CN1296013A - Novel human membrane granulosa protein and coding sequence - Google Patents

Abstract

The present invention discloses a novel human granule membrane protein-140, called BioHGMP140 for short, polynucleotide for coding said polypeptide and method for producing this polypeptide by using recombination technology. Said invention also discloses a method for curing several diseases of inflammatory reaction, immunologic dysfunction and cancers by using the said polypeptide and polynucleotide. It also discloses an antagonist for resisting said polypeptide and its medical effect. Said invention also discloses a diagnostic testing method based on the identification of mutation in said nucleic acid sequence and horizontal change of said polypeptide expression, and also discloses the application of polynucleotide to coding this new BioHGMP140.

Description

New human membrane granulosa protein and encoding sequence thereof

The invention belongs to biological technical field and field of genetic engineering, specifically, the present invention relates to a kind of new polypeptide--NOVEL HUMAN GRANULE MEMBRANE PROTEIN 140 (Novel Human Granule Membrane Protein140, be called for short " BioHGMP140 "), and the polynucleotide sequence of this polypeptide of encoding.The invention still further relates to the preparation method and the application of these polynucleotide and polypeptide.

Membrane granulosa protein GMP-140 (Granule Membrane Protein 140) is an integral glycoprotein, and it is one of glycoprotein receptor family member.It is discharged by thrombocyte, vascular endothelial cell and Megakaryocytic secretory granules, and wherein the storage particle of endotheliocyte is called Weibel Palade body.When thrombocyte and vascular endothelial cell were activated by agonist (as zymoplasm, ionophore or histamine etc.), GMP-140 redistributed on the plasma membrane rapidly.GMP-140 is rich in halfcystine, high glycosylation, and the major part of its protein structure is positioned at kytoplasm outer [Johnston GI, et al.J.Biol.Chem.1989; 264:1816-23], can be removed with hydrolysis method from the activatory platelet surface.

The molecular structure of GMP-140 comprises six structural domains: the structural domain with signal peptide feature of (1) nearly C-terminal, be rich in polare Aminosaeren; (2) agglutinoid structural domains are rich in Lys, Asp, amino acid such as Try; (3) back with a skins somatomedin structural domain; (4) structural domains that comprise nine continuous repeated fragments, relevant with the combination of complement proteins; (5) membrane spaning domains; (6) short kytoplasm tails.

The mutual conglutination reaction of GMP-140 in the circulation of white corpuscle and vascular endothelial cell plays an important role.It combines with tumour cell in many human cancer tissues, and it is combined in cell surface [Aruffo A, the et al.Proc.Natl.Acad.Sci.USA 1992 of tumor cell line (to remove melanoma) in many cancers; 1589:2292-6].The expressed GMP-140 of activated thrombocyte and vascular endothelial cell is neutrophil(e) cell and monocytic acceptor.This characteristic helps the bonding rapidly of in wounded tissue white corpuscle and endotheliocyte, also helps interacting at the thrombocyte and the white corpuscle of inflammation part and bleeding part.GMP-140 may participate in inflammation, thrombus and the metastases etc. of pathology, and this effect can instruct design at human diseases and have new drug [McEver RP, an et al.J Cell Biochem 1991 that stops bonding function of receptors; 45:156-61].

Studies show that the overexpression of GMP-140 or inhibition and some diseases have substantial connection, for example inflammatory reaction, immunologic derangement and cancer etc.Therefore, be diagnosis, prevention, treatment relative disease, research and development people GMP-140 is significant.

An object of the present invention is to provide isolating new polypeptide--NOVEL HUMAN GRANULE MEMBRANE PROTEIN 140's (abbreviating " BioHGMP140 " as) with and fragment, analogue and derivative.

Another object of the present invention provides the polynucleotide of this BioHGMP140 polypeptide of coding.

Another object of the present invention provides the recombinant vectors of the polynucleotide that contain the BioHGMP140 that encodes.

Another object of the present invention provides the genetically engineered host cell of the polynucleotide that contain the BioHGMP140 that encodes.

Another object of the present invention provides the method for producing BioHGMP140.

Another object of the present invention provides the antibody at BioHGMP140 polypeptide of the present invention.

Another object of the present invention has provided at the simulated compound of BioHGMP140 polypeptide of the present invention, antagonist, agonist, inhibitor.

Another object of the present invention provides the method for the diagnosis disease relevant unusually with BioHGMP140 with treatment.

In a first aspect of the present invention, novel isolated NOVEL HUMAN GRANULE MEMBRANE PROTEIN 140 (BioHGMP140) is provided, this polypeptide is the people source, and it comprises: have the polypeptide of SEQ ID NO:2 aminoacid sequence or its conservative property variation polypeptide or its active fragments or its reactive derivative, analogue.Preferably, this polypeptide is that polypeptide or its amino acid variation with SEQ ID NO:2 aminoacid sequence is no more than 5% derivative.

In a second aspect of the present invention, the polynucleotide of these polypeptide of separated coding are provided, these polynucleotide comprise a nucleotide sequence, and this nucleotide sequence is shown at least 70% homogeny with a kind of nucleotides sequence that is selected from down group: (a) polynucleotide of the above-mentioned BioHGMP140 of coding; (b) with polynucleotide (a) complementary polynucleotide.Preferably, this polynucleotide encoding has the polypeptide of aminoacid sequence shown in the SEQ ID NO:2.More preferably, the sequence of these polynucleotide is be selected from down group a kind of: the sequence that (a) has 15-1526 position among the SEQ ID NO:1; (b) has the sequence of 1-1880 position among the SEQ ID NO:1.

In a third aspect of the present invention, the carrier that contains above-mentioned polynucleotide is provided, and has been transformed or host cell of transduceing or the host cell that is directly transformed or transduce by above-mentioned polynucleotide by this carrier.

Others of the present invention are because disclosing of the technology of this paper is conspicuous to those skilled in the art.

Following accompanying drawing is used to illustrate specific embodiments of the present invention, and is not used in qualification by the scope of the invention that claims defined.

Fig. 1 is the amino acid sequence homology comparison diagram of the membrane granulosa protein GMP-140 (M72332) of NOVEL HUMAN GRANULE MEMBRANE PROTEIN 140 of the present invention (BioHGMP140) and Mus musculus.Same amino acid represents with monocase amino acid that between two sequences similar amino acid is represented with "+".

As used herein, " separation " refer to that material separates (if natural from its primal environment Material, primal environment namely are natural surroundingses). For example, the polynucleotide under the native state in the active somatic cell and Polypeptide does not have separation and purification, but same polynucleotide or polypeptide are such as same its that exists from native state In his material separately, then for separation and purification.

As used herein, " BioHGMP140 albumen or the polypeptide of separation " refers to that BioHGMP140 is substantially free of Natural relative other albumen, lipid, carbohydrate or other material. Those skilled in the art can use standard Purified technology of protein purifying BioHGMP140. Basically pure polypeptide is on non-reduced polyacrylamide gel Can produce single master tape. The purity of BioHGMP140 polypeptide can be determined with amino acid analysis.

The invention provides a kind of new polypeptide--BioHGMP140 polypeptide, it is by SEQ ID NO basically: Amino acid sequence shown in 2 forms. Polypeptide of the present invention can be recombinant polypeptide, natural polypeptides, synthetic many Peptide, preferred recombinant polypeptide. Polypeptide of the present invention can be the product of natural purifying, or the product of chemical synthesis Thing, or use recombinant technique from protokaryon or eucaryon host (for example, bacterium, yeast, higher plant, insect and the food in one's mouth The breast zooblast) produces in. The host used according to the recombinant production scheme, polypeptide of the present invention can be glycosylation , maybe can be nonglycosylated. Polypeptide of the present invention also can comprise or not comprise that initial methionine is residual Base.

The present invention also comprises fragment, derivative and the analog of BioHGMP140. As used herein, term " fragment ", " derivative " refer to basically keep the natural BioHGMP140 of the present invention mutually with " analog " Biological function together or active polypeptide. The fragment of polypeptide of the present invention, derivative or analog can be: (ⅰ) Have one or more conservative or non-conservation amino acid residue (preferred conservative amino acid residue) is substituted many Peptide, and the amino acid residue of such replacement can be also can not encoded by genetic code, or (ⅱ) exist The polypeptide that has substituted radical in one or more amino acid residues, or (ⅲ) mature polypeptide and another compound (such as the compound that prolongs the polypeptide half-life, for example polyethylene glycol) merges formed polypeptide, or (ⅳ) additional Amino acid sequence be fused to this peptide sequence and the polypeptide that forms (such as targeting sequencing or secretion sequence or be used for purifying The sequence of this polypeptide or proteinogen sequence). According to the instruction of this paper, these fragments, derivative and analog belong to The known range of those skilled in the art.

The present invention also provides the nucleic acid (polynucleotides) that separates, and these polynucleotides have SEQ ID by coding substantially The polynucleotides of the polypeptide of NO:2 amino acid sequence form. Preferably, polynucleotide sequence of the present invention has The nucleotide sequence of SEQ ID NO:1.

Polynucleotides of the present invention can be dna form or rna form. Dna form comprises cDNA, genome DNA or artificial synthetic DNA. DNA can be strand or double-stranded. DNA can be coding strand or non-coding Chain. The coding region sequence of encoding mature polypeptide can be identical with the coding region sequence shown in the SEQ ID NO:1 or The variant of degeneracy. As used herein, " variant of degeneracy " refer to that in the present invention coding has SEQ The protein of ID NO:2 or polypeptide, but with the differentiated nucleic acid order of coding region sequence shown in the SEQ ID NO:1 Row.

The polynucleotides of the mature polypeptide of coding SEQ ID NO:2 comprise: the coded sequence that only has mature polypeptide; Become The coded sequence of ripe polypeptide and various additional code sequence; The coded sequence of mature polypeptide is (with optional additional code Sequence) and non-coding sequence.

Term " polynucleotides of coded polypeptide " refer to comprise encode this polypeptide polynucleotides and comprise additional the volume The polynucleotides of code and/or non-coding sequence.

The invention still further relates to the variant of above-mentioned polynucleotides, its coding has identical amino acid sequence with the present invention Polypeptide or fragment, analog and the derivative of polypeptide. The variant of these polynucleotides can be natural generation The variant that allelic variant or non-natural take place. These nucleotide diversity bodies comprise that replacement variant, disappearance become Allosome and insertion variant. As known in the art, allelic variant is a kind of replacement form of polynucleotides, It may be replacement, disappearance or the insertion of one or more nucleotides, but can be from not changing in fact its coding The function of polypeptide.

The invention still further relates to and the polynucleotides of sequence hybridization described above (have at least between two sequences 50%, preferably have 70% homogeny). The present invention be more particularly directed under stringent condition and multinuclear glycosides of the present invention The interfertile polynucleotides of acid. In the present invention, " stringent condition " refers to: (1) is than LIS and Hybridization under the high-temperature and wash-out, such as 0.2 * SSC, 0.1%SDS, 60 ℃; Or (2) when hybridization be added with denaturant, as 50% (v/v) formamide, 0.1% calf serum/0.1%Ficoll, 42 ℃ etc.; Or (3) are only between two sequences Homogeny is at least more than 95%, is more preferably 97% and just hybridizes when above. And interfertile polynucleotides are compiled The polypeptide of code has identical biological function and activity with the mature polypeptide shown in the SEQ ID NO:2.

The invention still further relates to the nucleic acid fragment with sequence hybridization described above. As used herein, " nucleic acid Fragment " length contain at least 10 nucleotides, better be at least 30 nucleotides, be more preferably at least 50 nucleosides Acid is preferably more than at least 100 nucleotides. The amplification technique (such as PCR) that nucleic acid fragment also can be used for nucleic acid with Determine and/or separate the polynucleotides of coding BioHGMP140.

Polypeptide among the present invention preferably provides with the form of separating with polynucleotides, more preferably is purified to homogeneous.

The special polynucleotide sequence of coding BioHGMP140 of the present invention can obtain with several different methods. For example, Separate polynucleotides with hybridization technique well known in the art. These technology including, but not limited to: 1) with probe with Genome or cDNA library hybridize to detect the polynucleotide sequence and 2 of homology) antibody screening of expression library with Detect the polynucleotide passage of the clone with common structure feature.

Sequence dna fragment of the present invention also can obtain with following method: 1) separate double chain DNA sequence from genomic dna; 2) the chemical synthesising DNA sequence is to obtain the double-stranded DNA of described polypeptide.

In the above-mentioned method of mentioning, isolation of genomic DNA is least commonly used.The direct chemical of dna sequence dna is synthetic to be the method for often selecting for use.The more frequent method of selecting for use is the separation of cDNA sequence.The standard method that separates interested cDNA is from the donorcells separating mRNA of this gene of high expression level and carries out reverse transcription, forms plasmid or phage cDNA library.Extract the existing multiple proven technique of method of mRNA, test kit also can obtain (Qiagene) from commercial channels.And the construction cDNA library also is usual method (Sambrook, et al., MolecularCloning, A Laboratory Manual, Cold Spring Harbor Laboratory.New York, 1989).Also can obtain the cDNA library of commercial offers, as the different cDNA library of Clontech company.When being used in combination polymerase chain reaction technique, even few expression product also can be cloned.

Available ordinary method is screened gene of the present invention from these cDNA libraries.These methods include, but is not limited to: (1) DNA-DNA or DNA-RNA hybridization; (2) appearance of marker gene function or forfeiture; (3) level of mensuration BioHGMP140 transcript; (4), detect the protein product of genetic expression by immunological technique or mensuration biologic activity.Aforesaid method can singly be used, but also several different methods combined utilization.In (1) kind method, hybridizing used probe is and any a part of homology of polynucleotide of the present invention that at least 10 Nucleotide of its length better are at least 3 Nucleotide, are more preferably at least 50 Nucleotide, preferably at least 100 Nucleotide.In addition, within 2000 Nucleotide, preferable is within 1000 Nucleotide to the length of probe usually.Probe used herein is the dna sequence dna of chemosynthesis on the basis of gene order information of the present invention normally.Gene of the present invention itself or fragment are certainly as probe.Dna probe can carry out mark with radio isotope, fluorescein or enzyme (as alkaline phosphatase) etc.

In (4) kind method, detect the protein product of BioHGMP140 genetic expression and can use immunological technique such as Western blotting, radioimmunoprecipitation, enzyme-linked immunosorbent assay (ELISA) etc.

Use method (Saiki, the et al.Science 1985 of round pcr DNA amplification/RNA; 230:1350-1354) be optimized for acquisition gene of the present invention.When particularly being difficult to from the library, obtain the cDNA of total length, can preferably use RACE method (the terminal rapid amplifying method of RACE-cDNA).The primer that is used for PCR can suitably be selected according to polynucleotide sequence information of the present invention disclosed herein, and available ordinary method is synthetic.Available ordinary method is as the DNA/RNA fragment by gel electrophoresis separation and purifying amplification.

The gene of the present invention that obtains as mentioned above or the nucleotide sequence of its various dna fragmentations, and available ordinary method such as dideoxy chain termination (Sanger et al.PNAS, 1977,74:5463-5467) measure.This class polynucleotide sequence is measured also available commercial sequencing kit.In order to obtain the cDNA sequence of total length, order-checking need be carried out repeatedly.Sometimes need to measure a plurality of clones' cDNA sequence, just can be spliced into the cDNA sequence of total length.

The present invention also relates to comprise the carrier of polynucleotide of the present invention, and with carrier of the present invention or directly with the host cell of BioHGMP140 encoding sequence through the genetically engineered generation, and the method that produces polypeptide of the present invention through recombinant technology.

Among the present invention, the polynucleotide sequence of coding BioHGMP140 can be inserted in the carrier, contains the recombinant vectors of polynucleotide of the present invention with formation.Term " carrier " refers to that bacterial plasmid well known in the art, phage, yeast plasmid, vegetable cell virus, mammalian cell virus are as adenovirus, retrovirus or other carrier.The carrier of Shi Yonging includes but not limited in the present invention: and the expression vector based on the T7 promotor of in bacterium, expressing (Rosenberg, et al.Gene, 1987,56:125); The pMSXND expression vector of in mammalian cell, expressing (Lee and Nathans, J Bio Chem.263:3521,1988) and at the carrier that derives from baculovirus of expressed in insect cells.In a word, as long as can duplicate in host and stablize, any plasmid and carrier may be used to make up recombinant expression vector.A key character of expression vector is to contain replication origin, promotor, marker gene and translational control element usually.

Available method well-known to those having ordinary skill in the art makes up the dna sequence dna that contains the BioHGMP140 that encodes and the expression vector of suitable transcribing/translational control element.These methods comprise (Sambroook, et al.Molecular Cloning, a LaboratoryManual, Cold Spring Harbor Laboratory.New York, 1989) such as extracorporeal recombinant DNA technology, DNA synthetic technology, the interior recombinant technologys of body.Described dna sequence dna can effectively be connected on the suitable promotor in the expression vector, and is synthetic to instruct mRNA.The representative example of these promotors has: colibacillary lac or trp promotor; The PL promotor of lambda particles phage; Eukaryotic promoter comprises LTRs and some other known may command gene expression promoter in prokaryotic cell prokaryocyte or eukaryotic cell or its virus of CMV immediate early promoter, HSV thymidine kinase promoter, early stage and late period SV40 promotor, retrovirus.Expression vector also comprises ribosome bind site that translation initiation is used and transcription terminator etc.Inserting enhancer sequence in carrier will make its transcribing in higher eucaryotic cells be enhanced.Enhanser is the cis acting factor that DNA expresses, and nearly 10 to 300 base pairs act on promotor transcribing with enhancing gene usually.Can for example be included in the SV40 enhanser of 100 to 270 base pairs of replication origin side in late period one, at the polyoma enhanser of replication origin side in late period one and adenovirus enhanser etc.

In addition, expression vector preferably comprises one or more selected markers, to be provided for selecting the phenotypic character of transformed host cells, cultivate Tetrahydrofolate dehydrogenase, neomycin resistance and the green fluorescent protein (GFP) of usefulness as eukaryotic cell, or be used for colibacillary tsiklomitsin or amicillin resistance etc.

Persons skilled in the art all know how to select appropriate carriers/transcriptional regulatory element (as promotor, enhanser etc.) and selected marker.

Among the present invention, the polynucleotide of coding BioHGMP140 or the recombinant vectors that contains these polynucleotide can transform or transduce into host cell, contain the genetically engineered host cell of these polynucleotide or recombinant vectors with formation.Term " host cell " refers to prokaryotic cell prokaryocyte, as bacterial cell; Or eukaryotic cell such as low, as yeast cell; Or higher eucaryotic cells, as mammalian cell.The representative example of host cell has: intestinal bacteria, streptomyces; Bacterial cell such as Salmonella typhimurium; Fungal cell such as yeast; Vegetable cell; Insect cell such as fruit bat S2 or Sf9; Zooblast such as CHO, COS or Bowes melanoma cells etc.

Can carry out with routine techniques well known to those skilled in the art with dna sequence dna of the present invention or the recombinant vectors transformed host cell that contains described dna sequence dna.When the host was prokaryotic organism such as intestinal bacteria, the competent cell that can absorb DNA can be used CaCl in exponential growth after date results ₂Method is handled, and used step is well-known in this area.Also available MgCl ₂Carry out.If desired, transforming also the method for available electroporation carries out.When the host is an eukaryote, can select following DNA transfection method for use: coprecipitation of calcium phosphate method, perhaps conventional mechanical method such as microinjection, electroporation, liposome packing etc.

Recombinant DNA technology (Science, 1984 by routine; 224:1431), utilize polynucleotide sequence of the present invention to can be used to express or produce the BioHGMP140 of reorganization.In general following steps are arranged:

(1). with the polynucleotide (or varient) of coding of the present invention people BioHGMP140, or with the recombinant expression vector that contains these polynucleotide proper host cell that transforms or transduce;

(2). in suitable medium, cultivate the host cell that transforms or transduce;

(3). separation, protein purification from substratum or cell.

In step (2), according to used host cell, used substratum can be selected from various conventional substratum in the cultivation.Under the condition that is suitable for the host cell growth, cultivate.After host cell grows into suitable cell density, induce the promotor of selection with suitable method (as temperature transition or chemical induction), cell is cultivated for some time again.

In step (3), recombinant polypeptide can wrap and be expressed or be secreted into the extracellular in cell or on cytolemma.If desired, can utilize its physics, the separating by various separation methods with other characteristic and the albumen of purification of Recombinant of chemistry.These methods are well-known to those skilled in the art.These methods include, but are not limited to: conventional renaturation is handled, protein precipitant is handled (salt analysis method), centrifugal, the broken bacterium of infiltration, the combination of ultrasonication, super centrifugal, sieve chromatography (gel-filtration), adsorption chromatography, ion exchange chromatography, high performance liquid chromatography (HPLC) and other various liquid chromatography (LC) technology and these methods.

The antagonist of polypeptide of the present invention and this polypeptide, agonist and inhibitor can be directly used in disease treatment.BioHGMP140 albumen or polypeptide can as pharmacological agent membrane granulosa protein GMP-140 hypofunction or the forfeiture due to disease.The antagonist of BioHGMP140 can be used to treatment or epidemic prevention disorder, and immunologic derangement comprises but (being not limited to): glomerulonephritis, lupus erythematosus, Ge Leifushi disease, diabetes, anaemia, pulmonary emphysema, pancreatitis, Sjogren ' s syndromes, A Disenshi disease, osteoarthritis, gout, polymyositis, myasthenia gravis, hemochromatosis, hereditary allergic dermatitis, asthma, bronchitis, autoimmunization thyroiditis etc.Can directly be used as antagonist with BioHGMP140 specificity bonded antibody, or with target or pass through mechanism medicament be taken in the cell or tissue of expressing BioHGMP140 indirectly.

The antagonist of BioHGMP140 or fragment or derivative can be used to treatment or preventing inflammation reaction, and inflammation includes (but are not limited to): atopic reaction, bronchial asthma, hypersensitivity pneumonitis, adult respiratory distress syndrome, the lung eosinophilia, sarcoidosis, similar rheumatism sample sacroiliitis, osteoarthritis, cholecystitis, glomerulonephritis, osteoporosis, dermatomyositis, urticaria, atopic dermatitis, polymyositis, intestines are answered acute syndromes, atrophic gastritis, systemic lupus erythematous, myasthenia gravis, multiple sclerosis, Green-barre syndrome, intracranial granuloma, ulcerative colitis, pancreatitis, Crohn disease, myocarditis, the sample sclerosis of artery week, multiple scleroderma, and the inflammation that causes of infection and wound etc.

The antagonist of BioHGMP140 or fragment or derivative can be used to treatment or preventing cancer, and cancer includes (but are not limited to): gland cancer, leukemia, lymphoma, melanoma, sarcoma etc.; Especially relevant cancers in position such as kidney, bladder, pancreas, bone, brain, mammary gland, uterus, gall-bladder, liver, lung, Tiroidina, esophagus, testis, skin, mesentery.Can directly be used as antagonist with BioHGMP140 specificity bonded antibody, or with target or pass through mechanism medicament be taken in the cell or tissue of expressing BioHGMP140 indirectly.The antagonist of BioHGMP140 or fragment or derivative can be used to treatment or preventing cancer immunologic derangement.

The present invention also provides SCREENED COMPOUND to identify the method that improves (agonist) or check the medicament of (antagonist) BioHGMP140.Agonist improves BioHGMP140 biological function such as stimulate cellular proliferation, and antagonist prevention disorder such as the various cancer relevant with cell hyperproliferation with treatment.For example, in the presence of medicine, the BioHGMP140 with mark cultivates with mammalian cell, measures the ability that medicine improves or check the BioHGMP140 effect then, thereby identifies agonist or antagonist.

The antagonist of BioHGMP140 comprises antibody, compound, acceptor disappearance thing and the analogue etc. that filter out.The antagonist of BioHGMP140 can combine and eliminate its function with the BioHGMP140 polypeptide, or suppresses the generation of this polypeptide, or combines with the avtive spot of this polypeptide and to make this polypeptide can not bring into play biological function.

In screening during as the compound of antagonist, BioHGMP140 can be added during bioanalysis measures, by measuring compound interactional influence between BioHGMP140 and its acceptor is determined whether compound is antagonist.With the same quadrat method of above-mentioned SCREENED COMPOUND, can filter out the acceptor disappearance thing and the analogue of antagonist action.Can be incorporated into the rondom polypeptide storehouse that solid formation forms by the various amino acid that may make up by screening with BioHGMP140 bonded peptide molecule obtains.During screening, generally tackle the BioHGMP140 molecule and carry out mark.

The invention provides and use polypeptide, and fragment, derivative, analogue or their cell are as the method for antigen with production antibody.These antibody can be polyclonal antibody or monoclonal antibody.The present invention also provides the antibody at the BioHGMP140 antigenic determinant.These antibody include, but is not limited to: the fragment that polyclonal antibody, monoclonal antibody, chimeric antibody, single-chain antibody, Fab fragment and Fab expression library produce.

The method of the available BioHGMP140 direct injection of the production of polyclonal antibody immune animal (as rabbit, mouse, rat etc.) obtains.Have multiple adjuvant to can be used for enhancing immunity reaction, comprising but be not limited to freund's adjuvant etc.The technology of the monoclonal antibody of preparation BioHGMP140 includes, but is not limited to: and hybridoma technology (Kohler andMilstein.Nature, 1975,256:495-497), three knurl technology, people B-quadroma technology, EBV-hybridoma technology etc.With the variable region bonded chimeric antibody in human constant region and inhuman source can with existing technology production (Morrison et al, PNAS, 1985,81:6851).And the technology of existing manufacture order chain antibody (U.S.Pat No.496778) also can be used for producing the single-chain antibody of anti-BioHGMP140.

The antibody of anti-BioHGMP140 can be used in the immunohistochemistry technology, detects the BioHGMP140 in the biopsy specimen.With the also available labelled with radioisotope of BioHGMP140 bonded monoclonal antibody, inject in the body and can follow the tracks of its position and distribution.This radiolabeled antibody can be used as a kind of atraumatic diagnostic method and is used for the location of tumour cell and has judged whether transfer.

Antibody also can be used for designing the immunotoxin at a certain privileged sites in the body.As the monoclonal antibody of BioHGMP140 high-affinity can with bacterium or plant poison (as diphtheria toxin, ricin, abrine etc.) covalent attachment.A kind of usual method is with sulfydryl linking agent such as SPDP, attacks the amino of antibody, by the exchange of disulfide linkage, toxin is incorporated on the antibody, and this hybrid antibody can be used for killing the BioHGMP140 positive cells.

The disease that antibody among the present invention can be used for treating or prevention is relevant with BioHGMP140.The antibody that gives suitable dosage can stimulate or block generation or the activity of BioHGMP140.

The invention still further relates to the diagnostic testing process of quantitative and detection and localization BioHGMP140 level.These tests are known in the art, and comprise that FISH measures and radioimmunoassay.The BioHGMP140 level that is detected in the test can be with laying down a definition the importance of BioHGMP140 in various diseases and be used to the disease of diagnosing BioHGMP140 to work.

Polypeptide of the present invention also can be used as the peptide spectrum analysis.For example, the polypeptide available physical, chemistry or enzyme carry out the specificity cutting, and carries out the two-dimentional or three-dimensional gel electrophoresis analysis of one dimension, be more preferably and carry out mass spectroscopy.

The polynucleotide of coding BioHGMP140 also can be used for multiple therapeutic purpose.Gene therapy technology can be used for treating because cell proliferation, growth or the metabolic disturbance due to the nothing expression of BioHGMP140 or the unusual/non-activity expression.The gene therapy vector (as virus vector) of reorganization can be designed for the BioHGMP140 that expresses variation, to suppress endogenic BioHGMP140 activity.For example, a kind of BioHGMP140 of variation can be the BioHGMP140 that shortens, lacked signal conduction function territory, though can combine with the substrate in downstream, lacks signaling activity.Therefore the gene therapy vector of reorganization can be used for treating the disease of BioHGMP140 expression or active caused by abnormal.Deriving from viral expression vector such as retrovirus, adenovirus, adeno-associated virus (AAV), hsv, parvovirus etc. can be used for the polynucleotide of coding BioHGMP140 are transferred in the cell.The method of recombinant viral vector that structure carries the polynucleotide of coding BioHGMP140 be found in existing document (Sambrook, etal.).The polynucleotide of reorganization coding BioHGMP140 can be packaged in the liposome and then be transferred in the cell in addition.

Polynucleotide import tissue or intracellular method comprises: directly be injected into polynucleotide in the in-vivo tissue; Or external by carrier (as virus, phage or plasmid etc.) earlier with the polynucleotide transfered cell in, again cell is transplanted in the body etc.

Suppress the oligonucleotide (comprising sense-rna and DNA) of BioHGMP140 mRNA and ribozyme also within the scope of the invention.Ribozyme is the enzyme sample RNA molecule that a kind of energy specificity is decomposed specific RNA, and its mechanism of action is to carry out the endonuclease effect after ribozyme molecule and the hybridization of complementary target RNA-specific.The RNA of antisense and DNA and ribozyme can obtain with existing any RNA or DNA synthetic technology, as the technology widespread use of solid phase phosphoamide chemical synthesis synthetic oligonucleotide.Antisense rna molecule can be transcribed acquisition by the dna sequence dna of this RNA that encodes in external or body.This dna sequence dna has been incorporated into the downstream of rna polymerase promoter of carrier.In order to increase the stability of nucleic acid molecule, available several different methods is modified it, and as increasing the sequence length of both sides, the connection between the ribonucleoside is used phosphoric acid thioester bond or peptide bond but not phosphodiester bond.

The polynucleotide of coding BioHGMP140 can be used for diagnosing the disease relevant with BioHGMP140.The unconventionality expression of the expression that the polynucleotide of coding BioHGMP140 can be used for detecting BioHGMP140 BioHGMP140 whether or under morbid state.As the dna sequence dna of the BioHGMP140 that encodes can be used for biopsy specimen is hybridized to judge the expression situation of BioHGMP140.Hybridization technique comprises the Southern blotting, Northern blotting, in situ hybridization etc.These technological methods all are disclosed mature technologies, and relevant test kit all can obtain from commercial channels.Part or all of polynucleotide of the present invention can be used as probe stationary on microarray (microarray) or DNA chip (being called " gene chip " again), is used for analyzing the differential expression analysis and the gene diagnosis of tissue gene.Carry out the transcription product that RNA-polymerase chain reaction (RT-PCR) amplification in vitro also can detect BioHGMP140 with the special primer of BioHGMP140.

The sudden change that detects the BioHGMP140 gene also can be used for the disease of diagnosing BioHGMP140 relevant.The form of BioHGMP140 sudden change comprises that the point mutation compared with normal wild type BioHGMP140 dna sequence dna, transposition, disappearance, reorganization and other are any unusual etc.Available existing technology such as Southern blotting, dna sequence analysis, PCR and in situ hybridization detect sudden change.In addition, sudden change might influence proteic expression, therefore can judge indirectly that with Northern blotting, Western blotting gene has or not sudden change.

Sequence of the present invention identifies it also is valuable to karyomit(e).This sequence can be specifically at certain bar human chromosome particular location and and can with its hybridization.At present, need to identify the concrete site of each gene on the karyomit(e).Yet, have only chromosomal marker thing seldom to can be used for the marker chromosomes position now based on actual sequence data (repetition polymorphism).According to the present invention, for these sequences are associated with disease related gene, its important the first step is positioned these dna sequence dnas on the karyomit(e) exactly.

In brief, prepare PCR primer (preferred 15-35bp), sequence can be positioned on the karyomit(e) according to cDNA.Then, these primers are used for the somatocyte hybrid cell that the PCR screening contains each bar human chromosome.Have only those hybrid cells that contain corresponding to the people's gene of primer can produce the fragment of amplification.

The PCR localization method of somatocyte hybrid cell is that DNA is navigated to concrete chromosomal quick method.Use Oligonucleolide primers of the present invention,, can utilize one group to realize inferior location from specific chromosomal fragment or a large amount of genomic clone by similar approach.Other the similar strategy that can be used for chromosomal localization comprises in situ hybridization, uses the karyomit(e) prescreen and the hybridization preliminary election of the airflow classification of mark, thereby makes up the special cDNA storehouse of karyomit(e).

The cDNA clone is carried out fluorescence in situ hybridization (FISH) with Metaphase Chromosome, can in a step, accurately carry out chromosomal localization.The summary of this technology is referring to Verma etc., Human Chromosomes:a Manualof Basic Techniques, Pergamon Press, New York (1988).

In case sequence is positioned to chromosome position accurately, the physical location of this sequence on karyomit(e) just can be associated with the gene map data.These data for example are found in, V.Mckusick, MendelianInheritance in Man (can by with the online acquisition of Johns Hopkins University Welch MedicalLibrary).Can pass through linkage analysis then, determine gene and navigated to relation between the disease on the chromosomal region already.

Then, measure ill and not cDNA between diseased individuals or genome sequence difference.If observe certain sudden change in some or all of diseased individuals, and this sudden change is not observed in any normal individual, then this sudden change may be the cause of disease of disease.More ill and diseased individuals not is usually directed at first seek the variation of structure in the karyomit(e), as from the horizontal visible of karyomit(e) or use based on detectable disappearance of the PCR of cDNA sequence or transposition.Resolving power according to present physical mapping and assignment of genes gene mapping technology, being accurately positioned to the cDNA of the chromosomal region relevant with disease, can be a kind of (the supposing that 1 megabasse mapping resolving power and every 20kb are corresponding to a gene) between 50 to 500 potential Disease-causing genes.

Polypeptide of the present invention, polynucleotide and stand-in thereof, agonist, antagonist and inhibitor and suitable pharmaceutical carrier (pharmaceutically acceptable carrier) combination back can be used.These carriers can be water, glucose, ethanol, salt, damping fluid, glycerine and their combination.Composition comprises the polypeptide of the present invention or the antagonist of safe and effective amount and carrier and the vehicle that does not influence effect of drugs.These compositions can be used as medicine and are used for disease treatment.

The present invention also provides medicine box or the test kit that contains one or more containers, and one or more medicinal compositions compositions of the present invention are housed in the container.With these containers, can have by the given indicative prompting of government authorities of making, using or selling medicine or biological products, the government authorities that this prompting reflects production, uses or sells permits it to use on human body.In addition, polypeptide of the present invention can be used in combination with other treatment compound.

Pharmaceutical composition can be with mode administration easily, as by in part, intravenously, intraperitoneal, intramuscular, subcutaneous, the nose or the route of administration of intracutaneous etc.BioHGMP140 with treatment effectively and or/amount of the concrete indication of prevention comes administration.The amount and the dosage range that are applied to patient's BioHGMP140 will depend on many factors, as administering mode, person's to be treated healthiness condition and diagnostician's judgement.

In an example of the present invention, a kind of isolating polynucleotide are provided, its coding has the mature polypeptide of aminoacid sequence shown in the SEQ ID NO:2.These polynucleotide are to find from the cDNA library of people's fetal brain tissue, and the polynucleotide sequence total length is 1880 bases, its open reading frame (15-1526) 503 amino acid of having encoded.Find relatively that according to amino acid sequence homologous the membrane granulosa protein GMP-140 of this polypeptide and Mus musculus has 30% homology, infer that thus the new people BioHGMP140 of the present invention has the similar 26S Proteasome Structure and Function of membrane granulosa protein GMP-140 gene family.

The cDNA of people BioHGMP140 provided by the present invention, oligonucleotide, polypeptide and antibody etc. have important value for diseases related, screening inhibitor or these diseases of pharmacological agent of the effect of membrane granulosa protein GMP-140 in research different tissues and the cell, diagnosis membrane granulosa protein GMP-140 imbalance.

In addition, because people BioHGMP140 albumen of the present invention has the natural acid sequence that is derived from the people, therefore, compare with the albumen of the same clan that derives from other species, estimate to have higher active and/or lower side effect (for example in the intravital immunogenicity of people lower or do not have) being applied to man-hour.

Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to people such as normal condition such as Sambrook, molecular cloning: laboratory manual (New York:ColdSpring Harbor Laboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.

The clone of embodiment 1:BioHGMP140 cDNA

Extract the total RNA of people's tire brain with guanidinium isothiocyanate/phenol/chloroform single stage method.From total RNA, separate poly (A) mRNA with Quick mRNA separating kit (Qiegene company product).2ug poly (A) mRNA forms cDNA through reverse transcription.CDNA fragment orientation is inserted on the multiple clone site of pBSK (+) carrier (Clontech company product) with Smart cDNA clone's test kit (available from Clontech), transforms DH5 α bacterium and form the cDNA library.Measure the sequence of all clones' 5 ' and 3 ' end with dyestuff termination circulating reaction sequencing kit (Perkin-Elmer company product) and ABI 377 automatic sequencings views (Perkin-Elmer company).CDNA sequence and the existing public dna sequence data storehouse (Genbank) measured are compared, and the cDNA sequence that found that one of them clone (0968d01) is new DNA.By synthetic a series of primers the contained insertion cDNA fragment of this clone is carried out two-way mensuration.The result shows, the contained full-length cDNA of 0968d01 clone is 1880bp (shown in SEQ ID NO:1), from 15bp to 1526bp the open reading frame (ORF) of a 1512bp, the new protein (shown in SEQ ID NO:2) of encoding arranged.This clone is named as pBS-0968d01, its encoded protein matter called after NOVEL HUMAN GRANULE MEMBRANE PROTEIN 140 (abbreviating " BioHGMP140 " as).

Embodiment 2:cDNA clone's homology retrieval

With the nucleotide sequence and the encoded protein sequence thereof of people BioHGMP140 gene of the present invention, with Blast program (Basic local Alignment search tool) [Altschul, SF et al.J.Mol.Biol.1990; 215:403-10], carry out the homology retrieval at databases such as Genbank, Swissport.The gene the highest with people BioHGMP140 dna homolog of the present invention is the gene of the membrane granulosa protein GMP-140 of a kind of known Mus musculus, and its encoded protein number is M72332 in the access of Genbank.The protein homology comparative result is shown in Fig. 1, both height homologies, and its homogeny is 30%; Similarity is 45%.This shows that novel polypeptide of the present invention has the 26S Proteasome Structure and Function of membrane granulosa protein GMP-140.

Embodiment 3: with RT-PCR method clone BioHGMP140 gene

Total RNA is a template with fetus brain cell, is that primer carries out the synthetic cDNA of reverse transcription reaction with oligo-dT, with behind the test kit purifying of Qiagene, carries out pcr amplification with following primer:

Primer 1:5 '-GTGGTTCTCTTCCAATGATA-3 ' (SEQ ID NO.3)

Primer 2: 5 '-AGCAAAATATACTTTAATGG-3 ' (SEQ ID NO.4)

Primer 1 is corresponding to the forward sequence that begins of 1bp of the 5 ' end of SEQ ID NO:1; Primer 2 is corresponding to the end of 3 ' among SEQID NO:1 reverse sequence.

The condition of amplified reaction: in the reaction volume of 50 μ l, contain 50mmol/L KCl, 10mmol/L Tris-Cl, (pH8.5), 1.5mmol/L MgCl ₂, 200 μ mol/L dNTP, 10pmol primer, the Taq archaeal dna polymerase of 1U (Clontech company product).Go up by 25 cycles of following conditioned response at PE9600 type DNA thermal cycler (Perkin-Elmer company): 94 ℃ of 30sec; 55 ℃, 30sec; 72 ℃ of 2min.When RT-PCR, establish the blank negative contrast of positive contrast of beta-actin and template simultaneously.Amplified production is connected to (Invitrogen company product) on the pCR carrier with the test kit purifying of QIAGEN company with TA clone test kit.Dna sequence analysis is the result show, the 1-1880bp shown in the dna sequence dna of PCR product and the SEQ ID NO:1 is identical.

Embodiment 4:Northern blotting is analyzed the BioHGMP140 expression of gene:

Extract total RNA[Ahal.Biochem 1987,162,156-159 with single stage method].This method comprises acid guanidine thiocyanate phenol-chloroform extracting.Promptly use 4M guanidinium isothiocyanate-25mM Trisodium Citrate, 0.2M sodium acetate (pH4.0) carries out homogenate to tissue, adds the phenol of 1 times of volume and the chloroform-primary isoamyl alcohol (49: 1) of 1/5 volume, and is centrifugal after mixing.The sucking-off aqueous phase layer adds Virahol (0.8 volume) and with the centrifugal RNA precipitation that obtains of mixture.With RNA precipitation 70% washing with alcohol that obtains, dry and soluble in water.

With 20 μ g RNA, on 1.2% sepharose that contains 20mM 3-(N-morpholino) propanesulfonic acid (pH7.0)-5mM sodium acetate-1mM EDTA-2.2M formaldehyde, carry out electrophoresis.Be transferred on the nitrocellulose filter then.With α- ³²PdATP prepares by random priming ³²The dna probe of P-mark.Used dna probe is the BioHGMP140 coding region sequence (15bp to 1526bp) of the pcr amplification shown in the SEQ 1.Will ³²The probe of P-mark (about 2 * 10 ⁶Cpm/ml) spend the night in 42 ℃ of hybridization in solution with the nitrocellulose filter that has shifted RNA, this solution comprises 50% methane amide-25mMKH ₂PO ₄(pH7.4)-5 * SSC-5 * Denhardt ' s solution and 200 μ g/ml salmon sperm DNAs.After the hybridization, filter membrane is washed 30min in 55 ℃ in 1 * SSC-0.1%SDS.Then, analyze with quantitative with Phosphor Imager.

Embodiment 5: vivoexpression, separation and the purifying of reorganization BioHGMP140

According to the coding region sequence (15-1526 position) of SEQ ID NO:1, design a pair of specificity amplification primer, sequence is as follows:

Primer 3:5 '-CCCGAATTCATGATACCAAATGCGTTCAT-3 ' (SEQ ID No 5)

Primer 4:5 '-CCCGCGGCCGCTTAAAACCCAGTCCTAATTT-3 ' (SEQ ID No 6)

5 ' end of these two sections primers contains EcoRI and NcoI restriction enzyme site respectively, be respectively the encoding sequence of target gene 5 ' end and 3 ' end thereafter, EcoRI and NcoI restriction enzyme site are corresponding to expression vector plasmid pET-28b (+) (Novagen company product, Cat.No.69865.3) the selectivity restriction enzyme site on.With the pBS-0968d01 plasmid that contains the total length goal gene is template, carries out the PCR reaction.The PCR reaction conditions is: contain pBS-0968d01 plasmid 10pg, primer 3 and primer 4 among the cumulative volume 50 μ l and be respectively 10pmmol, Advantagepolymerase Mix (Clontech company product) 1 μ l.Loop parameter: 94 ℃ of 20s, 60 ℃ of 30s, 68 ℃ of 2min, totally 25 circulations.Respectively amplified production and plasmid pET-28 (+) are carried out double digestion with EcoRI and NcoI, reclaim big fragment respectively, and connect with the T4 ligase enzyme.Connect product and transform, after the dull and stereotyped overnight incubation of the LB that contains kantlex (final concentration 30 μ g/ml), use the colony polymerase chain reaction (PCR) method screening positive clone, and check order with the big enterobacterial DH5 of Calcium Chloride Method α.Select the correct positive colony of sequence (pET-0968d01) with Calcium Chloride Method with recombinant plasmid transformed e. coli bl21 (DE3) plySs (Novagen company product).In the LB liquid nutrient medium that contains kantlex (final concentration 30 μ g/ml), host bacterium BL21 (pET-0968d01) is cultured to logarithmic phase at 37 ℃, adds IPTG to final concentration 1mmol/L, continues to cultivate 5 hours.Centrifugal collection thalline, through the broken bacterium of ultrasonic wave, centrifugal collection supernatant with carrying out chromatography with 6 Histidines (6His-Tag) bonded affinity column His.Bind QuickCartridge (Novagen company product), has obtained the target protein BioHGMP140 of purifying.Through the SDS-PAGE electrophoresis, obtain a single band at the 55kDa place.This band is transferred on the pvdf membrane carries out the n terminal amino acid sequential analysis with the Edams hydrolysis method, 15 amino acid of N-end hold 15 amino-acid residues identical with the N-shown in the SEQ ID NO:2 as a result.

Embodiment 6: anti-BioHGMP140 production of antibodies

With the synthetic specific polypeptide of following BioHGMP140: the Met-Ile-Pro-Asn-Ala-Phe-Ile-Ser-Glu-Thr-Ser-Ser-Trp-Lys-Glu (SEQ ID NO:7) of Peptide synthesizer (PE company product).This polypeptide formed mixture with the coupling of hemocyanin and bovine serum albumin respectively, and method is referring to Avrameas, etal.Immunochemistry, 1969; 6:43.Add the complete Freund's adjuvant immunizing rabbit with the above-mentioned hemocyanin polypeptide complex of 4mg, add the incomplete Freund's adjuvant booster immunization once with the hemocyanin polypeptide complex again after 15 days.Employing is done the titre that ELISA measures antibody in the rabbit anteserum through the titer plate of 15 μ g/ml bovine serum albumin polypeptide complex bag quilts.From the rabbit anteserum of antibody positive, separate total IgG with albumin A-Sepharose.Polypeptide is incorporated on the Sepharose 4B post of cyanogen bromide-activated, from total IgG, separates anti-peptide antibody with affinity chromatography.Immuno-precipitation proof antibody purified can combine with BioHGMP140 specifically.

All quote in this application as a reference at all documents that the present invention mentions, just quoted as a reference separately as each piece document.Should be understood that in addition those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims institute restricted portion equally.

Sequence table

(1) general information:

(ⅰ) denomination of invention: new human membrane granulosa protein and encoding sequence thereof

(ⅱ) sequence number: 7

(2) information of SEQ ID NO:1:

(ⅰ) sequence signature:

(A) length: 1880bp

(B) type: nucleic acid

(C) chain: two strands

(D) topological framework: linearity

(ⅱ) molecule type: cDNA

( ⅲ ) ：SEQ ID NO：1：GTGGTTCTCT TCCAATGATA CCAAATGCGT TCATCAGTGA GACCAGCTCT TGGAAGGAAA 60ATGTGATAAC TTACAGCTGC AGGTCTGGAT ATGTCATACA AGGCAGTTCA GATCTGATTT 120GTACAGAGAA AGGGGTATGG AGCCAGCCTT ATCCAGTCTG TGAGCCCTTG TCCTGTGGGT 180CCCCACCGTC TGTCGCCAAT GCAGTGGCAA CTGGAGAGGC ACACACCTAT GAAAGTGAAG 240TGAAACTCAG ATGTCTGGAA GGTTATACGA TGGATACAGA TACAGATACA TTCACCTGTC 300AGAAAGATGG TCGCTGGTTC CCTGAGAGAA TCTCCTGCAG TCCTAAAAAA TGTCCTCTCC 360CGGAAAACAT AACACATATA CTTGTACATG GGGACGATTT CAGTGTGAAT AGGCAAGTTT 420CTGTGTCATG TGCAGAAGGG TATACCTTTG AGGGAGTTAA CATATCAGTA TGTCAGCTTG 480ATGGAACCTG GGAGCCACCA TTCTCCGATG AATCTTGCAG TCCAGTTTCT TGTGGGAAAC 540CTGAAAGTCC AGAACATGGA TTTGTGGTTG GCAGTAAATA CACCTTTGAA AGCACAATTA 600TTTATCAGTG TGAGCCTGGC TATGAACTAG AGGGGAACAG GGAACGTGTC TGCCAGGAGA 660ACAGACAGTG GAGTGGAGGG GTGGCAATAT GCAAAGAGAC CAGGTGTGAA ACTCCACTTG 720AATTTCTCAA TGGGAAAGCT GACATTGAAA ACAGGACGAC TGGACCCAAC GTGGTATATT 780CCTGCAACAG AGGCTACAGT CTTGAAGGGC CATCTGAGGC ACACTGCACA GAAAATGGAA 840CCTGGAGCCA CCCAGTCCCT CTCTGCAAAC CAAATCCATG CCCTGTTCCT TTTGTGATTC 900CCGAGAATGC TCTGCTGTCT GAAAAGGAGT TTTATGTTGA TCAGAATGTG TCCATCAAAT 960GTAGGGAAGG TTTTCTGCTG CAGGGCCACG GCATCATTAC CTGCAACCCC GACGAGACGT 1020GGACACAGAC AAGCGCCAAA TGTGAAAAAA TCTCATGTGG TCCACCAGCT CACGTAGAAA 1080ATGCAATTGC TCGAGGCGTA CATTATCAAT ATGGAGACAT GATCACCTAC TCATGTTACA 1140GTGGATACAT GTTGGAGGGT TTCCTGAGGA GTGTTTGTTT AGAAAATGGA ACATGGACAT 1200CACCTCCTAT TTGCAGAGCT GTCTGTCGAT TTCCATGTCA GAATGGGGGC ATCTGCCAAC 1260GCCCAAATGC TTGTTCCTGT CCAGAGGGCT GGATGGGGCG CCTCTGTGAA GAACCAATCT 1320GCATTCTTCC CTGTCTGAAC GGAGGTCGCT GTGTGGCCCC TTACCAGTGT GACTGCCCGC 1380CTGGCTGGAC GGGGTCTCGC TGTCATACAG CTGTTTGCCA GTCTCCCTGC TTAAATGGTG 1440GAAAATGTGT AAGACCAAAC CGATGTCACT GTCTTTCTTC TTGGACGGGA CATAACTGTT 1500CCAGGAAAAG GAGGACTGGG TTTTAACCAC TGCACGACCA TCTGGCTCTC CCAAAAGCAG 1560GATCATCTCT CCTCGGTAGT GCCTGGGCAT CCTGGAACTT ATGCAAAGAA AGTCCAACAT 1620GGTGCTGGGT CTTGTTTAGT AAACTTGTTA CTTGGGGTTA CTTTTTTTAT TTTGTGATAT 1680ATTTTGTTAT TCCTTGTGAC ATACTTTCTT ACATGTTTCC ATTTTTAAAT ATGCCTGTAT 1740TTTCTATAT AAAAATTATAT TAAATAGATG CTGCTCTACC CTCACAAAAT GTACATATTC 1800TGCTGTCTAT TGGGAAAGTT CCTGGTACAC ATTTTTATTC AGTTACTTAA AATGATTTTT 1860CCATTAAAGT ATATTTTGCT 1880

(2) information of SEQ ID NO:2:

(ⅰ) sequence signature:

(A) length: 503 amino acid

(B) type: amino acid

(D) topological framework: linearity

(ⅱ) molecule type: polypeptide

( ⅲ ) ：SEQ ID NO：2：Met Ile Pro Asn Ala Phe Ile Ser Glu Thr Ser Ser Trp Lys Glu 15Asn Val Ile Thr Tyr Ser Cys Arg Ser Gly Tyr Val Ile Gln Gly 30Ser Ser Asp Leu Ile Cys Thr Glu Lys Gly Val Trp Ser Gln Pro 45Tyr Pro Val Cys Glu Pro Leu Ser Cys Gly Ser Pro Pro Ser Val 60Ala Asn Ala Val Ala Thr Gly Glu Ala His Thr Tyr Glu Ser Glu 75Val Lys Leu Arg Cys Leu Glu Gly Tyr Thr Met Asp Thr Asp Thr 90Asp Thr Phe Thr Cys Gln Lys Asp Gly Arg Trp Phe Pro Glu Arg 105Ile Ser Cys Ser Pro Lys Lys Cys Pro Leu Pro Glu Asn Ile Thr 120His Ile Leu Val His Gly Asp Asp Phe Ser Val Asn Arg Gln Val 135Ser Val Ser Cys Ala Glu Gly Tyr Thr Phe Glu Gly Val Asn Ile 150Ser Val Cys Gln Leu Asp Gly Thr Trp Glu Pro Pro Phe Ser Asp 165Glu Ser Cys Ser Pro Val Ser Cys Gly Lys Pro Glu Ser Pro Glu 180His Gly Phe Val Val Gly Ser Lys Tyr Thr Phe Glu Ser Thr Ile 195Ile Tyr Gln Cys Glu Pro Gly Tyr Glu Leu Glu Gly Asn Arg Glu 210Arg Val Cys Gln Glu Asn Arg Gln Trp Ser Gly Gly Val Ala Ile 225Cys Lys Glu Thr Arg Cys Glu Thr Pro Leu Glu Phe Leu Asn Gly 240Lys Ala Asp Ile Glu Asn Arg Thr Thr Gly Pro Asn Val Val Tyr 255Ser Cys Asn Arg Gly Tyr Ser Leu Glu Gly Pro Ser Glu Ala His 270Cys Thr Glu Asn Gly Thr Trp Ser His Pro Val Pro Leu Cys Lys 285Pro Asn Pro Cys Pro Val Pro Phe Val Ile Pro Glu Asn Ala Leu 300Leu Ser Glu Lys Glu Phe Tyr Val Asp Gln Asn Val Ser Ile Lys 315Cys Arg Glu Gly Phe Leu Leu Gln Gly His Gly Ile Ile Thr Cys 330Asn Pro Asp Glu Thr Trp Thr Gln Thr Ser Ala Lys Cys Glu Lys 345Ile Ser Cys Gly Pro Pro Ala His Val Glu Asn Ala Ile Ala Arg 360Gly Val His Tyr Gln Tyr Gly Asp Met Ile Thr Tyr Ser Cys Tyr 375Ser Gly Tyr Met Leu Glu Gly Phe Leu Arg Ser Val Cys Leu Glu 390Asn Gly Thr Trp Thr Ser Pro Pro Ile Cys Arg Ala Val Cys Arg 405Phe Pro Cys Gln Asn Gly Gly Ile Cys Gln Arg Pro Asn Ala Cys 420Ser Cys Pro Glu Gly Trp Met Gly Arg Leu Cys Glu Glu Pro Ile 435Cys Ile Leu Pro Cys Leu Asn Gly Gly Arg Cys Val Ala Pro Tyr 450Gln Cys Asp Cys Pro Pro Gly Trp Thr Gly Ser Arg Cys His Thr 465Ala Val Cys Gln Ser Pro Cys Leu Asn Gly Gly Lys Cys Val Arg 480Pro Asn Arg Cys His Cys Leu Ser Ser Trp Thr Gly His Asn Cys 495Ser Arg Lys Arg Arg Thr Gly Phe 503

(2) information of SEQ ID NO:3

(ⅰ) sequence signature

(A) length: 20 bases

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ⅱ) molecule type: oligonucleotide

(ⅲ) sequence description: SEQ ID NO:3:GTGGTTCTCTTCCAATGATA 20

(2) information of SEQ ID NO:4

(ⅰ) sequence signature

(A) length: 20 bases

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ⅱ) molecule type: oligonucleotide

(ⅲ) sequence description: SEQ ID NO:4:AGCAAAATATACTTTAATGG 20

(2) information of SEQ ID NO:5

(ⅰ) sequence signature

(A) length: 29 bases

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ⅱ) molecule type: oligonucleotide

(ⅲ) sequence description: SEQ ID NO:5:CCCGAATTCATGATACCAAATGCGTTCAT 29

(2) information of SEQ ID NO:6

(ⅰ) sequence signature

(A) length: 31 bases

(B) type: nucleic acid

(C) chain: strand

(D) topological framework: linearity

(ⅱ) molecule type: oligonucleotide

(ⅲ) sequence description: SEQ ID NO:6:CCCGCGGCCGCTTAAAACCCAGTCCTAATTT 31

(2) information of SEQ ID NO:7:

(ⅰ) sequence signature:

(A) length: 15 amino acid

(B) type: amino acid

(D) topological framework: linearity

(ⅱ) molecule type: polypeptide

(ⅲ) sequence description: SEQ ID NO:7:Met Ile Pro Asn Ala Phe Ile Ser Glu Thr Ser Ser Trp Lys Glu 15

Claims (18)

1, a kind of isolating people BioHGMP140 polypeptide is characterized in that it comprises: have the polypeptide of the aminoacid sequence shown in the SEQ ID NO.2 or fragment, analogue or the derivative of its polypeptide.

2, polypeptide as claimed in claim 1 is characterized in that, it is that polypeptide or its amino acid variation with the aminoacid sequence shown in the SEQ ID NO.2 are no more than 5% derivative.

3, polypeptide as claimed in claim 2 is characterized in that, it is the polypeptide with the aminoacid sequence shown in the SEQ ID NO.2.

4, a kind of isolating polynucleotide is characterized in that, described polynucleotide are to be selected from down group:

(a) coding has the polynucleotide of the polypeptide of aminoacid sequence shown in the SEQ ID NO.2 or its fragment, analogue, derivative;

(b) with polynucleotide (a) complementary polynucleotide;

(c) with (a) or the polynucleotide of at least 70% homogeny (b) are arranged.

5, polynucleotide as claimed in claim 4 is characterized in that, described polynucleotide are polynucleotide that coding has aminoacid sequence shown in the SEQID NO.2.

6, polynucleotide as claimed in claim 4 is characterized in that, the sequence of described polynucleotide is the sequences that have the sequence of 15-1526 position among the SEQ ID NO.1 or have 1-1880 position among the SEQ ID NO.1.

7, a kind of recombinant vectors that contains exogenous polynucleotide is characterized in that, it is the recombinant vectors that is formed by the described polynucleotide of claim 4 and plasmid, virus or expression vector establishment.

8, a kind of genetically engineered host cell that contains exogenous polynucleotide is characterized in that, it is to be selected from following a kind of host cell:

(a) host cell that transforms or transduce with the described recombinant vectors of claim 7;

(b) host cell that transforms or transduce with the described polynucleotide of claim 4.

9, a kind of preparation method with the active polypeptide of BioHGMP140 is characterized in that, described method comprises:

(a) being fit to express under the BioHGMP140 condition, cultivate the described through engineering approaches host cell of claim 8;

(b) from culture, isolate and have the active polypeptide of BioHGMP140.

10, a kind of can with polypeptide bonded antibody, it is characterized in that, described antibody be can with BioHGMP140 specificity bonded antibody.

11, the compound of an analoglike or adjusting polypeptide active or expression, it is characterized in that it is the active compound of simulation BioHGMP140, or promote the active compound of BioHGMP140, or the active compound of antagonism BioHGMP140, or the active compound of inhibition BioHGMP140.

12, compound as claimed in claim 11 is characterized in that, it is the polynucleotide sequence shown in the SEQ ID NO.1 or its segmental antisense sequences.

13, the described application of compound of a kind of claim 11 is characterized in that, described compound be used to regulate BioHGMP140 in vivo, the method for external activity.

14, a kind of disease relevant with the described BioHGMP140 polypeptide of claim 1 or method of disease susceptibility of detecting is characterized in that, is to detect the relevant disease or the susceptibility of disease by the method that is selected from down group:

Whether (a) detect described expression of polypeptides amount indirectly or directly unusual;

Whether (b) detect described polypeptide active indirectly or directly unusual;

(c) directly or indirectly detect and cause described expression of polypeptides amount or active unusual nucleotide diversity in the polynucleotide.

15, the application of polypeptide according to claim 1 is characterized in that, it is applied to screen stand-in, agonist, antagonist or the inhibitor of BioHGMP140; Perhaps be used for the peptide finger print identification.

16, the application of nucleic acid molecule as claimed in claim 4 is characterized in that, it is used for nucleic acid amplification reaction as primer, perhaps is used for hybridization as probe, perhaps is used to make gene chip or microarray.

17, a kind of pharmaceutical composition is characterized in that, it contains the described polypeptide of claim 1 and/or the described polynucleotide of claim 4 and the pharmaceutically acceptable carrier of safe and effective amount.

18, the application of polypeptide as claimed in claim 1 is characterized in that, is used to regulate and treat the medicine of inflammatory reaction, immunologic derangement and Cancerous disease with described polypeptide preparation.