CN117143870A - Application of bowl gene in limb regeneration and pest control - Google Patents
Application of bowl gene in limb regeneration and pest control Download PDFInfo
- Publication number
- CN117143870A CN117143870A CN202310757592.0A CN202310757592A CN117143870A CN 117143870 A CN117143870 A CN 117143870A CN 202310757592 A CN202310757592 A CN 202310757592A CN 117143870 A CN117143870 A CN 117143870A
- Authority
- CN
- China
- Prior art keywords
- blattaria
- bowl
- dsrna
- gene
- insect
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
- 101150039201 bowl gene Proteins 0.000 title claims abstract description 30
- 230000008929 regeneration Effects 0.000 title abstract description 33
- 238000011069 regeneration method Methods 0.000 title abstract description 33
- 241000607479 Yersinia pestis Species 0.000 title abstract description 4
- 241001674044 Blattodea Species 0.000 claims abstract description 46
- 239000012620 biological material Substances 0.000 claims abstract description 16
- 238000000034 method Methods 0.000 claims abstract description 14
- 230000000694 effects Effects 0.000 claims abstract description 13
- 230000037314 wound repair Effects 0.000 claims abstract description 12
- 230000002401 inhibitory effect Effects 0.000 claims abstract description 10
- 239000002773 nucleotide Substances 0.000 claims abstract description 9
- 125000003729 nucleotide group Chemical group 0.000 claims abstract description 9
- 230000002441 reversible effect Effects 0.000 claims abstract description 8
- 230000000295 complement effect Effects 0.000 claims abstract description 3
- 108091032973 (ribonucleotides)n+m Proteins 0.000 claims description 42
- 102000040650 (ribonucleotides)n+m Human genes 0.000 claims description 37
- 241000238675 Periplaneta americana Species 0.000 claims description 35
- 230000014509 gene expression Effects 0.000 claims description 19
- 241000238631 Hexapoda Species 0.000 claims description 14
- 239000003795 chemical substances by application Substances 0.000 claims description 9
- 230000009261 transgenic effect Effects 0.000 claims description 9
- 102000039446 nucleic acids Human genes 0.000 claims description 8
- 108020004707 nucleic acids Proteins 0.000 claims description 8
- 150000007523 nucleic acids Chemical class 0.000 claims description 8
- 230000017423 tissue regeneration Effects 0.000 claims description 7
- 239000003153 chemical reaction reagent Substances 0.000 claims description 6
- 238000002347 injection Methods 0.000 claims description 6
- 239000007924 injection Substances 0.000 claims description 6
- 241000238659 Blatta Species 0.000 claims description 4
- 241000238657 Blattella germanica Species 0.000 claims description 4
- 241000238661 Periplaneta Species 0.000 claims description 4
- 241000048273 Periplaneta japonica Species 0.000 claims description 4
- 230000037213 diet Effects 0.000 claims description 4
- 235000005911 diet Nutrition 0.000 claims description 4
- 239000000126 substance Substances 0.000 claims description 4
- 230000033228 biological regulation Effects 0.000 claims description 2
- 230000030279 gene silencing Effects 0.000 claims description 2
- 238000002360 preparation method Methods 0.000 claims description 2
- 238000005507 spraying Methods 0.000 claims description 2
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 claims description 2
- 238000002266 amputation Methods 0.000 abstract description 6
- 230000008569 process Effects 0.000 abstract description 5
- 238000005516 engineering process Methods 0.000 abstract description 4
- 238000010353 genetic engineering Methods 0.000 abstract description 2
- 230000035899 viability Effects 0.000 abstract description 2
- 108091030071 RNAI Proteins 0.000 abstract 1
- 230000009368 gene silencing by RNA Effects 0.000 abstract 1
- 229920002477 rna polymer Polymers 0.000 abstract 1
- 108090000623 proteins and genes Proteins 0.000 description 9
- 108091023040 Transcription factor Proteins 0.000 description 6
- 102000040945 Transcription factor Human genes 0.000 description 6
- 230000001276 controlling effect Effects 0.000 description 5
- 238000011160 research Methods 0.000 description 5
- 230000008685 targeting Effects 0.000 description 5
- 239000000463 material Substances 0.000 description 4
- 241001465754 Metazoa Species 0.000 description 3
- 239000002299 complementary DNA Substances 0.000 description 3
- 238000011161 development Methods 0.000 description 3
- 230000018109 developmental process Effects 0.000 description 3
- 238000010586 diagram Methods 0.000 description 3
- 230000002829 reductive effect Effects 0.000 description 3
- 108020004414 DNA Proteins 0.000 description 2
- 102100034343 Integrase Human genes 0.000 description 2
- 108010092799 RNA-directed DNA polymerase Proteins 0.000 description 2
- 238000011529 RT qPCR Methods 0.000 description 2
- 241000251539 Vertebrata <Metazoa> Species 0.000 description 2
- 230000002159 abnormal effect Effects 0.000 description 2
- 238000002474 experimental method Methods 0.000 description 2
- 238000000605 extraction Methods 0.000 description 2
- 230000035772 mutation Effects 0.000 description 2
- 210000000056 organ Anatomy 0.000 description 2
- 230000002265 prevention Effects 0.000 description 2
- 230000001105 regulatory effect Effects 0.000 description 2
- 230000004083 survival effect Effects 0.000 description 2
- 238000011144 upstream manufacturing Methods 0.000 description 2
- 206010002091 Anaesthesia Diseases 0.000 description 1
- 108020004635 Complementary DNA Proteins 0.000 description 1
- 230000004568 DNA-binding Effects 0.000 description 1
- 206010059866 Drug resistance Diseases 0.000 description 1
- 108700039691 Genetic Promoter Regions Proteins 0.000 description 1
- 108091028043 Nucleic acid sequence Proteins 0.000 description 1
- 108700026244 Open Reading Frames Proteins 0.000 description 1
- 101710137500 T7 RNA polymerase Proteins 0.000 description 1
- 210000001015 abdomen Anatomy 0.000 description 1
- 230000003321 amplification Effects 0.000 description 1
- 230000037005 anaesthesia Effects 0.000 description 1
- 230000009286 beneficial effect Effects 0.000 description 1
- 108091092328 cellular RNA Proteins 0.000 description 1
- 238000013461 design Methods 0.000 description 1
- 238000001514 detection method Methods 0.000 description 1
- 230000004069 differentiation Effects 0.000 description 1
- 208000037265 diseases, disorders, signs and symptoms Diseases 0.000 description 1
- 208000035475 disorder Diseases 0.000 description 1
- 239000003814 drug Substances 0.000 description 1
- 239000012636 effector Substances 0.000 description 1
- 239000012634 fragment Substances 0.000 description 1
- 238000001727 in vivo Methods 0.000 description 1
- 230000000670 limiting effect Effects 0.000 description 1
- 244000144972 livestock Species 0.000 description 1
- 230000007774 longterm Effects 0.000 description 1
- 230000007246 mechanism Effects 0.000 description 1
- 238000000520 microinjection Methods 0.000 description 1
- 239000000203 mixture Substances 0.000 description 1
- 238000003199 nucleic acid amplification method Methods 0.000 description 1
- 230000008121 plant development Effects 0.000 description 1
- 102000004169 proteins and genes Human genes 0.000 description 1
- 238000012216 screening Methods 0.000 description 1
- 238000012163 sequencing technique Methods 0.000 description 1
- 230000011664 signaling Effects 0.000 description 1
- 241000894007 species Species 0.000 description 1
- 230000002194 synthesizing effect Effects 0.000 description 1
- 238000013518 transcription Methods 0.000 description 1
- 230000035897 transcription Effects 0.000 description 1
- 238000012795 verification Methods 0.000 description 1
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01M—CATCHING, TRAPPING OR SCARING OF ANIMALS; APPARATUS FOR THE DESTRUCTION OF NOXIOUS ANIMALS OR NOXIOUS PLANTS
- A01M99/00—Subject matter not provided for in other groups of this subclass
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
- A01N57/00—Biocides, pest repellants or attractants, or plant growth regulators containing organic phosphorus compounds
- A01N57/10—Biocides, pest repellants or attractants, or plant growth regulators containing organic phosphorus compounds having phosphorus-to-oxygen bonds or phosphorus-to-sulfur bonds
- A01N57/16—Biocides, pest repellants or attractants, or plant growth regulators containing organic phosphorus compounds having phosphorus-to-oxygen bonds or phosphorus-to-sulfur bonds containing heterocyclic radicals
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01P—BIOCIDAL, PEST REPELLANT, PEST ATTRACTANT OR PLANT GROWTH REGULATORY ACTIVITY OF CHEMICAL COMPOUNDS OR PREPARATIONS
- A01P7/00—Arthropodicides
- A01P7/04—Insecticides
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering N.A.
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
- Y02A40/10—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in agriculture
- Y02A40/146—Genetically Modified [GMO] plants, e.g. transgenic plants
Abstract
The invention belongs to the field of genetic engineering, discloses application of a bowl gene in limb regeneration and pest control, and particularly discloses a dsRNA (double-stranded ribonucleic acid) comprising a nucleotide sequence shown as SEQ ID NO. 2 and a nucleotide sequence shown as a reverse complementary sequence thereof. The invention discloses the influence of the blattaria insect bowl gene on the amputation regeneration capability of the blattaria insect bowl for the first time, and develops and obtains the dsRNA capable of effectively inhibiting the amputation regeneration of the blattaria insect and the biological material related to the dsRNA based on RNAi interference technology. The synthesized dsRNA targets the bowl gene to influence the wound repair and regeneration process after amputation of the blattaria insect, limit the activity capacity of the blattaria insect and reduce the viability of the blattaria insect, thereby achieving the effect of preventing and controlling the blattaria insect.
Description
Technical Field
The invention belongs to the field of genetic engineering, and in particular relates to application of a bowl gene in limb regeneration and pest control.
Background
Regeneration of tissue and organs has been one of the most encouraging phenomena in biological research, and has also been the first 125 scientific questions in the world by international journal Science. The strong tissue regeneration capability is a survival skill obtained by organisms in a long-term evolution process, and has important biological and ecological significance in the aspect of population environment adaptability. Limb regeneration phenomenon is common in insects, but the regeneration capability difference of different insects is larger, and the development of the research field of insect regeneration can provide reference and reference for the development of the regeneration biology of higher vertebrates. With the vigorous development of modern bioscience and technology, vertebrate regeneration biology research has made remarkable progress, however, insect appendage regeneration mechanism research with stronger regeneration capability is far lagged behind.
American cockroach (Periplaneta americana), belonging to the family Blattaceae of the order Blatta (commonly called cockroach), is called "small-strength" because of its strong vitality and strong tissue regeneration capability. The appendage is renewable after losing, and the whole worm extract thereof has remarkable curative effect in clinical application aspects such as wound repair and the like as a Chinese patent medicine, and is an ideal material for researching the regeneration of the severed limb of the insect. Transcription factors play a key role in regulating gene expression and animal and plant development. The nature of transcription factors is a series of proteins that bind specifically to DNA. There are typically different functional regions, such as a DNA binding domain and an effector domain. Transcription factors can be combined with promoter regions upstream of genes, and can also form transcription factor complexes with other transcription factors to influence transcription of genes, so that complex and fine influences can be generated. The transcription factor bowl can play a key role in controlling cell fate and differentiation, but research in insect limb regeneration has not been reported, and by carrying out gene manipulation (RNAi) on the bowl, the wound repair and limb regeneration process of the American cockroach can be obviously influenced under the condition of destroying the gene expression, and the method is expected to become an ideal strategy for green control of the cockroach and has a good application prospect in wound repair and limb regeneration in other animals.
Disclosure of Invention
The object of the first aspect of the present invention is to provide a dsRNA.
The object of the second aspect of the invention is to provide a biomaterial associated with the dsRNA of the first aspect of the invention.
In a third aspect of the present invention, there is provided a reagent.
The object of the fourth aspect of the present invention is to provide the use of the dsRNA of the first aspect of the present invention, the biomaterial of the second aspect of the present invention and/or the agent of the third aspect of the present invention.
The object of the fifth aspect of the present invention is to provide a method for controlling insects of the order blattaria.
In order to achieve the above purpose, the technical scheme adopted by the invention is as follows:
in a first aspect, the present invention provides a dsRNA comprising a double stranded RNA consisting of the nucleotide sequence shown in SEQ ID NO. 2 and the nucleotide sequence shown in the reverse complement thereof.
In a second aspect of the invention there is provided a biomaterial associated with the dsRNA of the first aspect of the invention, the biomaterial comprising any one of a 1) to a 8):
a1 A nucleic acid molecule encoding the dsRNA of the first aspect of the invention;
a2 An expression cassette comprising a 1) the nucleic acid molecule;
a3 A vector comprising a 1) the nucleic acid molecule;
a4 A vector comprising a 2) the expression cassette;
a5 A transgenic cell line comprising a 1) said nucleic acid molecule;
a6 A transgenic cell line comprising a 2) said expression cassette;
a7 A transgenic cell line comprising a 3) the vector;
a8 A transgenic cell line comprising the vector of a 4).
Preferably, the transgenic cell line does not comprise propagation material.
In a third aspect, the present invention provides a reagent comprising a substance regulating a bowl gene of an insect belonging to the order Blatta.
Preferably, the regulation includes reducing the expression level of the blattaria insect bowl gene and silencing the expression of the blattaria insect bowl gene.
Preferably, the nucleotide sequence of the bowl gene is shown as SEQ ID NO. 1 or SEQ ID NO. 3.
Preferably, the substance comprises the dsRNA of the first aspect of the invention and/or the biomaterial of the second aspect of the invention.
Preferably, the blattaria insect comprises at least one of periplaneta americana, periplaneta australis, periplaneta germanica and periplaneta japonica; further preferably, the blattaria insect is periplaneta americana.
In a fourth aspect the invention resides in providing the use of a dsRNA of the first aspect of the invention, a biomaterial of the second aspect of the invention and/or an agent of the third aspect of the invention in any one of b 1) to b 6):
b1 Inhibiting tissue regeneration of blattaria insect;
b2 Preparation of a product for inhibiting tissue regeneration of an insect of the order Blatta
b3 Preventing and controlling cockroaches;
b4 Preparing a product for preventing and controlling cockroaches;
b5 Inhibiting wound repair in blattaria insects;
b6 Preparing a product for inhibiting wound repair of cockroaches.
Preferably, the blattaria insect comprises at least one of periplaneta americana, periplaneta australis, periplaneta germanica and periplaneta japonica.
Preferably, the tissue comprises insect organ tissue or limb.
In a fifth aspect, the present invention provides a method for controlling an insect of the order blattaria, comprising the step of reducing the expression amount and/or activity of a bowl gene in the insect of the order blattaria.
Preferably, the step of reducing the expression level and/or activity of the bowl gene in the blattaria insect is to introduce the dsRNA of the first aspect of the present invention, the biomaterial of the second aspect of the present invention and/or the agent of the third aspect of the present invention into the blattaria insect.
Preferably, the means of introduction comprises diet or injection.
Preferably, the diet comprises pre-administering, spraying, misting the food or water with the dsRNA of the first aspect of the invention, the biological material of the second aspect of the invention and/or the agent of the third aspect of the invention.
The beneficial effects of the invention are as follows:
the invention discloses the influence of the blattaria insect bowl gene on the amputation regeneration capability of the blattaria insect bowl for the first time, and develops and obtains the dsRNA capable of effectively inhibiting the amputation regeneration of the blattaria insect and the biological material related to the dsRNA based on RNAi interference technology. The synthesized dsRNA targets the bowl gene to influence the wound repair and regeneration process after amputation of the blattaria insect, limit the activity capacity of the blattaria insect and reduce the viability of the blattaria insect, thereby achieving the effect of preventing and treating the blattaria insect and being also applicable to wound repair and tissue regeneration of other animals.
The method for preventing and treating the blattaria insects provided by the invention can not generate drug resistance, has no harm to people and livestock and has no pollution to the environment in the insect prevention and treatment process.
Drawings
FIG. 1 is a diagram showing the RNAi efficiency of a bowl gene, wherein P < 0.05 is represented.
FIG. 2 is a graph showing statistical results of abnormal phenotype and regeneration ability of periplaneta americana limbs caused by the interference of the bowl gene; wherein A is the abnormal phenotype of periplaneta americana limb regeneration, B is a statistical result diagram of regeneration capacity, and P is less than 0.005 in the diagram.
Detailed Description
The invention will now be described in detail with reference to specific examples, without limiting the scope of the invention.
The materials, reagents and the like used in this example are commercially available materials and reagents unless otherwise specified.
Example 1 acquisition of periplaneta americana bowl sequence and dsRNA thereof
Total RNA of periplaneta americana was extracted using the TRIzol (performed according to the instructions using the extraction kit, life Technologies), and then reverse transcribed using oligo T primer and reverse transcriptase PrimeScript II reverse transcriptase (Takara Bio, shiga, japan) to obtain cDNA.
According to the existing periplaneta americana genome information, the complete sequence of the periplaneta americana bowl gene is found by comparison with other species.
The nucleotide sequence of the periplaneta americana bowl gene is shown as SEQ ID No. 1.
5’-ATGCCGGTGGAGGGCGCTGCGGAAGGTTCCGCCGCTTCCGCGGGGTCGTC AGGCGGCGCTTCCACATCATCAGCCCCGCGGGACGAACCCCTATCCCTGTCGCTACCGCGCCCGCCCTTGTCAGGGCGGAGCTCGTCGTCGTCGCGTGGAGGCCCCGGGTTCGAACTCTACCACCATCACCTGGCAGCCGGTCTGGGCGGCCTGCACCGAGAGAGTTCGGCCTTCGTGCCCGTCGTGCCCCAGCGCTTCGTGGCGTACCCTCCCCTTCTCATGGAGGACAAAGTCGAGGGCCGCAAGTCGACGTCTGGCACCAGCTTCGAGCTGATGGCGCTCATGGCCGACAAGAGGAAGGAGCTGGCGCTGAGGGAGGAGGCCGCACGCGTCGCCGCCGCCCACGCCGCGGCTGCCGCTGCCATGCTGCTGCCGCACCCGCACAGGGGCCAGCCGCCCCCGCCGGGGATACTGGAGGGGCTCCCGGGAGCGCCGCCGCCCCACCACCCGTACGGCCCGCCGGCCGGGATCTTTGCGCCCGGCGGATCGGGGTCCGGGTCGGGTGCCGGACCCGGCAGCTTCCCGTTCCCCGGTGCCGCGTTCCCGCCACACCCCCACCACCCCCACGCGCACCTGGACCGCAGGCTGCTGAGGGCGCCCGGCAGGGCGTCGCGCCCCAAGAAGCAGTTCATCTGCAAGTTCTGCAGCCGGCAGTTCACCAAGTCGTACAACCTGCTGATCCACGAGCGCACGCACACGGACGAGCGGCCCTACTCGTGCGACATCTGCGGCAAGGCGTTCAGGCGGCAGGACCACCTCAGGGACCACAGGTACATCCACTCCAAGGAGAAGCCCTTCAAGTGCGGCGAGTGCGGGAAAGGTTTCTGCCAGTCGCGGACGCTGGCCGTGCACAAGATCCTGCACATGGAGGAGTCGCCGCACAAGTGCCCCGTGTGCAGCCGCAGCTTCAACCAGCGCTCCAACCTCAAGACGCACCTGCTCACGCACACAGACCACAAGCCCTATGAGTGCGGCTCCTGCGGCAAGGTGTTCCGGCGCAACTGCGACCTGCGGCGCCACGCCCTCACGCACGCCGTGGG CGACGTCCCGCCCGAGGTGCTGGGCGAGGCGTCAGCGAGCCGTCCCGACCCACCGCCGCCGCCGCCACCACCCCCTCCGCCCCCGCTCAAAGAGTCGTCAGAGTCGACGCCTCCGCCACCGCCGCCGAGGCGCGGGTCGCCGCCTCCGACGACGCGCTGTCATCACCACGACGCAGCATCGTCATCGTCCTCGTATACAATGCGCCCCCCGCCTCCCGAAGCGCCCCCGGACCCGCCCCTGCTGCAGATCAGGAGAGATCTGCTGCACAAGCCGTCGACAGTGACGAGTCTGGAACCCACGCCGGGCACCAGCATGGGGGCGCTCGGGATATTCCGGAGAAAGCTGCCGGAGCCGCCGGACATCCGGGTGAGGAGCGCACTGCCCGCCACCGTGACGCGTCCCGACGCGGCCGATCCGGGGCCCTCCACATCCGCGTCCACGTCGACCTCGAGGCCGCCCGCCAGGAACCCGTCCACGAAGATGCACGGCTTCAGCATCGAGGAGATCATGAGGCGCTAG-3’(SEQ ID No:1)。
And (3) designing website E-RNAi (https:// www.dkfz.de/signaling/E-RNAi3 /) by using dsRNA, copying and pasting the whole targeted periplaneta americana bowl gene open reading frame sequence into the website, and screening by using design parameters to obtain the optimal dsRNA targeting sequence, wherein the DNA sequence of the dsRNA targeting sequence is shown as SEQ ID No. 3.
5’-CGCTTCCGCGGGGTCGTCAGGCGGCGCTTCCACATCATCAGCCCCGCGGGA CGAACCCCTATCCCTGTCGCTACCGCGCCCGCCCTTGTCAGGGCGGAGCTCGTCGTCGTCGCGTGGAGGCCCCGGGTTCGAACTCTACCACCATCACCTGGCAGCCGGTCTGGGCGGCCTGCACCGAGAGAGTTCGGCCTTCGTGCCCGTCGTGCCCCAGCGCTTCGTGGCGTACCCTCCCCTTCTCATGGAGGACAAAGTCGAGGGCCGCAAGTCGACGTCTGGCACCAGCTTCGAGCTGATGGCGCTCATGGCCGACAAGAGGAAGGAGCTGGCGCTGAGGGAGGAGGCCGCACG-3’(SEQ ID No:3)。
Primer sequences for amplification dsRNA targeting were then designed, specifically, the upstream primer bowl F:5'-CGCTTCCGCGGGGTCGTC-3' (SEQ ID NO: 4), downstream primer bowl R:5'-CGTGCGGCCTCCTCCCTC-3' (SEQ ID NO: 5). The DNA fragment containing the targeting sequence (SEQ ID No: 3) was amplified using cDNA as a template, and its clone was changed to pTOPO vector (purchased from Aidlab), and the presence or absence of base mutation in the sequence was verified by sequencing, and the clone without any mutation was selected for the subsequent experiment, and the vector obtained based on this step was designated pTOPO-bowl.
The T7 promoter is introduced at two sides of the target sequence by adopting PCR, and the specific method comprises the following steps: the primers (5'-GGATCCTAATACGACTCACTATAGGCGCTTCCGCGGGGTCGTC-3' (SEQ ID No: 6) and 5'-GGATCCTAATACGACTCACTATAGG CGTGCGGCCTCCTCCCTC-3' (SEQ ID No: 7)) containing the T7 promoter at both ends were amplified using the pTOPO-bowl vector as a template to obtain a PCR product containing the T7 promoter at both ends.
The T7RiboMAX Express RNAi System (Promega Corporation) is used for synthesizing forward and reverse RNA, after the T7 RNA polymerase and DNaseI are sequentially processed, the two forward and reverse RNAs are mixed and processed for 10min at 70 ℃, and then the temperature is gradually reduced to room temperature to anneal the RNAs into dsRNA, thus obtaining the double-stranded RNA composed of the nucleotide sequence shown as SEQ ID No. 2 and the corresponding reverse complementary nucleotide.
5’-CGCUUCCGCGGGGUCGUCAGGCGGCGCUUCCACAUCAUCAGCCCCGCGG GACGAACCCCUAUCCCUGUCGCUACCGCGCCCGCCCUUGUCAGGGCGGAGCUCGUCGUCGUCGCGUGGAGGCCCCGGGUUCGAACUCUACCACCAUCACCUGGCAGCCGGUCUGGGCGGCCUGCACCGAGAGAGUUCGGCCUUCGUGCCCGUCGUGCCCCAGCGCUUCGUGGCGUACCCUCCCCUUCUCAUGGAGGACAAAGUCGAGGGCCGCAAGUCGACGUCUGGCACCAGCUUCGAGCUGAUGGCGCUCAUGGCCGACAAGAGGAAGGAGCUGGCGCUGAGGGAGGAGGCCGCACG-3’(SEQ ID No:2)。
EXAMPLE 2 American cockroach in vivo injection experiment of dsRNA
The periplaneta americana just ecdysis selected for feeding, the periplaneta americana is placed on a microscopic dissecting table after being subjected to low-temperature anesthesia the next day after the periplaneta americana is ecdysis, then dsRNA (SEQ ID No: 2) targeting the bowl gene is injected into the abdomen of the periplaneta americana as a bowl gene interference group according to a certain dosage (1 mu L is injected, the concentration is 1 mu g/mu L) by using a microinjection method, the total injection is carried out once, meanwhile dsMock (GAAAGCUCGGUACCACGCAUGCUGCAGACGCGUUACGUAUCGGAUCCAGAAU UCGUGAUAUCUGAAUUCGUCGACAAGCUUCUCGAGCCUAGGCUAGCUCUAGAC CACACGUGUGGGGGCCCGAGCUCGCGGCCGCUGUAUUC (SEQ ID No: 10)) which cannot target any endogenous gene of the periplaneta americana is taken as a control group, the influence of dsRNA treatment on the periplaneta americana limb regeneration is continuously observed after the injection, and the influence of the bowl gene on the wound repair and limb regeneration of the periplaneta americana is studied under the condition that the gene expression quantity is reduced.
Verification of the interference effect of dsRNA on the bowl Gene
The periplaneta americana was anesthetized and dissected 48h after one dsRNA injection, its leg tissues were dissected out and RNA was extracted, and the fat mass was treated using the RN 28-easysspin Plus tissue/cellular RNA rapid extraction kit (Aidlab, RN 2802), operating according to kit instructions. RNA concentration was measured using Nanodrop One, and then 2. Mu.g of RNA was measured and reverse transcribed to obtain cDNA. qPCR primers (5'-GCTGTGACGCCGTTGATTTCT-3' (SEQ ID No: 8) and 5'-GCGGGGCTGATGATGTGG-3' (SEQ ID No: 9)) were designed using premier 5 primer design software, quantitative detection of gene expression was performed using SYBR Green qPCR mix, and the effect of target gene interference was detected by analyzing the quantitative result.
As shown in fig. 1, it was found that dsRNA treatment could significantly interfere with expression of the target gene bowl.
(II) observation and statistics of the regeneration condition of periplaneta americana
Compared with a control group (dsMock injected with any endogenous gene of periplaneta americana can not be targeted), limb regeneration variation of periplaneta americana of the bowl gene interference group is observed and counted.
Experimental results show that the American cockroach injected with the control group can normally grow new normal appendages (the length of the new appendages is normal) after the ecdysis and the appendage is broken, the American cockroach with the bowl gene interference group has regeneration disorder, and only a small proportion of limb tissues (the length of the new appendage is obviously lower than that of the control group) (A in fig. 2) can be grown, so that the activity capacity of the American cockroach is greatly influenced, the survival capacity of the American cockroach is reduced, and the prevention and treatment effect is achieved. Further, the broken limb regeneration capacity of the periplaneta americana in the two groups is counted, and the result is shown as a figure 2B, wherein the broken limb regeneration capacity of the periplaneta americana in the two groups is remarkably different, so that the fact that the bootl gene can play an important role in wound repair and limb regeneration of the periplaneta americana is proved.
The embodiments of the present invention have been described in detail with reference to the accompanying drawings, but the present invention is not limited to the above embodiments, and various changes can be made within the knowledge of one of ordinary skill in the art without departing from the spirit of the present invention. Furthermore, embodiments of the invention and features of the embodiments may be combined with each other without conflict.
Claims (10)
1. A dsRNA comprising a double stranded RNA consisting of a nucleotide sequence shown in SEQ ID No. 2 and a nucleotide sequence shown in its reverse complement.
2. A biomaterial associated with the dsRNA of claim 1, said biomaterial comprising any one of a 1) to a 8): a1 A nucleic acid molecule encoding the dsRNA of claim 1;
a2 An expression cassette comprising a 1) the nucleic acid molecule;
a3 A vector comprising a 1) the nucleic acid molecule;
a4 A vector comprising a 2) the expression cassette;
a5 A transgenic cell line comprising a 1) said nucleic acid molecule;
a6 A transgenic cell line comprising a 2) said expression cassette;
a7 A transgenic cell line comprising a 3) the vector;
a8 A transgenic cell line comprising the vector of a 4).
3. A reagent, characterized in that the reagent pack regulates the substance of the blattaria insect bowl gene.
4. The agent according to claim 3, wherein the regulation comprises reducing the expression level of the blattaria insect bowl gene and silencing the expression of the blattaria insect bowl gene.
5. The agent of claim 4, wherein the substance comprises the dsRNA of claim 1 and/or the biological material of claim 2.
6. Use of the dsRNA of claim 1, the biomaterial of claim 2 and/or the agent of any one of claims 3-5 in any one of b 1) to b 6):
b1 Inhibiting tissue regeneration of blattaria insect;
b2 Preparation of a product for inhibiting tissue regeneration of an insect of the order Blatta
b3 Preventing and controlling cockroaches;
b4 Preparing a product for preventing and controlling cockroaches;
b5 Inhibiting wound repair in blattaria insects;
b6 Preparing a product for inhibiting wound repair of cockroaches.
7. The use according to claim 6, wherein the blattaria insect comprises at least one of periplaneta americana, periplaneta australis, periplaneta germanica, periplaneta japonica.
8. A method for controlling blattaria insects, comprising the step of reducing the expression amount and/or activity of a bowl gene in the blattaria insects; preferably, the step of reducing the expression level and/or activity of the bowl gene in the blattaria insect is to introduce the dsRNA of claim 1, the biological material of claim 2 and/or the agent of any one of claims 3 to 5 into the blattaria insect.
9. The method of claim 8, wherein the means of introducing comprises diet or injection; preferably, the diet comprises the inclusion of the dsRNA of claim 1, the biomaterial of claim 2 and/or the agent of any one of claims 3-5 in food or water by pre-application, spraying.
10. The method of claim 9, wherein the blattaria insect comprises at least one of periplaneta americana, periplaneta australiana, periplaneta germanica, periplaneta japonica.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202310757592.0A CN117143870B (en) | 2023-06-25 | 2023-06-25 | Application of bowl gene in limb regeneration and pest control |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202310757592.0A CN117143870B (en) | 2023-06-25 | 2023-06-25 | Application of bowl gene in limb regeneration and pest control |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN117143870A true CN117143870A (en) | 2023-12-01 |
| CN117143870B CN117143870B (en) | 2024-03-12 |
Family
ID=88897512
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202310757592.0A Active CN117143870B (en) | 2023-06-25 | 2023-06-25 | Application of bowl gene in limb regeneration and pest control |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN117143870B (en) |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106854650A (en) * | 2016-11-17 | 2017-06-16 | 江苏开放大学 | American cockroach wingless full length genes are identified and applied |
| CN110468131A (en) * | 2019-08-13 | 2019-11-19 | 华南师范大学 | DsRNA, encoding gene based on the design of American cockroach Orco gene and the preparation method and application thereof |
| CN112458087A (en) * | 2020-11-06 | 2021-03-09 | 华南师范大学 | dsRNA designed based on periplaneta americana HDAC1 gene, preparation method thereof, coding gene and application thereof |
| CN114853861A (en) * | 2022-04-06 | 2022-08-05 | 岭南现代农业科学与技术广东省实验室 | Periplaneta americana PRP protein expression inhibitor and encoding gene and application thereof |
| CN114957426A (en) * | 2022-06-02 | 2022-08-30 | 华南师范大学 | SP6RARS and application thereof in preventing and controlling blattaria insects |
-
2023
- 2023-06-25 CN CN202310757592.0A patent/CN117143870B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106854650A (en) * | 2016-11-17 | 2017-06-16 | 江苏开放大学 | American cockroach wingless full length genes are identified and applied |
| CN110468131A (en) * | 2019-08-13 | 2019-11-19 | 华南师范大学 | DsRNA, encoding gene based on the design of American cockroach Orco gene and the preparation method and application thereof |
| CN112458087A (en) * | 2020-11-06 | 2021-03-09 | 华南师范大学 | dsRNA designed based on periplaneta americana HDAC1 gene, preparation method thereof, coding gene and application thereof |
| CN114853861A (en) * | 2022-04-06 | 2022-08-05 | 岭南现代农业科学与技术广东省实验室 | Periplaneta americana PRP protein expression inhibitor and encoding gene and application thereof |
| CN114957426A (en) * | 2022-06-02 | 2022-08-30 | 华南师范大学 | SP6RARS and application thereof in preventing and controlling blattaria insects |
Non-Patent Citations (5)
| Title |
|---|
| CHONGHUA REN等: "Two transcriptional cascades orchestrate cockroach leg regeneration", 《BIORXIV》, 9 December 2023 (2023-12-09), pages 1 - 41 * |
| TETSUYA BANDO等: "Molecular mechanisms of limb regeneration: insights from regenerating legs of the cricket Gryllus bimaculatus", 《INT. J. DEV. BIOL.》, vol. 62, 21 June 2018 (2018-06-21), pages 559 - 569 * |
| 周小洁等: "RNA干扰技术在德国小蠊功能基因研究中的应用", 《中国媒介生物学及控制杂志》, vol. 24, no. 5, 20 October 2013 (2013-10-20), pages 473 - 476 * |
| 赵方明等: "德国小蠊通过自体切除来优化断足再生", 《昆虫学报》, vol. 66, no. 04, 19 April 2023 (2023-04-19), pages 439 - 449 * |
| 马云峰;李绍斌;杨松;黎玄钢;: "蜚蠊目RNA干扰的应用研究进展及展望", 《科技视界》, no. 12, 25 April 2020 (2020-04-25), pages 173 - 175 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN117143870B (en) | 2024-03-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Yamaguchi et al. | siRNAs induce efficient RNAi response in Bombyx mori embryos | |
| CN103571844B (en) | DsRNA and the application be combined in control aphid damage thereof | |
| CN108893472B (en) | A kind of dsRNA and its application on prevention and treatment Groton bug | |
| Gui et al. | First report on CRISPR/Cas9-targeted mutagenesis in the Colorado potato beetle, Leptinotarsa decemlineata | |
| CN103088024B (en) | Application of two dsRNAs (double-stranded ribonucleic acids) and combination thereof in controlling aphid damage | |
| CN110468137B (en) | Himalayan twenty eight star ladybug high-lethal gene and application thereof in preventing and treating ladybug | |
| CN114957426B (en) | SP6RARS and application thereof in preventing and treating cockroaches | |
| CN114853861B (en) | Periplaneta americana PRP protein expression inhibitor, and encoding gene and application thereof | |
| Xi et al. | Sex control by Zfy siRNA in the dairy cattle | |
| CN110862990B (en) | Cad96ca gene related to epidermal development of German cockroach, dsRNA of gene, preparation method and application thereof | |
| CN117143870B (en) | Application of bowl gene in limb regeneration and pest control | |
| CN116904461B (en) | Application of zfh-2 gene in limb regeneration and pest control | |
| CN112458087B (en) | dsRNA designed based on periplaneta americana HDAC1 gene, preparation method thereof, coding gene and application thereof | |
| CN112159811A (en) | Targeted circRNA capable of competitively binding oar-miR-29b and application thereof | |
| CN112695033A (en) | siRNA designed based on periplaneta americana male periglandular reproduction related gene SP28 and preparation method and application thereof | |
| CN110295169A (en) | A kind of miRNA and its application for killing brown paddy plant hopper | |
| CN112522278B (en) | dsRNA (double-stranded ribonucleic acid) designed based on periplaneta americana olfactory receptor gene OR3X, encoding gene, preparation method and application thereof | |
| CN116535480B (en) | FUBP and application thereof | |
| CN108060147A (en) | Migratory locusts protein tyrosine kinase PTK and its encoding gene and application | |
| Onuma et al. | Nkx2-1 and FoxE regionalize glandular (mucus-producing) and thyroid-equivalent traits in the endostyle of the chordate Oikopleura dioica | |
| CN110699359B (en) | Grh gene related to epidermal development of German cockroach, dsRNA of gene, preparation method and application thereof | |
| CN112725345B (en) | dsRNA designed based on periplaneta americana sex pheromone receptor gene OR5M, coding gene, preparation method and application thereof | |
| CN108949769A (en) | A kind of cotton bollworm molt hormone regulating and controlling factor E78-C gene cDNA and its application | |
| CN108949770B (en) | Heliothis armigera E75 gene and application thereof in RNA-mediated pest control | |
| CN116790679B (en) | Application of German cockroach Dnmt1 gene in limb regeneration and pest control |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |