr Pro Gly Met Leu His Ala Gly Gln Ser76 Leu Gln Ile Phe Arg Lys Trp Ala Gly Asn Glu Lys Asn Met Val91 Ile Met Pro Gly Tyr Cys Val Gln Gly Thr Val Gly His Lys Ile106 Leu Ser Gly Gln Arg Lys Leu Glu Met Glu Gly Arg Gln Val Leu121 Glu Val Lys Met Gln Val Glu Tyr Met Ser Phe Ser Ala His Ala136 Asp Ala Lys Gly Ile Met Gln Leu Val Gly Gln Ala Glu Pro Glu151 Ser Val Leu Leu Val His Gly Glu Ala Lys Lys Met Glu Phe Leu166 Lys Gln Lys Ile Glu Gln Glu Leu Arg Val Asn Cys Tyr Met Pro181 Ala Asn Gly Glu Thr Val Thr Leu Pro Thr Ser Pro Ser Ile Pro196 Val Gly Ile Ser Leu Gly Leu Leu Lys Arg Glu Met Ala Gln Gly211 Leu Leu Pro Glu Ala Lys Lys Pro Arg Leu Leu His Gly Thr Leu226 Ile Met Lys Asp Ser Asn Phe Arg Leu Val Ser Ser Glu Gln Ala241 Leu Lys Glu Leu Gly Leu Ala Glu His Gln Leu Arg Phe Thr Cys256 Arg Val His Leu His Asp Thr Arg Lys Glu Gln Glu Thr Ala Leu271 Arg Val Tyr Ser His Leu Lys Ser Val Leu Lys Asp His Cys Val286 Gln His Leu Pro Asp Gly Ser Val Thr Val Glu Ser Val Leu Leu301 Gln Ala Ala Ala Pro Ser Glu Asp Pro Gly Thr Lys Val Leu Leu316 Val Ser Trp Thr Tyr Gln Asp Glu Glu Leu Gly Ser Phe Leu Thr331 Ser Leu Leu Lys Lys Gly Leu Pro Gln Ala Pro Ser

(4) information of SEQ ID NO:3

(i) sequence signature

(A) length: 20 bases

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: oligonucleotide

(iii) sequence description: SEQ ID NO:3:TAAGTAGGCTGAGGTGTCTT 20

(5) information of SEQ ID NO:4

(i) sequence signature

(A) length: 20 bases

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: oligonucleotide

(iii) sequence description: SEQ ID NO:4:CTTTTGTTCAGCTTTTACTG 20

(6) information of SEQ ID NO:5

(i) sequence signature

(A) length: 29 bases

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: oligonucleotide

(iii) sequence description: SEQ ID NO:5:CCCGAATTCTGAACCTGAAGGTGCCCATC 29

(7) information of SEQ ID NO:6

(i) sequence signature

(A) length: 31 bases

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ii) molecule type: oligonucleotide

(iii) sequence description: SEQ ID NO:6:CCCGCGGCCGCTCAGCTGGGGGCCTGGGGGA 31

(8) information of SEQ ID NO:7:

(i) sequence signature:

(A) length: 15 amino acid

(B) type: amino acid

(D) topological framework: linearity

(ii) molecule type: polypeptide

(iii) sequence description: SEQ ID NO:7:Met-Asn-Leu-Lys-Val-Pro-Ile-Tyr-Phe-Ser-Thr-Gly-Leu-Thr-Glu 15

Claims (18)

1, a kind of isolating people BioCPSF polypeptide is characterized in that it is to have: the polypeptide of the aminoacid sequence shown in the SEQ ID NO.2 or fragment, analogue or the derivative of its polypeptide.

2, polypeptide as claimed in claim 1 is characterized in that, it is that polypeptide or its amino acid variation with the aminoacid sequence shown in the SEQ ID NO.2 are no more than 5% derivative.

3, polypeptide as claimed in claim 2 is characterized in that, it is the polypeptide with the aminoacid sequence shown in the SEQ ID NO.2.

4, a kind of isolating polynucleotide is characterized in that, described polynucleotide are to be selected from down group:

(a) coding has the polynucleotide of the polypeptide of aminoacid sequence shown in the SEQ ID NO.2 or its fragment, analogue, derivative;

(b) with polynucleotide (a) complementary polynucleotide;

(c) with (a) or the polynucleotide of at least 70% homogeny (b) are arranged.

5, polynucleotide as claimed in claim 4 is characterized in that, described polynucleotide are polynucleotide that coding has aminoacid sequence shown in the SEQ ID NO.2.

6, polynucleotide as claimed in claim 4 is characterized in that, the sequence of described polynucleotide is the sequences that have the sequence of 652-1680 position among the SEQ ID NO.1 or have 1-1938 position among the SEQ ID NO.1.

7, a kind of recombinant vectors that contains exogenous polynucleotide is characterized in that, it is by the recombinant vectors that requires 4 described polynucleotide and plasmid, virus or vehicle expression vector establishment to form.

8, a kind of genetically engineered host cell that contains exogenous polynucleotide is characterized in that, it is to be selected from following a kind of host cell:

(a) host cell that transforms or transduce with the described recombinant vectors of claim 7;

(b) host cell that transforms or transduce with the described polynucleotide of claim 4.

9, a kind of preparation method with the active polypeptide of BioCPSF is characterized in that, described method comprises:

(a) being fit to express under the BioCPSF condition, cultivate the described through engineering approaches host cell of claim 8;

(b) from culture, isolate and have the active polypeptide of BioCPSF.

10, a kind of can with polypeptide bonded antibody, it is characterized in that, described antibody be can with BioCPSF specificity bonded antibody.

11, the compound of an analoglike or adjusting polypeptide active or expression, it is characterized in that it is the active compound of simulation BioCPSF, or promote the active compound of BioCPSF, or the active compound of antagonism BioCPSF, or the active compound of inhibition BioCPSF.

12, compound as claimed in claim 11 is characterized in that, it is the polynucleotide sequence shown in the SEQ ID NO.1 or its segmental antisense sequences.

13, the described application of compound of a kind of claim 11 is characterized in that, described compound be used to regulate BioCPSF in vivo, the method for external activity.

14, a kind of disease relevant with the described BioCPSF polypeptide of claim 1 or method of disease susceptibility of detecting is characterized in that, is to detect the relevant disease or the susceptibility of disease by the method that is selected from down group:

Whether (a) detect described expression of polypeptides amount indirectly or directly unusual;

Whether (b) detect described polypeptide active indirectly or directly unusual;

(c) directly or indirectly detect and cause described expression of polypeptides amount or active unusual nucleotide diversity in the polynucleotide.

15, the application of polypeptide according to claim 1 is characterized in that, it is applied to screen stand-in, agonist, antagonist or the inhibitor of BioCPSF; Perhaps be used for the peptide finger print identification.

16, the application of nucleic acid molecule as claimed in claim 4 is characterized in that it is used for nucleic acid amplification reaction as primer, perhaps is used for hybridization as probe, perhaps is used to make gene chip or microarray.

17, a kind of pharmaceutical composition is characterized in that, it contains the described polypeptide of claim 1 and/or the described polynucleotide of claim 4 and the pharmaceutically acceptable carrier of safe and effective amount.

18, the application of polypeptide as claimed in claim 1 is characterized in that, is used for the treatment of immunologic derangement, the medicine of diseases such as cancer with described polypeptide preparation.

Images