CN116970637A - Application of TGACG6 transcription factor in regulation and control of thousand seed weight of rape seeds - Google Patents

Abstract

The application discloses an application of a TGACG6 transcription factor in regulating thousand seed weight of rape seeds, wherein the nucleotide sequence of the TGACG6 transcription factor is shown as SEQ ID NO. 2 or other sequences which have more than 80% homology with the sequence shown as SEQ ID NO. 2 and code the same functional protein. The CRISPR/Cas9 gene editing vector of the TGACG6 transcription factor is transformed into a rape genome by using an agrobacterium-mediated genetic transformation method, a rape variety with a deleted gene function is obtained, thousand seed weight of a mutant material is measured, and as a result, the accumulation of the thousand seed weight of the rape is negatively regulated by the BnaTGA6 gene, and the thousand seed weight of the mutant material is obviously increased compared with that of a wild type. The application has very important significance in rape breeding.

Description

Application of TGACG6 transcription factor in regulation and control of thousand seed weight of rape seeds

Technical Field

The application belongs to the field of genetic engineering and biotechnology, and particularly relates to a TGACG6 transcription factor BnaTGA6 for regulating thousand seed weight of rape and application thereof.

Background

During the evolution of the last hundred million years, plants evolved the ability to synthesize various metabolites that play an important role in plant growth, propagation and adaptation to the environment. There are about 10 to 100 tens of thousands of metabolites in the plant kingdom, indicating that plants have a rich metabolic diversity. In recent years, more and more researchers have utilized whole genome association analysis (Genome Wide Association Studies, GWAS) to resolve metabolome diversity, which in combination with metabolome is called metabolite whole genome association analysis (Metabolite Genome Wide Association Studies, GWAS) mGWAS, which is capable of better resolving genetic variation behind metabolic diversity. Cabbage type rape (Brassica napus l.) is one of the most important oil crops in the world, with rapeseed oil accounting for about 50% of the vegetable oil supply in our country. Oil content and thousand kernel weight are important yield traits of rape, and the way and mechanism by which metabolites regulate the oil content and thousand kernel weight in rape seeds are not clear.

Important pathways affecting seed grain weight: seed size in higher plants depends on the coordinated growth of embryo, endosperm and maternal tissues, and in recent years, many signal pathways controlling thousand kernel weight have been studied. In the aspect of ubiquitin-proteasome pathway, ubiquitin receptor DA1 limits proliferation of cells in the periwinkle so as to influence seed size, ubiquitin receptor DA1 has negative regulation effect on seed size, wang et al overexpress AtDA1 with function deficiency in brassica napus, so that the expression quantity of BnDA1 in brassica napus is down-regulated, and the thousand seed weight of seeds is increased by 21.23% under field conditions (Wang et al 2017). The G PROTEIN-coupled pathway transmits signals to effectors through membrane-bound receptors and heterotrimeric G PROTEINs consisting of gα, gβ and gγ subunits, mutations in the arabidopsis GPA1 and AGB1 genes lead to defects in plant growth and development, and in G PROTEIN signaling, arabidopsis G PROTEIN γ3 (AGG 3) is able to prolong the cell proliferation phase, thereby affecting seed size (Chakravorty et al 2011,Li et al 2012). MITOGEN-ACTIVATED PROTEIN KINASE (MAPKs) plays an important role in mediating plant multiple developmental and defense signals (Xu and Zhang 2015), for MAPK signals MKP1 and MITOGEN-ACTIVATED PROTEIN KINASE KINASE (MKK 5) affect seed size by controlling morphological occurrence of the seed coat (Zhang et al 2017,Xu et al 2018). Plant hormones such as Brassinosteroids (BR) and auxins play an important role in rice grain development through biosynthesis, homeostatic pathways, signaling, BR receptor D61 upregulating rice seed size by affecting downstream transcription factors (Che et al 2015). DNA methylation, which generally refers to the covalent addition of methyl groups to cytosine at 5 positions, is a heritable epigenetic process that regulates the growth and development of animals and plants, and in plants, is involved in regulating many epigenetic phenomena including transcriptional silencing, defense against pathogens, regulation of imprinting, and silencing of genes involved in controlling flowering time, flower organogenesis, fertilization, and leaf morphology (Finnegan et al 1996,Kakutani et al 1996).

Research progress in TGA 6: the TGACG SEQUENCE-SPECIFIC BINDING PROTEIN (TGA) transcription factor belongs to the plant basic leucine zipper protein (bZIP) transcription factor superfamily, with 10 TGA family members in Arabidopsis. Among these, seven TGAs are involved in defense, including branch I members TGA1 and TGA4, branch II members TGA2, TGA5 and TGA6, and branch III members TGA3 and TGA7.TGA6 is the transcription factor of the second branch of the arabidopsis TGA family (Gatz 2013). TGA2, TGA5 and TGA6 interact with NONEXPRESSOR OF PATHOGENESISRELATED (NPR 1) in a yeast two-hybrid assay, TGA2 and TGA6 have a greater affinity for NPR1 than TGA5 does for NPR1, TGA2/5/6 can bind directly to the PATHGENESIS-RELATED1 (PR-1) promoter sequence, and the authors demonstrate that NPR1 can regulate PR-1 gene expression by interacting with the TGA6 transcription factor (Zhang et al 1999). There is a functional redundancy in the three genes TGA2, TGA5 and TGA6. the TGA6-1 TGA2-1 TGA5-1 triple mutant had decreased tolerance to high concentrations of Salicylic Acid (SA) under normal growth conditions and PR-1 had higher expression levels in the mutant, which indicated that TGA family transcription factors had a negative effect on plant SA tolerance and PR-1 gene expression (Zhang et al 2003). TGA6 transcription factors suppress immune responses through physical interactions in the nucleus, TGA directly activates RBOHD and RBOHF expression, ripAB (type III effector protein), a bacterial protein known to cause damage to host organisms, by interfering with the recruitment of RNA polymerase II to suppress TGA activity and block SA signaling, thereby affecting plant resistance to bacterial pathogens (Qi et al 2022). TGA6 has important roles in maintaining redox balance in plants, regulating antioxidant defense mechanisms of plants, participating in nutrient metabolism of plants, and regulating reproductive development of plants.

The application clones a TGACG6 transcription factor BnaTGA6, creates a BnaTGA6 mutant by using CRISPR/Cas9 technology, and the thousand seed weight of the obtained rape mutant is obviously increased. The result of the inventor shows that the BnaTGA6 gene plays an important role in regulating thousand seed weight of rape seeds, and has a considerable application prospect in creating thousand seed re-germplasm of rape.

Disclosure of Invention

The application aims to provide an application of a rape TGACG6 transcription factor BnaTGA6 in regulating and controlling thousand seed weight of rape, and also provides a method for improving thousand seed weight of rape seeds.

Obtaining complete metabolic group data of mature seeds of the brassica napus through measuring 382 parts of core germplasm metabolic groups; constructing a comprehensive agronomic trait (thousand grain weight) ternary relationship network (metabolite-QTL-gene) by using genome and developing seed transcriptome data existing in the laboratory through association analysis (GWAS and TWAS); through the combination of metabolic markers and a plurality of groups of analytical data, novel genes related to thousand seed weight of rape seeds are mined and cloned. A gene BnaTGA6 which is obviously related to thousand-grain-weight related metabolites is found in the whole genome related analysis and the whole transcriptome related analysis of the metabolic group of the brassica napus seeds.

The protein encoded by the gene belongs to TGA6 transcription factors, and exists on chromosomes of brassica napus (Westar) A01 (BnaA 01G0282200 WE), A03 (BnaA 03G0338500 WE), A05 (BnaA 05G0375400 WE), C01 (BnaC 01G0389200 WE), C03 (BnaC 03G0325700 WE) and C05 (BnaC 05G0455000 WE), the nucleotide sequences of the genes are respectively shown as sequences SEQ ID NO 1,SEQ ID NO:2,SEQ ID NO:3,SEQ ID NO:4,SEQ ID NO:5 and SEQ ID NO 6, and BnaTGA6 consists of 996-1005bp, and the homology is above 80%. The protein sequence coded by the gene is shown as a sequence table SEQ ID NO. 7,SEQ ID NO:8,SEQ ID NO:9,SEQ ID NO:10,SEQ ID NO:11 and a sequence table SEQ ID NO. 12, and 331-334 amino acids are coded.

When the mutant of the gene is obtained, a CRISPR/Cas9 gene editing vector of a TGACG6 transcription factor BnaTGA6 coding gene is transformed into a genome of rape by using an agrobacterium-mediated genetic transformation method, and the rape variety with the gene BnaTGA6 deleted in function is obtained by using a CRISPR/Cas9 gene editing technology.

Rape yield is critical to global vegetable oil supply, and thousand seed weight belongs to one of three factors of rape yield. Comprehensive research on secondary metabolome and multiple groups of chemical analysis such as genome, transcriptome, agronomic characters and the like have great promotion effect on the research on brassica napus. A large number of new genes participating in thousand seed weight increase can be mined through multiunit analysis, and the novel genes have an important effect on the subsequent genetic improvement of the thousand seed weight of the rape. The genetic resource created by the application has very important significance in rape high-yield breeding.

Drawings

Fig. 1: target site editing of the BnaTGA6 mutant. sgRNA1 is located in the third exon region of gene BnaTGA6, sgRNA2 is located in the fourth exon region of gene BnaTGA6, CR1 and CR2 are homozygous mutants of BnaTGA6 that were edited.

Fig. 2: the gene BnaTGA6 is identified in the phenotype of rape. CR1 and CR2 are homozygous mutants edited by BnaTGA6, with 3 different individuals per line, representing P <0.01 in Student's t test.

Detailed Description

The present application will be described in further detail with reference to specific examples. It is to be understood that these examples are illustrative of the present application and are not intended to limit the scope of the present application. The experimental methods not specified in detail in the following examples are generally followed by conventional methods or by the instructions "molecular cloning: the methods described in the laboratory guidelines (New York: cold Spring Harbor Laboratory, 1989) or according to the methods suggested in the operating manual provided by the manufacturer.

Plant metabolites can affect the growth and development of plants themselves and environmental adaptation, and plant metabolites play an important role in maintaining human food safety. Rape is the third largest oil crop in the world, rape seed oil accounts for about 50% of the vegetable oil supply in China, thousand seed weight is an important agronomic trait of rape, and increasing thousand seed weight is an important breeding goal of rape. The experimental object of the research is a natural population of 382 inbred cabbage type rape, the genetic basis of thousand seed weight of the rape seeds is comprehensively analyzed from the metabolism angle by multi-group chemical combination analysis based on genome, transcriptome and metabolome data, and a batch of candidate genes affecting thousand seed weight are mined. Experiments prove that the candidate gene BnaA03.TGA6 specifically affects the thousand seed weight function, and the main contents are as follows:

mature seeds are selected as research materials in the research, 2173 metabolites are detected in total by using a liquid chromatography-triple quaternary lever combination instrument and a method of widely targeting metabolite analysis, 137 metabolites which are obviously related to thousand-grain weight are identified through analysis, and the metabolites are used as metabolic markers of thousand-grain weight. The marker metabolites were used to perform a genome-wide association analysis (Metabolite Genome-Wide Association Study, mGWAS) to target 734 metabolite quantitative trait loci (Metabolite Quantitative Trait Loci, mQTL) of thousand-grain-related metabolites. At the same time, a metabolite full transcriptome association analysis (Metabolite Transcriptome-Wide Association Study, mTMAS) was performed in combination with population transcriptome data of 40 day post-flowering seed development, correlating to 9077 genes for thousand-grain weight related metabolites. And analyzing the metabolite related gene expression network to obtain 19 gene expression modules of the metabolite related to thousand-grain weight. And combining weighted correlation network analysis, constructing a ternary relation network comprising metabolites, mQTL and modular genes for thousand kernel reconstruction, and mining 24 candidate genes for regulating and controlling thousand kernel weight.

Based on the results of the multi-set chemical combination analysis, a co-localized mQTL hotspot mQTL555 with 11 thousand-grain-weight related metabolites was found on the A03 chromosome. One gene, bnaa03.tga6, was screened in mQTL555 for a significant association with mTWAS of 3 metabolites. Further analysis found that bnaa03.tga6 was significantly associated with 10 genes known to affect grain weight. Gene sequence analysis shows that bnaa03.tga6 may bind to the promoter regions of these 10 genes, regulating their expression and thus affecting thousand seed weight of rape seeds. Mutant materials of BnaA03.TGA6 are created by CRISPR/Cas9 technology, and the result shows that the thousand grain weight of the BnaA03.TGA6 mutant materials is improved by 27.4% -30% compared with that of wild seeds. And mGWAS, eGWAS, mTWAS and the content of the seed thousand kernel weight positive correlation heavy metabolic markers (S21-4360, S21-0694 and S21-1527) positioned by the coexpression network are obviously increased in the mutant seeds. These results indicate that BnaA03.TGA6 has the effect of regulating thousand seed weight of brassica napus seeds.

EXAMPLE 1 creation of canola BnaA03.TGA6 mutant Material

Strains used in this study: coli Escherichia coli (dh5α) was used for gene cloning, vector construction and plasmid extraction; agrobacterium GV3101 is used for genetic transformation of canola; subcellular localization observations the vector used was pMDC83; the system for editing rape genes is a Chinese agricultural university Chen Jijun CRISPR/Cas9 gene editing system, the sgRNA framework template is pCBC-DT1T2 plasmid, and the Cas9 protein expression and genetic transformation vector is pKSE-401. Except that the system used for editing rape genes is derived from the China agricultural university Chen Jijun laboratory, other vectors are all derived from the laboratory.

Construction of BnaTGA6-CRISPR vector

The sgRNA-Cas9 system of the university of agricultural university, team Chen Jijun, was used to create the canola BnaTGA6 mutant. The experimental operation steps are as follows:

(1) Logging in to a websitehttp://www.genome.arizona.edu/crispr/CRISPRsearch.htmlScreening target sgRNA1 according to the target position and the score: AGGCTTGCTCAAAATCGAG, located in the third exon region of the gene BnaTGA6 and sgRNA2: TAGGCGTATGTTCAGCAGC in the fourth exon region of the gene BnaTGA6.

(2) Designing primers

DT1-BsF:ATATATGGTCTCGATTGAGGCTTGCTCAAAATCGAGGTT

DT1-F0:TGAGGCTTGCTCAAAATCGAGGTTTTAGAGCTAGAAATAGC

DT2-R0:AACGCTGCTGAACATACGCCTACAATCTCTTAGTCGACTCTAC

DT2-BsR:ATTATTGGTCTCGAAACGCTGCTGAACATACGCCTACAA

(3) And (3) PCR amplification: four-primer PCR amplification was performed using 100-fold diluted pCBC-DT1T2 as a template. DT1-BsF and DT2-BsR are normal primer concentrations; DT1-F0 and DT2-R0 were diluted 20-fold. The amplification system is as follows:

PCR amplification procedure: total denaturation at 98℃for 1min; 15sec for denaturation at 98 ℃, 25sec for annealing at 56 ℃, 25sec for extension at 72 ℃,34 cycles; total extension at 72℃for 5min.

(4) The PCR product was purified and recovered, and the following restriction-ligation system (restriction-ligation) was established:

reaction conditions: 5hours at 37 ℃,5 minutes at 50 ℃,10 minutes at 80 ℃.

(5) Transformation of E.coli DH 5. Alpha: mu.L of plasmid containing the target cloning fragment is taken, competent E.coli is transformed, kan plate screening, positive clone PCR identification and sequencing are carried out. The correct sequencing vector is the CRISPR vector of BnaTGA6.

2. Agrobacterium-mediated genetic transformation

(1) The recombinant plasmid vector with correct construction is introduced into an agrobacterium strain GV3101, and positive monoclonal is selected and stored in a refrigerator at the temperature of minus 80 ℃. The method for introducing the medicine comprises the following steps:

a. cleaning an electric rotating cup: washing with pure water, washing with ultrapure water, pouring, washing with absolute ethyl alcohol (blowing with 1ml gun head), pouring absolute ethyl alcohol, and air drying in an ultra clean bench;

b. taking agrobacteria competent GV3101 20 μl;

c. taking 0.8 mu l of recombinant plasmid with correct construction, adding the recombinant plasmid into 20 mu l of competence, gently sucking and beating the recombinant plasmid, and uniformly mixing the recombinant plasmid to avoid generating bubbles;

d. placing the electric rotating cup with washed and dried drying in ice for precooling, and then driving the mixed liquid into the cup by the wall of the cup;

e. adjusting the electric converter to 1800V;

f. taking the electric rotating cup out of the ice, and wiping the outer wall of the electric rotating cup with water absorbing paper;

g. placing the electric rotating cup into an instrument, continuously pressing two push keys, and hearing a sound of a drop after a few seconds is successful;

h. after the electric shock is successful, 400 mu l of antibiotic-free LB is added into the electric rotating cup, and the electric rotating cup is transferred into a sterile centrifuge tube after being sucked for a few days;

i.28 ℃ for about 2 hours, 100 mul of the mixture is coated on the double antibody, the double antibody is sealed by a sealing film, the double antibody is inverted and cultured in a 28 ℃ incubator for 2 days, and spot picking detection is carried out.

(2) Agrobacterium colony detection

Colony is selected and cultured in double-antibody LB for 2 hours at 28 ℃, a proper amount of bacterial liquid is taken for PCR detection, and positive agrobacterium bacterial liquid is preserved.

(3) Genetic transformation of rape

The receptor for rape transformation is brassica napus Westar, and the specific operation flow is described in the reference literature: an efficient Agrobacterium-mediated transformation method using hypocotyl as explants for Brassica napus (1) seed of Brassica napus line 'Westar' is sown in a culture box of MS by sterilization and disinfection, and dark culture is carried out in a culture chamber; (2) culturing the constructed agrobacterium tumefaciens bacterial liquid expressing the CRISPR/Cas9 gene editing vector at 28 ℃ overnight in a shaking table, collecting bacterial liquid, and infecting hypocotyls; (3) the obtained transformed material was identified by PCR and planted in the experimental field.

(2) Identification of CRISPR transformed individuals

And sequencing the obtained rape CRISPR transformed single plant to screen rape mutants. First, the primers Cas9-570-F (5'-AGACCGTGAAGGTTGTGGAC-3') and Cas9-570-R (5'-TAGTGATCTGCCGTGTCTCG-3') are used for identifying Cas9 protein, and specific amplification and sequencing identification of target genes are carried out on Cas9 protein positive single plants. The specific amplification method of the target gene comprises the following steps: bnaA01G0282200WE was specifically amplified with primers TGA6-A01-F (5'-TCCTTTTTCTTATTATGTTCCATAGACTCTGC-3') and TGA6-A01-R (5'-TTGAGTCAACTTCAATCGGCTGTTC-3'), respectively; bnaA03G0338500WE was specifically amplified with primers TGA6-A03-F (5'-GCATATTGCCTAATCTGTTTTGTTTCCTTTTT-3') and TGA6-A03-R (5'-GAAAGAAAATTTAAACCTGTTGCCTCGCTC-3'), respectively; primers TGA6-A05-F (5'-ATTCATCTCTGCCGATCTATAACTATCTTCTT-3') and TGA6-A05-R (5'-CTCTTTGCAGCTCTTGCTCAAGTT-3') specifically amplify BnaA05G0375400WE; primers TGA6-C01-F (5'-CATAACGTAGTTTTGTTTCCTTTTTGATCCAT-3') and TGA6-C01-R (5'-ATAAGAAAGAAAAGTGTAAACCTGTTGCCTTG-3') specifically amplify BnaC01G0389200WE; primers TGA6-C03-F (5'-TTTTTATTTTGATCCGTAGACCGTTCG-3') and TGA6-C03-R (5'-GTCAGCTTCAACCGGCTGTTC-3') specifically amplify BnaC03G0325700WE; primers TGA6-C05-F (5'-TTACTCATCTTTGCCGATCAATAACTATCTTC-3') and TGA6-C05-R (5'-TTGCTCCAGTTGAGTCAGCTTCAATC-3') specifically amplify BnaC05G0455000WE as follows:

the PCR system is as follows: easy taq polymerase 0.15. Mu.L, 10mM dNTP 0.4. Mu.L, 10 Xbuffer 2. Mu.L, DNA template 2. Mu.L, F primer 2. Mu.L, R primer 2. Mu.L, ddH ₂ O to 20. Mu.L. PCR conditions: total denaturation at 94℃for 5min; denaturation at 94℃for 30sec, annealing at 55℃for 30sec, extension at 72℃for 30sec,32 circulations; total extension at 72℃for 5min.

Sequencing the amplified target fragment by PCR product, and using DSDecode on-line website to obtain sequencing resulthttp:// skl.scau.edu.cn/dsdecode/)Analyzing the editing condition of the target site. Sequencing results showed that multiple mutant independent lines CR1 and CR2 were obtained with BnaTGA6 edited (fig. 1).

Example 2 functional verification and bioinformatic analysis of mutant materials

1. Determination of thousand seed weight of rape seed

With reference to GB 5519-85, quality analysis is carried out on rape seeds harvested in the mature period to obtain thousand seed weight data, and a measuring instrument is provided by the national rape engineering technology research center of agricultural university in China.

Thousand kernel weight results showed that the thousand kernel weight of the acceptor background material Westar was 3.10±0.06g, the thousand kernel weights of the mutant materials CR1 and CR2 were 3.96±0.10g and 4.03±0.03g, respectively, and the two mutant thousand kernel weights were significantly increased by about 27.4% and 30% compared to the wild type (fig. 2).

BnatGA6 bioinformatic analysis

The BnaA03.TGA6 gene is subjected to seed full-development expression level analysis (https:// yanglab.hzau.edu.cn/BnIR), the AtTGA6 has 6 homologous genes in brassica napus, which are respectively positioned on A01, A03, A05, C01, C03 and C05 chromosomes, wherein the homologous genes BnaC03.TGA6 have the highest expression level in the seed full-development stage, and the BnaA03.TGA6 has higher expression level in the later stage of the horn development.

Multiple sets of chemical analyses showed that bnaa03.tga6 is in the hot spot region of thousand grain weight related metabolite mGWAS, bnaa03.tga6 may affect the content of multiple metabolites in brassica napus seeds and may affect the thousand grain weight of brassica napus. Metabolome analysis showed that the levels of the three metabolites S21-0694, S21-1527 and S21-4360 were significantly increased in the mutants compared to WT, whereas these metabolites were significantly positively correlated with thousand kernel weight, and therefore the increase in thousand kernel weight of the BnaTGA6 mutant strain was probably due to the increase in the content of these metabolites.

In order to study the potential mechanism of BnaA03.TGA6 for regulating thousand seed weight of rape, the transcription binding motif of BnaA03.TGA6 is predicted, and the prediction result shows that BnaA03.TGA6 has two potential binding sites. Further correlation analysis of the genes of BnaA03.TGA6 in the whole development stage of rape group transcriptome (20 DAF,40 DAF) and ZS11 seeds showed that BnaA03.TGA6 was significantly correlated with BnaA04.MKP1, bnaC04.METI, bnaC05.DA1, bnaA06.SK41 and BnaC08.UBP 15. Correlation analysis of BnaA03.TGA6 in the rape group transcriptome 40DAF found that BnaA03.TGA6 was significantly correlated with BnaA 01.TOP1-alpha, bnaA04.MKP1, bnaC01.TOP1-alpha, bnaA03.MKK5, bnaC04.METI, bnaC05.DA1, bnaA06.SK41 and BnaC08.UBP 15. Correlation analysis of BnaA03.TGA6 in the whole development stage of rape group transcriptome ZS11 seeds found that BnaA03.TGA6 was significantly correlated with BnaA 01.TOP1-alpha, bnaA04.MKP1, bnaC01.TOP1-alpha, bnaA02.AGG3, bnaA03.MKK5 and BnaC 04.EOD3.

In summary, the present study found 10 genes (BnaA02.AGG3, bnaA04.MKP1, bnaA03.MKK5, bnaC05.DA1, bnaC08.UBP15, bnaA06.SK41, bnaC04.EOD3, bnaC04.METI, bnaA01.TOP1-. Alpha., bnaC01. TOP1-. Alpha.) that were significantly associated with BnaA03.TGA6. The promoter regions of these genes all have the binding motif of bnaa03.tga6 and these genes have been shown to be involved in regulating seed weight in other species. These results indicate that BnaA03.TGA6 may be used as a novel transcription factor for regulating thousand seed weight, and combined with transcription factors for regulating seed weight of multiple channels to regulate thousand seed weight of brassica napus.

Claims (5)

1. The nucleotide sequence of the TGACG6 transcription factor is shown as SEQ ID NO. 2 or other sequences which have more than 80 percent of homology with the sequence shown as SEQ ID NO. 2 and code the same functional protein.

2. Use of a protein encoded by the TGACG6 transcription factor of claim 1 for regulating thousand seed weight of canola seeds.

3. Use of a CRISPR/Cas9 gene editing vector of a TGACG6 transcription factor encoding gene as defined in claim 1 for regulating thousand seed weight of canola seeds.

4. Use of recombinant bacteria containing CRISPR/Cas9 gene editing vector of TGACG6 transcription factor encoding gene in claim 1 for regulating thousand seed weight of rape seed.

5. A method for improving thousand seed weight of rape seeds is characterized by comprising the following steps: transforming the CRISPR/Cas9 gene editing vector of the TGACG6 transcription factor encoding gene in claim 1 into the genome of rape by using an agrobacterium-mediated genetic transformation method, and obtaining the rape variety with the TGACG6 transcription factor gene function deleted by using a CRISPR/Cas9 gene editing technology.