CN110699359B - Grh gene related to epidermal development of German cockroach, dsRNA of gene, preparation method and application thereof - Google Patents

Grh gene related to epidermal development of German cockroach, dsRNA of gene, preparation method and application thereof Download PDF

Info

Publication number
CN110699359B
CN110699359B CN201910977154.9A CN201910977154A CN110699359B CN 110699359 B CN110699359 B CN 110699359B CN 201910977154 A CN201910977154 A CN 201910977154A CN 110699359 B CN110699359 B CN 110699359B
Authority
CN
China
Prior art keywords
gene
dsrna
grh
seq
nucleotide sequence
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201910977154.9A
Other languages
Chinese (zh)
Other versions
CN110699359A (en
Inventor
李胜
任充华
赵政
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Guangmeiyuan R & D Center Key Laboratory Of Insect Developmental Biology And Applied Technology Huashi Meizhou City
South China Normal University
Original Assignee
Guangmeiyuan R & D Center Key Laboratory Of Insect Developmental Biology And Applied Technology Huashi Meizhou City
South China Normal University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Guangmeiyuan R & D Center Key Laboratory Of Insect Developmental Biology And Applied Technology Huashi Meizhou City, South China Normal University filed Critical Guangmeiyuan R & D Center Key Laboratory Of Insect Developmental Biology And Applied Technology Huashi Meizhou City
Priority to CN201910977154.9A priority Critical patent/CN110699359B/en
Publication of CN110699359A publication Critical patent/CN110699359A/en
Application granted granted Critical
Publication of CN110699359B publication Critical patent/CN110699359B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/43504—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates
    • C07K14/43563—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from insects
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K67/00—Rearing or breeding animals, not otherwise provided for; New breeds of animals
    • A01K67/033—Rearing or breeding invertebrates; New breeds of invertebrates
    • A01K67/0333—Genetically modified invertebrates, e.g. transgenic, polyploid
    • A01K67/0337—Genetically modified Arthropods
    • A01K67/0339—Genetically modified insects, e.g. Drosophila melanogaster, medfly
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/89—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation using microinjection
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2227/00—Animals characterised by species
    • A01K2227/70—Invertebrates
    • A01K2227/706—Insects, e.g. Drosophila melanogaster, medfly
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.

Abstract

The invention discloses a Grh gene related to the epidermal development of Blattella germanica, dsRNA of the gene, a preparation method and application thereof, wherein the nucleotide sequence of the Grh gene is shown as SEQ ID No.1, and the dsRNA is double-stranded RNA consisting of the nucleotide sequence shown as SEQ ID No.2 and a nucleotide sequence which is reversely complementary with the nucleotide sequence shown as SEQ ID No. 2. The invention utilizes RNAi interference technology, realizes the purpose of cockroach control on the basis of blocking or destroying the moulting of the cockroaches by synthesizing dsRNA to target-silence the epidermal development related gene Grh to influence the molting of the cockroaches, and provides a new molecular target for pest control.

Description

Grh gene related to epidermal development of German cockroach, dsRNA of gene, preparation method and application thereof
Technical Field
The invention belongs to the field of genetic engineering, and particularly relates to a Grh gene related to epidermal development of Blattella germanica, dsRNA of the gene, and a preparation method and application of the dsRNA.
Background
Cockroaches are one of the most widely distributed and intractable domestic sanitary pests worldwide. Cockroaches prefer wet, warm and dark living places, and are often active at night, so that the cockroaches are difficult to kill. Although the volume of the cockroach is small, the cockroach has strong killing power, not only can bite clothes and pollute food, but also can spread diseases, and is a carrier of various bacteria; the cockroach can secrete some strange smell substances, when the population density is higher, the secretion can make living places of the cockroach diffuse a special odor, and meanwhile, the secretion can make food go bad and go bad, so that certain harm is brought to human life and agricultural production.
From the last 40 s, chemical pesticides and organic insecticides have shown high-efficiency insecticidal effects in pest control practices, and revolutionary changes have been brought to pest control. However, with the long-term use of the fertilizer in large quantities, a series of negative problems such as soil degradation, pesticide residue, water source and environment pollution, biological chain interruption, ecological imbalance and the like become increasingly prominent. Therefore, the development of an environment-friendly, efficient and low-toxicity method for controlling cockroaches is of great significance to economic development, social progress and food safety.
RNA interference (RNAi) is a target gene silencing mechanism mediated by double-stranded RNA (dsrna), has high sequence specificity, is specific for RNAi technology-based pest control strategies, and is safe for non-target organisms. The core of the pest control strategy based on the RNAi technology is to search key molecular target genes and obtain specific and efficient dsRNA fragment sequences. The RNA interference technology uses a biological means, does not cause pollution to the environment, and is an environment-friendly pest control means.
The cockroach can molt for many times in a lifetime, the molting is a key life process for the continuous growth of the body of the cockroach, and the molting of the cockroach every time is accompanied with the increase of the body type. And the phenomenon of multiple molting brings a chance for the control of the cockroaches, and the death of the cockroaches caused by blocking the molting of the cockroaches becomes an ideal strategy for controlling the cockroaches.
Disclosure of Invention
The first technical problem to be solved by the present invention is: provides a gene related to epidermal development of the German cockroach, and can influence the epidermal development of the German cockroach by targeting the gene, thereby establishing a safe and efficient novel method for preventing and treating the cockroach.
A second technical problem to be solved by the present invention is: provides a fragment sequence of a gene related to epidermal development of the German cockroach.
A third technical problem to be solved by the present invention is: provides a preparation method of the gene fragment.
A fourth technical problem to be solved by the present invention is: provides the application of the gene segment.
A fifth technical problem to be solved by the present invention is: dsRNA designed based on the gene fragment is provided.
A sixth technical problem to be solved by the present invention is: a method for preparing the dsRNA.
A seventh technical problem to be solved by the present invention is: the use of the above dsRNA.
In order to solve the first technical problem, the invention adopts the following scheme: a Grh gene related to the epidermal development of Blattella germanica has a nucleotide sequence shown in SEQ ID No. 1.
In order to solve the second technical problem, the invention adopts the following scheme: a gene segment of Grh gene related to the epidermal development of Blattella germanica, the nucleotide sequence of the gene segment is shown in SEQ ID No. 3.
In order to solve the third technical problem, the invention adopts the following scheme: the preparation method of the gene fragment comprises the following steps: cloning the Grh gene into a vector as a template, and designing a primer for PCR amplification to obtain the gene fragment.
Further, the primers comprise an upstream primer and a downstream primer, wherein the nucleotide sequence of the upstream primer is shown as SEQ ID No.4, and the nucleotide sequence of the downstream primer is shown as SEQ ID No. 5.
In order to solve the fourth technical problem, the invention adopts the following scheme: a recombinant vector or a recombinant bacterium containing the gene segment.
The recombinant vector or the recombinant bacterium is applied to prevention and treatment of German cockroach.
In order to solve the fifth technical problem, the invention adopts the following scheme: the dsRNA is double-stranded RNA consisting of a nucleotide sequence shown in SEQ ID No.2 and a nucleotide sequence which is reversely complementary with the nucleotide sequence shown in SEQ ID No. 2.
In order to solve the sixth technical problem, the invention adopts the following scheme: the preparation method of the dsRNA comprises the following steps: the Grh gene fragment is cloned into a vector to be used as a template, a primer is designed, and the dsRNA is obtained by in vitro transcription synthesis after PCR amplification.
Further, the primers comprise an upstream primer and a downstream primer, wherein the nucleotide sequence of the upstream primer is shown as SEQ ID No.6, and the nucleotide sequence of the downstream primer is shown as SEQ ID No. 7.
In order to solve the seventh technical problem, the invention adopts the following scheme: the dsRNA is applied to the preparation of products for preventing and treating German cockroach or influencing German cockroach epidermal development.
The dsRNA is applied to prevention and control of German cockroach.
A method for preventing and controlling German cockroach comprises the following steps: the dsRNA was introduced into Blattella germanica.
The invention has the beneficial effects that: the scheme firstly uses the German cockroach epidermis related gene Grh gene as a pest prevention and control target, and synthesizes dsRNA interfering the gene expression based on Grh gene design. The dsRNA is introduced into the body of the German cockroach, so that the expression of Grh gene can be obviously inhibited, further, the epidermal growth obstacle of the German cockroach is caused, the ecdysis process and the epidermal growth process cannot be normally carried out, and the German cockroach is dead, thereby realizing the final purpose of preventing and treating pests and providing a new molecular target for preventing and treating the pests.
Additional aspects and advantages of the invention will be set forth in part in the description which follows and, in part, will be obvious from the description, or may be learned by practice of the invention.
Drawings
FIG. 1 is a diagram showing the analysis of the functional domain of the Grh gene in example 2 of the present invention;
FIG. 2 is an RNAi efficiency assay of the Grh gene in example 2 of the present invention;
FIG. 3 is a graph showing the morphology of Blattella germanica after injection of dsCK and dsGrh in example 2 of the present invention;
FIG. 4 is a comparison chart of the results of moulting of Blattella germanica after injection of dsCK and dsGrh in example 2 of the present invention;
FIG. 5 is a graph showing the structural changes of the epidermal surface of Blattella germanica after injection of dsCK and dsGrh in example 2 of the present invention.
Detailed Description
In order to explain technical contents, achieved objects, and effects of the present invention in detail, the following description is made with reference to the accompanying drawings in combination with the embodiments.
The most key concept of the invention is as follows: the ecdysis process of cockroaches is influenced by interfering Grh gene expression through synthesizing dsRNA, and the aim of preventing and controlling cockroaches is achieved by blocking the ecdysis process on the basis of blocking or destroying the surface development of cockroaches.
The first embodiment of the invention is as follows: design and synthesis of dsRNA:
total RNA from the adipose body site of Blattella germanica was extracted using TRIzol (Life technologies) method, and then reverse transcription was performed using OligodT primer (PrimeScript II reverse transcriptase trans criptase (Takara Bio, Shiga, Japan)) to synthesize the first strand cDNA.
According to the existing genome information of the German cockroach, the complete sequence of the German cockroach Grh gene is found by comparing the German cockroach with other species, and is shown as SEQ ID No. 1.
SEQ ID No.1：
ATGGCTGATATGCCGCCGTCGGAAGGCGGGGGCGGCGGAGAGGATGGGGCTTGGAGGACGGCAGCATATTACAGCAACGAACACCCCCTGACGGCGGCCACTGCAGCAATGCTCAACATCAGCGGCGCTGGCGTCGAAGACCAAACCCAATCCATGAGCTTAATCTACGAGTATTACAAACTTCCACAACTGCCGGCCACTGTCACCGATAAGGACAAACTCGAAATATGGCCGACGACATCCTCTGCGAGTGGCGCTCCCCTGCTGACGTCACAAGTGAAAGCGACCAATGGACTTGGCTCTGGGGCGGGACACGACTTGATCGCTCAACCTCCTGCGTCGTCTTCGGCCCTCAGCCCCTCCTCACCGGTCGTAGCGACGGCAGCCGAGCTCCAAGGCCTGTTTCTGCACCACCAACAACAACAGCAACAACAACAACAACTGCACCATCCTCATTTGCACCCTCAACAATTTATCGTAAAGCGCGAACCGGAAGATCTGAGCAGACACAAGGCTTCCGGGTCGCCGCCTCTACTGGACGGCGGGACAACAGGTAGCATCATCATCAGTAATAAGTCGGGCAGTGCGCCTAGGCATAAGTTGGTGCTCGTGTCTGCTGCTAATGGAGGTTCTGCGGGTAATCTCGTGGTGGATGTGGTGAATAACAACAGCACTGGTATAAAGGAAGAACTGCCGTCGCACCACCGTGGGCTCAACTCGCCGCAGCACGGCAGTCGCTCTATCAACGGAACGCCCTCTTCGACGTCTTCTCTGCTTGCCGCAGACGGAGGCACGACTGGTGGTTCCATCGAACTCATAACAGCGGACGGCCTCAAGCCCCCGATGTCTTACAGCACGCAAATCTTCGCTCAACACCATGGCGGGAGTGGGACACCCTCGCCTATACCTTACTCCGACCACGTGGCGCAATACACGACGACGGCCGTGTCTCAGGGTGGCACCGGCTATGTAACAACATCCGCGACGGGCAACATCCGCGCCGCGACGTCTGCCGCCTTCATAACGGACCAATACTACAGGGATTACTTCCCTGTGACAGGCACTTCCGCAGAGCAAGGATACACAACGACGCAAGTTCGCCAGCAAATTCCTTCCTATGCGGACAGCCCCGAGGGCGGCGGGGGTGGTGGAGGTGGCACGTCCAGTACGACTACGGCGTCGTTAATGGAACGATATGTTCGAAGCACCGGTAACGTGTACCACAATAATAAAAGTGTAGTGTCTGCGGCAACAGCTGCTGGACTTACGGTGGATCTGCCTTCGCCGGATAGTGGCATCGGAGCAGAAGCCATCACACCAAGAGAGCAGACCACAATACCTCAGCAATTCGACTATGGCGGCCCCGAAATGTGCCAGCAACCGCTACTCACCGACCCAGCGCTGGTGACGCAGAGGGTAGCGGCGGGCCAATCTCCTGGTCAAGGAAGCACTGGGGGCAGGTCGCGGCCATGGCACGATTTCGGCAGACAGAACGACGCAGACAAAATTCAGATACCTAAAATATACTCGCAATATGGGTTCAAGTATCACCTAGAGACACCAATCTCAACGAGTCAGAGGCGAGAGGACGACAGGATTACATATATCAACAAGGGCCAATTTTATGGCATCACCCTCGAGTACCTTCCCGATCCGGACAAACCTCTCAAGAGTCAAACAGTAAAGAGCGTCGTAATGCTCATGTTCCGAGAGGAGAAAAGTCCAGAGGACGAAATCAAAGCTTGGCAATTCTGGCATGGGAGGCAACATAGTGTAAAACAAAGGATATTGGACGCAGATACGAAAAACAGCGTTGGTTTGGTTGGCTGCATTGAAGAAGTTGCGCACAACGCTATCGCGGTCTACTGGAATCCTCTAGACAGTACAGCAAAGATAAACGTAGCAGTCCAATGTCTCAGCACGGACTTCAGCAGTCAGAAGGGCGTCAAAGGATTGCCTCTTCACCTCCAAATAGACACGTACGAAGATCCAAGGGATACCACAATTTTCCATAGAGGGTACTGTCAAATCAAAGTCTTCTGTGACAAGGGTGCAGAGAGAAAGACTAGAGATGAAGAAAGGCGAGCTGCTAAACGCAAAATGACAGCCACCGGTCGTAAGAAGATGGATGAATTGTACCATCCTGCAACGGAAAGGTCCGAATTCTATGCAATGAGTGACCTCGCAAAACCACCTGTCTTGTTCACCCCAGCGGAGGACATAGACAAGTTAACATCAATGGAACTTCAAGGGTTCTACAGTCATGAGACAGATAGCTCAAGCCTGTCGAATGGGGAGGCAAGTTCTGGGTCTCAGCATGGGCTTGGGAAGCAGGGATCGCCCTTCCTCCTGCATTCGAGCAAACCGAGCACCACGCCGACACTCAAGTTCCACAACCATTTTCCCCCGGATACACCTGGTGATAAGAAAGATGGCATAATTGATAGTGCAAACCTAACAACAGATGGCACTGTCTTCTCAAGTCCGCCAATTAAGAGGGCCAAGATGATGGCAGCTCCATCATTGAATGAACGAGTGATGTTATACGTTCGTCAGGACTCGGACGATGTTTACACACCCCTGCATGTTGTACCTCCCACAACACAGGGGCTACTCAATGCGGATTATAGCCAAAATTGA。
The dsRNA is used for designing E-RNAi (https:// www.dkfz.de/signalling/E-RNAi 3/), the whole targeted German cockroach Grh gene open reading frame sequence is copied and pasted to the website, and the optimal dsRNA targeted sequence is obtained by screening design parameters. Primer pairs TTGGTGCTCGTGTCTGCTGCTAATGGAGGT (SEQ ID No.4) and CGAACTTGCGTCGTTGTGTATCCTTGCTCT (SEQ ID No.5) were then designed. And amplifying to obtain a DNA fragment containing a target sequence by taking cDNA as a template, cloning the DNA fragment into a pTOPO vector (Aidlab, China), verifying whether the sequence has base mutation by sequencing, selecting the clone without any mutation for subsequent experiments, and naming the vector as pTOPO-Grh. The dsRNA targeted DNA sequence is shown as SEQ ID No. 3.
SEQ ID No.3：
TTGGTGCTCGTGTCTGCTGCTAATGGAGGTTCTGCGGGTAATCTCGTGGTGGATGTGGTGAATAACAACAGCACTGGTATAAAGGAAGAACTGCCGTCGCACCACCGTGGGCTCAACTCGCCGCAGCACGGCAGTCGCTCTATCAACGGAACGCCCTCTTCGACGTCTTCTCTGCTTGCCGCAGACGGAGGCACGACTGGTGGTTCCATCGAACTCATAACAGCGGACGGCCTCAAGCCCCCGATGTCTTACAGCACGCAAATCTTCGCTCAACACCATGGCGGGAGTGGGACACCCTCGCCTATACCTTACTCCGACCACGTGGCGCAATACACGACGACGGCCGTGTCTCAGGGTGGCACCGGCTATGTAACAACATCCGCGACGGGCAACATCCGCGCCGCGACGTCTGCCGCCTTCATAACGGACCAATACTACAGGGATTACTTCCCTGTGACAGGCACTTCCGCAGAGCAAGGATACACAACGACGCAAGTTCG。
The T7 promoter is introduced on both sides of the target sequence by PCR, and the specific method is to design primers, GGATCCTAATACGACTCACTATAGG TTGGTGCTCGTGTCTGCTGC (SEQ ID No.6) and GGATCCTAATACGACTCACTATAGG CGAACTTGCGTCGTTGTGTA (SEQ ID No.7), which contain the T7 promoter at both ends. Amplifying by using pTOPO-Grh vector as a template to obtain a PCR product containing T7 promoters at two ends, and then utilizing T7RiboMAXTMExpress RNAi System (Promega Corporation) to synthesize forward and reverse RNAs, after T7 RNA polymerase and DNaseI are sequentially processed, two forward and reverse RNAs are mixed and processed at 70 ℃ for 10min, and then are gradually cooled to room temperature to anneal into dsRNA, wherein the sequence is double-stranded RNA consisting of the nucleotide sequence shown in SEQ ID No.2 and corresponding reverse complementary nucleotides.
SEQ ID No.2：
UUGGUGCUCGUGUCUGCUGCUAAUGGAGGUUCUGCGGGUAAUCUCGUGGUGGAUGUGGUGAAUAACAACAGCACUGGUAUAAAGGAAGAACUGCCGUCGCACCACCGUGGGCUCAACUCGCCGCAGCACGGCAGUCGCUCUAUCAACGGAACGCCCUCUUCGACGUCUUCUCUGCUUGCCGCAGACGGAGGCACGACUGGUGGUUCCAUCGAACUCAUAACAGCGGACGGCCUCAAGCCCCCGAUGUCUUACAGCACGCAAAUCUUCGCUCAACACCAUGGCGGGAGUGGGACACCCUCGCCUAUACCUUACUCCGACCACGUGGCGCAAUACACGACGACGGCCGUGUCUCAGGGUGGCACCGGCUAUGUAACAACAUCCGCGACGGGCAACAUCCGCGCCGCGACGUCUGCCGCCUUCAUAACGGACCAAUACUACAGGGAUUACUUCCCUGUGACAGGCACUUCCGCAGAGCAAGGAUACACAACGACGCAAGUUCG。
The second embodiment of the invention is as follows: application of dsRNA (german cockroach in vivo experiment):
in order to verify the influence of the dsRNA targeting the Grh gene prepared by the invention on the epidermal development process of the German cockroach, the dsRNA injection mode of the German cockroach is realized. CK which does not target any gene of the German cockroach is adopted as a negative control of dsRNA.
The method comprises the following steps: selecting 5-age (N5) and 6-age (N6) German cockroach which just exuviates, breeding, anesthetizing the German cockroach at low temperature on the next day after exuviation, placing on a microscope dissecting table, injecting dsRNA targeting Grh genes into the abdomen of the German cockroach according to a certain dose by using a microinjection method, injecting once in all, continuously observing the influence of dsRNA treatment on the exuviation of the German cockroach after injection, and researching the influence of the Grh genes on the exuviation of the German cockroach under the condition of reducing the gene expression quantity. Wherein, the experimental group and the control group respectively have three biological repetitions, and 15 german cockroaches are repeatedly used for each repetition.
The verification results are as follows:
grh Gene Domain analysis:
functional domain analysis is carried out on the German cockroach Grh gene by using an online gene functional domain analysis website Pfam (https:// Pfam. xfam. org/ncbiseq/PF02008), and as a result, as shown in figure 1, the gene is found to contain a CP2 transcription factor core element and can play a role in DNA combination.
And (II) verifying the interference effect of dsRNA on Grh gene:
the german cockroach was anesthetized and dissected 48h after the injection of the primary dsRNA, the abdominal epidermis was dissected out and RNA was extracted, the adipose body was treated with RN 28-easysispin Plus tissue/cell RNA rapid extraction kit, and the procedure was performed according to the kit instructions. The RNA concentration was measured by Nanodrop One, and then 2. mu.g of RNA was measured and subjected to reverse transcription to obtain cDNA. The design of qPCR primers was performed using premier 5 primer design software, the designed primers were CTTACGGTGGATCTGCCTT (SEQ ID No.8) and ATTGTGGTCTGCTCTCTTGG (SEQ ID No.9), and the results of the quantitative analysis were shown in FIG. 2 to detect the target gene interference effect. As can be seen from fig. 2, dsRNA treatment can significantly interfere with the expression of the target gene Grh.
(III) observing and counting the molting of the German cockroach:
comparing with a control group (dsCK injected with any endogenous gene of the German cockroach, the ecdysis similarities and exclusions of the German cockroach of different treatment groups are observed and counted. The experimental results are shown in fig. 3 and 4, wherein fig. 3 is a morphology map control of 5-year (N5) and 6-year (N6) german cockroaches, and it can be seen from fig. 3 that the german cockroaches of the injection control group can normally molt (Ecydysis normal) and smoothly enter the next age; as can be seen from fig. 4, in the figure, "molting disorder (Ecydysis barrier)" means that german cockroach cannot normally molt and die, and "epidermal abnormal development (epidermia abnormal)" means that german cockroach has a defect of new Epidermis after molting, so that most german cockroaches in the dsGrh gene interference group have molting disorder and die, a small proportion of them can successfully molt, and further the purpose of preventing and controlling cockroaches can be achieved.
The dsCK targeting nucleotide sequence is shown as SEQ ID No.10, and the sequence is as follows:
ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAG。
(IV) anatomically observing the influence of interference Grh gene on the epidermal development of the Blattella germanica:
the results of the anatomical analysis of the experimental treatment group and the control group are shown in fig. 5, and it can be seen from fig. 5 that dsRNA injection affects epidermal development of german cockroach, epidermal structure is significantly changed, epidermal cell layer cannot normally develop, and the generation of new epidermis is hindered. dsGrh appearing in this example represents dsRNA synthesized in the present invention targeting the Grh gene.
In conclusion, the targeted silencing of the Grh gene by the RNA interference technology can effectively influence the expression of the gene Grh, further cause the epidermal growth obstacle of the cockroach, cause the moulting process and the epidermal growth process to be abnormal, and further cause the death of the cockroach.
The above description is only an embodiment of the present invention, and not intended to limit the scope of the present invention, and all equivalent changes made by using the contents of the present specification and the drawings, or applied directly or indirectly to the related technical fields, are included in the scope of the present invention.
Sequence listing
<110> extensive Meiyuan research and development center of China warrior insect developmental biology and application technology key laboratory in Meizhou city
South China Normal University
<120> Grh gene related to epidermal development of German cockroach, dsRNA of gene, preparation method and application thereof
<160> 10
<170> SIPOSequenceListing 1.0
<210> 1
<211> 2640
<212> DNA
<213> German cockroach (Blattella germanica)
<400> 1
atggctgata tgccgccgtc ggaaggcggg ggcggcggag aggatggggc ttggaggacg 60
gcagcatatt acagcaacga acaccccctg acggcggcca ctgcagcaat gctcaacatc 120
agcggcgctg gcgtcgaaga ccaaacccaa tccatgagct taatctacga gtattacaaa 180
cttccacaac tgccggccac tgtcaccgat aaggacaaac tcgaaatatg gccgacgaca 240
tcctctgcga gtggcgctcc cctgctgacg tcacaagtga aagcgaccaa tggacttggc 300
tctggggcgg gacacgactt gatcgctcaa cctcctgcgt cgtcttcggc cctcagcccc 360
tcctcaccgg tcgtagcgac ggcagccgag ctccaaggcc tgtttctgca ccaccaacaa 420
caacagcaac aacaacaaca actgcaccat cctcatttgc accctcaaca atttatcgta 480
aagcgcgaac cggaagatct gagcagacac aaggcttccg ggtcgccgcc tctactggac 540
ggcgggacaa caggtagcat catcatcagt aataagtcgg gcagtgcgcc taggcataag 600
ttggtgctcg tgtctgctgc taatggaggt tctgcgggta atctcgtggt ggatgtggtg 660
aataacaaca gcactggtat aaaggaagaa ctgccgtcgc accaccgtgg gctcaactcg 720
ccgcagcacg gcagtcgctc tatcaacgga acgccctctt cgacgtcttc tctgcttgcc 780
gcagacggag gcacgactgg tggttccatc gaactcataa cagcggacgg cctcaagccc 840
ccgatgtctt acagcacgca aatcttcgct caacaccatg gcgggagtgg gacaccctcg 900
cctatacctt actccgacca cgtggcgcaa tacacgacga cggccgtgtc tcagggtggc 960
accggctatg taacaacatc cgcgacgggc aacatccgcg ccgcgacgtc tgccgccttc 1020
ataacggacc aatactacag ggattacttc cctgtgacag gcacttccgc agagcaagga 1080
tacacaacga cgcaagttcg ccagcaaatt ccttcctatg cggacagccc cgagggcggc 1140
gggggtggtg gaggtggcac gtccagtacg actacggcgt cgttaatgga acgatatgtt 1200
cgaagcaccg gtaacgtgta ccacaataat aaaagtgtag tgtctgcggc aacagctgct 1260
ggacttacgg tggatctgcc ttcgccggat agtggcatcg gagcagaagc catcacacca 1320
agagagcaga ccacaatacc tcagcaattc gactatggcg gccccgaaat gtgccagcaa 1380
ccgctactca ccgacccagc gctggtgacg cagagggtag cggcgggcca atctcctggt 1440
caaggaagca ctgggggcag gtcgcggcca tggcacgatt tcggcagaca gaacgacgca 1500
gacaaaattc agatacctaa aatatactcg caatatgggt tcaagtatca cctagagaca 1560
ccaatctcaa cgagtcagag gcgagaggac gacaggatta catatatcaa caagggccaa 1620
ttttatggca tcaccctcga gtaccttccc gatccggaca aacctctcaa gagtcaaaca 1680
gtaaagagcg tcgtaatgct catgttccga gaggagaaaa gtccagagga cgaaatcaaa 1740
gcttggcaat tctggcatgg gaggcaacat agtgtaaaac aaaggatatt ggacgcagat 1800
acgaaaaaca gcgttggttt ggttggctgc attgaagaag ttgcgcacaa cgctatcgcg 1860
gtctactgga atcctctaga cagtacagca aagataaacg tagcagtcca atgtctcagc 1920
acggacttca gcagtcagaa gggcgtcaaa ggattgcctc ttcacctcca aatagacacg 1980
tacgaagatc caagggatac cacaattttc catagagggt actgtcaaat caaagtcttc 2040
tgtgacaagg gtgcagagag aaagactaga gatgaagaaa ggcgagctgc taaacgcaaa 2100
atgacagcca ccggtcgtaa gaagatggat gaattgtacc atcctgcaac ggaaaggtcc 2160
gaattctatg caatgagtga cctcgcaaaa ccacctgtct tgttcacccc agcggaggac 2220
atagacaagt taacatcaat ggaacttcaa gggttctaca gtcatgagac agatagctca 2280
agcctgtcga atggggaggc aagttctggg tctcagcatg ggcttgggaa gcagggatcg 2340
cccttcctcc tgcattcgag caaaccgagc accacgccga cactcaagtt ccacaaccat 2400
tttcccccgg atacacctgg tgataagaaa gatggcataa ttgatagtgc aaacctaaca 2460
acagatggca ctgtcttctc aagtccgcca attaagaggg ccaagatgat ggcagctcca 2520
tcattgaatg aacgagtgat gttatacgtt cgtcaggact cggacgatgt ttacacaccc 2580
ctgcatgttg tacctcccac aacacagggg ctactcaatg cggattatag ccaaaattga 2640
<210> 2
<211> 500
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
uuggugcucg ugucugcugc uaauggaggu ucugcgggua aucucguggu ggauguggug 60
aauaacaaca gcacugguau aaaggaagaa cugccgucgc accaccgugg gcucaacucg 120
ccgcagcacg gcagucgcuc uaucaacgga acgcccucuu cgacgucuuc ucugcuugcc 180
gcagacggag gcacgacugg ugguuccauc gaacucauaa cagcggacgg ccucaagccc 240
ccgaugucuu acagcacgca aaucuucgcu caacaccaug gcgggagugg gacacccucg 300
ccuauaccuu acuccgacca cguggcgcaa uacacgacga cggccguguc ucaggguggc 360
accggcuaug uaacaacauc cgcgacgggc aacauccgcg ccgcgacguc ugccgccuuc 420
auaacggacc aauacuacag ggauuacuuc ccugugacag gcacuuccgc agagcaagga 480
uacacaacga cgcaaguucg 500
<210> 3
<211> 500
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
ttggtgctcg tgtctgctgc taatggaggt tctgcgggta atctcgtggt ggatgtggtg 60
aataacaaca gcactggtat aaaggaagaa ctgccgtcgc accaccgtgg gctcaactcg 120
ccgcagcacg gcagtcgctc tatcaacgga acgccctctt cgacgtcttc tctgcttgcc 180
gcagacggag gcacgactgg tggttccatc gaactcataa cagcggacgg cctcaagccc 240
ccgatgtctt acagcacgca aatcttcgct caacaccatg gcgggagtgg gacaccctcg 300
cctatacctt actccgacca cgtggcgcaa tacacgacga cggccgtgtc tcagggtggc 360
accggctatg taacaacatc cgcgacgggc aacatccgcg ccgcgacgtc tgccgccttc 420
ataacggacc aatactacag ggattacttc cctgtgacag gcacttccgc agagcaagga 480
tacacaacga cgcaagttcg 500
<210> 4
<211> 30
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
ttggtgctcg tgtctgctgc taatggaggt 30
<210> 5
<211> 30
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
cgaacttgcg tcgttgtgta tccttgctct 30
<210> 6
<211> 45
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
ggatcctaat acgactcact ataggttggt gctcgtgtct gctgc 45
<210> 7
<211> 45
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
ggatcctaat acgactcact ataggcgaac ttgcgtcgtt gtgta 45
<210> 8
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
cttacggtgg atctgcctt 19
<210> 9
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 9
attgtggtct gctctcttgg 20
<210> 10
<211> 717
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 10
atggtgagca agggcgagga gctgttcacc ggggtggtgc ccatcctggt cgagctggac 60
ggcgacgtaa acggccacaa gttcagcgtg tccggcgagg gcgagggcga tgccacctac 120
ggcaagctga ccctgaagtt catctgcacc accggcaagc tgcccgtgcc ctggcccacc 180
ctcgtgacca ccctgaccta cggcgtgcag tgcttcagcc gctaccccga ccacatgaag 240
cagcacgact tcttcaagtc cgccatgccc gaaggctacg tccaggagcg caccatcttc 300
ttcaaggacg acggcaacta caagacccgc gccgaggtga agttcgaggg cgacaccctg 360
gtgaaccgca tcgagctgaa gggcatcgac ttcaaggagg acggcaacat cctggggcac 420
aagctggagt acaactacaa cagccacaac gtctatatca tggccgacaa gcagaagaac 480
ggcatcaagg tgaacttcaa gatccgccac aacatcgagg acggcagcgt gcagctcgcc 540
gaccactacc agcagaacac ccccatcggc gacggccccg tgctgctgcc cgacaaccac 600
tacctgagca cccagtccgc cctgagcaaa gaccccaacg agaagcgcga tcacatggtc 660
ctgctggagt tcgtgaccgc cgccgggatc actctcggca tggacgagct gtacaag 717

Claims (6)

1. A Grh gene related to the epidermal development of Blattella germanica is characterized in that the nucleotide sequence of the Grh gene is shown in SEQ ID No. 1.
2. The dsRNA for interfering the Grh gene related to the epidermal development of the German cockroach is characterized in that the dsRNA is double-stranded RNA consisting of a nucleotide sequence shown in SEQ ID No.2 and a nucleotide sequence which is reversely complementary with the nucleotide sequence shown in SEQ ID No. 2.
3. The method of making the dsRNA of claim 2, comprising the steps of: the Grh gene segment shown as SEQ ID No.3 is cloned into a vector as a template, a primer is designed, and the dsRNA is obtained by in vitro transcription synthesis after PCR amplification.
4. The method according to claim 3, wherein the primer comprises an upstream primer and a downstream primer, wherein the nucleotide sequence of the upstream primer is shown as SEQ ID No.6, and the nucleotide sequence of the downstream primer is shown as SEQ ID No. 7.
5. The use of the dsRNA of claim 2 for the preparation of a product for the control of German cockroach or affecting the epidermal development of German cockroach.
6. The use of the dsRNA of claim 2 for controlling German cockroach.
CN201910977154.9A 2019-10-15 2019-10-15 Grh gene related to epidermal development of German cockroach, dsRNA of gene, preparation method and application thereof Active CN110699359B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201910977154.9A CN110699359B (en) 2019-10-15 2019-10-15 Grh gene related to epidermal development of German cockroach, dsRNA of gene, preparation method and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201910977154.9A CN110699359B (en) 2019-10-15 2019-10-15 Grh gene related to epidermal development of German cockroach, dsRNA of gene, preparation method and application thereof

Publications (2)

Publication Number Publication Date
CN110699359A CN110699359A (en) 2020-01-17
CN110699359B true CN110699359B (en) 2020-11-10

Family

ID=69198781

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201910977154.9A Active CN110699359B (en) 2019-10-15 2019-10-15 Grh gene related to epidermal development of German cockroach, dsRNA of gene, preparation method and application thereof

Country Status (1)

Country Link
CN (1) CN110699359B (en)

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP5832062B2 (en) * 2005-05-31 2015-12-16 デフヘン・ナムローゼ・フェンノートシャップＤＥＶＧＥＮ ｎｖ RNAi for insect and spider control
MX344856B (en) * 2006-01-12 2017-01-10 Devgen Nv Dsrna as insect control agent.
CN108893472B (en) * 2018-07-16 2019-07-12 华南师范大学 A kind of dsRNA and its application on prevention and treatment Groton bug
CN109207601B (en) * 2018-08-06 2019-08-27 华南师范大学 American cockroach amputation regenerates correlation Hedgehog signal path gene and its application of dsRNA

Also Published As

Publication number Publication date
CN110699359A (en) 2020-01-17

Similar Documents

Publication Publication Date Title
CN108893472B (en) A kind of dsRNA and its application on prevention and treatment Groton bug
CN103571844B (en) DsRNA and the application be combined in control aphid damage thereof
CN103088024B (en) Application of two dsRNAs (double-stranded ribonucleic acids) and combination thereof in controlling aphid damage
Momose et al. Diving into marine genomics with CRISPR/Cas9 systems
He et al. Identification of microRNAs involved in cold adaptation of Litopenaeus vannamei by high-throughput sequencing
CN110862990B (en) Cad96ca gene related to epidermal development of German cockroach, dsRNA of gene, preparation method and application thereof
Ge et al. Mutation in myostatin 3′ UTR promotes C2C12 myoblast proliferation and differentiation by blocking the translation of MSTN
JPWO2018030208A1 (en) Method for producing gene knockin cell
Bayat et al. The CRISPR growth spurt: from bench to clinic on versatile small RNAs
EP4314277A1 (en) Compositions and methods for producing circular polyribonucleotides
Kato et al. Low-temperature incubation improves both knock-in and knock-down efficiencies by the CRISPR/Cas9 system in Xenopus laevis as revealed by quantitative analysis
CN112695033B (en) siRNA designed based on periplaneta americana male periglandular reproduction related gene SP28 and preparation method and application thereof
CN114853861A (en) Periplaneta americana PRP protein expression inhibitor and encoding gene and application thereof
CN110699359B (en) Grh gene related to epidermal development of German cockroach, dsRNA of gene, preparation method and application thereof
Bharati et al. Genome editing in animals: an overview
JP2009263362A (en) Insecticide using double stranded rna
CN112458087A (en) dsRNA designed based on periplaneta americana HDAC1 gene, preparation method thereof, coding gene and application thereof
CN112662689B (en) Migratory locust Rab11A gene and application of dsRNA thereof in migratory locust control
CN110106179B (en) dsRNA of locusta migratoria fatty acid synthetase gene LmFAS3 as well as preparation method and application thereof
CN116904461B (en) Application of zfh-2 gene in limb regeneration and pest control
CN110106177B (en) dsRNA of locusta migratoria fatty acid elongase gene LmElo as well as preparation method and application thereof
CN116535480B (en) FUBP and application thereof
CN117143870B (en) Application of bowl gene in limb regeneration and pest control
CN112725345B (en) dsRNA designed based on periplaneta americana sex pheromone receptor gene OR5M, coding gene, preparation method and application thereof
CN115011577B (en) Insect m 6 A-methylation transferase METTL3 gene fragment, dsRNA thereof and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant