CN116855530A

CN116855530A - Application of target gene of corn miR159a in resisting corn chlorosis mottle virus

Info

Publication number: CN116855530A
Application number: CN202311052284.4A
Authority: CN
Inventors: 夏子豪; 杨淼壬; 郝凯强; 王志平; 安梦楠; 吴元华
Original assignee: Shenyang Agricultural University
Current assignee: Shenyang Agricultural University
Priority date: 2023-08-21
Filing date: 2023-08-21
Publication date: 2023-10-10

Abstract

The invention provides application of a target gene of corn miR159a in resisting corn chlorosis mottle virus, and belongs to the technical fields of molecular biology and molecular breeding. In the invention, experiments prove that miR159a targets ZmMYB138 and ZmMYB74 participate in corn antivirus, RT-qPCR and Western blot experimental analysis are utilized, and ZmMYB138 and ZmMYB74 downregulation expression are found to promote the infection of MCMV, zmMYB138 downstream gene ZmCCoAOMT1 downregulation expression also promotes the infection of MCMV, so that ZmMYB138, zmMMYB 74 and ZmCCoAOMT1 genes are shown to be resistance genes of corn chlorosis mottle virus, and ideas are provided for the improvement and genetic breeding of corn varieties for cultivating the corn chlorosis mottle virus and disease-resistant plant germplasm resources.

Description

Application of target gene of corn miR159a in resisting corn chlorosis mottle virus

Technical Field

The invention relates to the technical fields of molecular biology and molecular breeding, in particular to application of a target gene of maize miR159a in resisting maize chlorotic mottle virus.

Background

Corn is an important grain crop, but corn diseases endanger the yield and quality of corn, and virus diseases bring serious losses to the production of corn. Maize chlorotic mottle virus (maize chlorotic mottle virus, MCMV) is a virus of the genus maize chlorotic mottle virus (Machlomovirus) of the family tomato family of short viruses (Tombusviridae). MCMV is very easy to spread and its infestation is very dangerous to corn. Maize plants infected with MCMV, whose leaves develop chlorosis, necrotic symptoms and tassel-like deformities, are complex infected with potyvirus that infects maize to form maize lethal necrosis. At present, no effective medicament is directly used for preventing and treating viral diseases, more antivirus breeding and prevention and treatment of a virus transmission medium are performed, once the virus transmission medium generates drug resistance, the viral diseases are expanded in a large area within a small range and cannot be prevented and treated, and economic losses which are difficult to estimate are caused. The application research of preventing and controlling maize chlorotic mottle virus by using miRNA sequence and gene regulation is rarely reported.

Disclosure of Invention

The invention aims to provide a target sequence of corn miR159a and application of a ZmCCoAOMT1 gene in resisting corn chlorosis mottle virus.

In order to achieve the above object, the present invention provides the following technical solutions:

the invention also provides application of the miR159a target sequence ZmMYB138 or ZmMYB74 gene in regulation and control of maize chlorosis mottle virus resistance.

The invention also provides application of the regulatory gene ZmCCoAOMT1 gene or ZmDnaJ gene which is used for over-expressing ZmMYB138 or ZmMYB74 in improving maize chlorosis mottle resistance.

By adopting the technical scheme, the invention has the following beneficial effects: the nucleotide sequence of the corn miR159a is shown as SEQ ID NO. 1. In the invention, experiments prove that miR159a targets ZmMYB138 and ZmMYB74 participate in corn antiviral, RT-qPCR and Western blot experimental analysis are utilized, the ZmMYB138 and ZmMYB74 downregulation expression is used for promoting the infection of MCMV, the ZmMYB138 and ZmMYB74 genes are resistance genes of maize chlorotic mottle virus, in ZmMYB138 and ZmMYB74 mutants and CMV-VIGS silenced ZmMMYB corn, zmCCoAOMT1 and ZmDnaJ downregulation expression are used for promoting the infection of MCMV by regulating ZmCCoAOMT1 and ZmDnaJ. Provides thinking for improving and inheriting breeding of maize varieties for cultivating maize chlorosis mottle virus and disease-resistant plant germplasm resources.

Drawings

FIG. 1 shows miR159a target gene expression level;

FIG. 2 is a diagram showing PCR detection of loss of an inserted Ds transposon in mutant maize;

FIG. 3 is a graph showing symptomatic exacerbation of MCMV infecting ZmMYB138 and ZmMYB74 mutant maize;

FIG. 4 shows that mutant ZmMYB138 favors MCMV accumulation; a: the expression level of ZmMYB138 in ZmMYB138 is down-regulated; b: MCMV accumulation upregulation in zmmyb138 p < 0.05 p < 0.01 p < 0.001 p < 0.0001;

FIG. 5 shows that mutant ZmMYB74 favors MCMV accumulation; a: the expression level of ZmMYB74 in ZmMYB74 is down-regulated; b: MCMV accumulation up-regulation in zmmyb74 p < 0.05 p < 0.01 p < 0.001 p < 0.0001;

FIG. 6 is an upregulation of MCMV CP protein accumulation in ZmMYB138 and ZmMYB74 mutants;

FIG. 7 is a colony PCR detection CMV vector;

FIG. 8 shows exacerbation of MCMV infection after ZmMYBs are silenced by VIGS in maize;

FIG. 9 is a graph of the contribution to MCMV infection after silencing MYB family; a: the expression level of ZmMYB138 is down-regulated after CMVVIGS and MCMV is inoculated; b: the expression level of ZmMYB74 is down-regulated after CMVQIGS ZmMYBs are inoculated with MCMV; c: MCMV accumulation up-regulated after CMVVIGS ZmMYBs p < 0.05 p < 0.01 p < 0.001 p < 0.0001;

FIG. 10 shows the up-regulation of the amount of MCMV CP protein accumulation after CMVVIGS ZmMYBs;

FIG. 11 shows that ZmCCoAOMT1 expression was also down-regulated after MYB mutants and CMV silenced MYB families; a: the expression level of ZmCCoAOMT1 is down-regulated after the zmmyb138 mutant is infected by MCMV; b: the Zmmyb74 mutant is down-regulated in the expression level of ZmCCoAOMT1 after being infected by MCMV; c: silencing ZmMYBs and down-regulating expression level of zmccaomt 1 after MCMV administration, wherein p is less than 0.05, p is less than 0.01, p is less than 0.001, p is less than 0.0001;

FIG. 12 shows that ZmDnaJ expression is also down-regulated after MYB mutants and CMV silence MYB families; a: zmmyb138 mutant changes in ZmDnaJ expression level after MCMV infection; b: zmmyb74 mutant changes in ZmDnaJ expression level after MCMV infection; c: silencing ZmMYBs and following MCMV vaccination, zmDnaJ expression level changes p < 0.05, p < 0.01, p < 0.001, p < 0.0001;

FIG. 13 is a colony PCR assay for CMV-ZmCCoAOMT1;

FIG. 14 is a graph of the contribution to MCMV infection following CMV silencing ZmCCoAOMT1; a: CMVVIGS

Inoculating MCMV after ZmCCoAOMT1, and down-regulating the expression quantity of ZmCCoAOMT1; b: CMVVIGS

MCMV accumulation up-regulated after zmcooaomt 1 inoculation p < 0.05 p < 0.01 p < 0.001;

FIG. 15 shows the upregulation of the accumulation of MCMV CP protein after CMVVIGS ZmCCoAOMT 1.

Detailed Description

The biological materials used in the examples of the present invention are shown below:

test toxin source: MCMV;

test plants: nicotiana benthamiana (for inoculation with CMV), maize inbred line B73 (for inoculation with MCMV);

reagent: the RNA extraction kit was purchased from Shanghai prolog biological products limited;

reverse transcription kit was purchased from the biotechnology company limited of nanking nuozan;

SYBR qPCR Master Mix from the biological sciences of nanking nuozan inc;

other reagents used in the present invention, unless otherwise specified, may be purchased from conventional sources.

miR159a sequence: UUUGGAUUGAAGGGAGCUCUG (SEQ ID NO. 1)

The ZmMYB138 complete CDS sequence is shown in SEQ ID NO. 2:

SEQ ID NO.2：

ATGTACCGGGTGAAGAGCGAGGGGGAGGGCGAGGGCGAGGGCGACTGCGAAATGATGCTGCAGGAACAGATGGACTCGCTGGTGGCCGACGACGTCAGCAGCGGAGGAGGGTCGCCTCACAGGGGCGTCGGCACGCCCCTGAAGAAGGGGCCATGGACGTCCGCGGAGGACGCCATCCTGGTGGACTACGTTAAGAAGAACGGCGAGGGCAACTGGAACGCGGTGCAGAAGAACACCGGGCTGTTCCGCTGCGGCAAGAGCTGCCGCCTCCGGTGGGCGAACCACCTCAGGCCCAACCTCAAGAAGGGGGCCTTCACCCCCGAGGAGGAGCGCCTCATCATCCAGCTCCACGCCAAGATGGGGAACAAGTGGGCGAGGATG GCTGGTCACTTGCCAGGGCGTACTGACAATGAGATCAAGAACTACTGGAACACTCGAATAAAGAGATGTCAACGAGCTAGCCTTCCTATTTATCCTGCTAGTGTATGCAATCAATCTACAAATGAAGATCAGCAACTGTCTGGTAATTTTAACGGTGGCGAGAATATATCCAATGATCTTCTATCTGGGAACAGCCTTTATCTGCCAGATTTTACCAGTGACAATTTCATTGCGAACCCAGAGGCTTTATCCTATGCACCACAGTTGTCAGCTGTTTCAATAAGCAATTTGCTCGGCCAAAGCTTTGCATCAAAAAGTTGTAGCTTCATGGATCAGGTTGACCAAGCGGGGATGCTGAAACAATCTGGCTGTGTGCTTCCTGCATTGAGCGATGCCATTGACAGTGTGCTTTCCTCAGCTGATCATTTTTCAAATGACTCTGAGAAGCTCAGGCAGGCTTTAGGTTTTGATTATCTGAATGAAGCCAATGCTAGCAGCAAGAGTATTGCACCTTTCGGGGTTGCACTTACTGGCAGCCATGCCTTTTTAAATGGCAATTTCTCTGCTTCTAGGCCCACAAATGGTCCTTTGAAGATGGAGCTCCCTTCACTCCAAGATACTGAATCTGATCCAAATAGCTGGCTCAAGTATACTGTGGCTCCTGCAATGCAGCCTACTGAATTAGTAGATCCTTACCTGCAGTCTCCATCAGCGACCCCTTCAGTGAAATCTGAGTGTGCATCGCCGAGGAACAGTGGTCTTTTGGAAGAGCTGCTTCATGAAGCTCAGGCACTAAGATCTGGGAAGAACCAACAATCATCGGTCCGAAGTTCAAGTTCTTCTGCTGGCACACCTTATGAGACTACCACGGTGGTTAGCCCAGAGTTTGATATGGGTCAGGAATATTGGGAAGAACAGCCCAGTTCTTTCCTCAGTGAATATGCTCATTTTAGTGGAAATTCTTTCACTGAATCCACTCCTCCTGTTAGTGCTGCGTCACCTGATATCTTCCAGCTCTCCAAGATTTCTCCTGCACAAAGCCCTTCAATGGGCTCTGGCGAGCAGGCGTTAGAGCCTAAACATGAGTCGGCAGCTTCACCTCGTCCTGAAAACTTGAGGCCTGATGCATTATTCTCTGGGAACACAGCCGATCCATCCATTTTCAATAATGCCATAGCCATGCTCCTGGGCAATGGCATTGATGCCGAGTACAAACCTGTTCTTGGTGATGGAATTGTGCTCGATTCTTCGTCATGGAACAACATGCAACATGCTTTTCAGATGGCGGGATTCAAATGA

the ZmMYB74 complete CDS sequence is shown in SEQ ID NO. 3:

SEQ ID NO.3：

ATGTACCGGGTGAAGAGCCAGGCGGAGGGCGAGGGCGAGGGCAAGGACGAGATGATGTCGCAGGACCAGATGGACTCGCCGGTGGACAACGATGTCAGCAGCAGCCGCAGGTCGCCTCGCAGGGGCGTCGGGGCGCCCCTGAAGAAAGGGCCCTGGACGGACGCGGAGGACGCCATCCTGATAGACTACGTTAAGAAGCACGGCGTGGGCAACTGGAACGCGGTGCGGAAGAACACCGAGCTATTGCGCTGCGGCAAGAGCTGCCGCCTCAGGTGGGCGAACCACCTCAGGCCCAACCTCAAGAAGGAGGCCTTCACCCCGGAGGAGGAGCGCCTCATCATCCAGCTCCACGCCAAGCTGGGGAACAAGTGGTCGAGGATGGCTATTCATTTGCCAGGGCGTACTGACAACGAAATAAAAAACTACTGGAACACACGAAAAAAGAGATGTGAACGAGCTAGCCTTCCTATCTATCCTGCTGGTGTACGTAATCAATCTTCAAATGAAGACCAGCAATTGTCTGGTGATTTGAACGGTGGCGAGAACATGTCCAATGATCTTCTATCCGGAAACAGCCTTTGTCTACCAGATTTTAACAATGACAGTTTCCGTGCGAAACTGAAGGCTTTACCACCACAGCTGCCAGCTGTTTCAATAAGCAATTTGCTCGGCCAAAGCTTTGCATCAAAAGGTTGTAGCTTCATGGATCAGGTAGACCAAGCAGGGATGCTGAAACAATCTGGCAGTGCGCTTCCTACATTGAGCGATGCCATTGACGATGTGATTTCCTCGGTTGATCAATTTTCAAATGACTCTGAGAAGCTCATGCAGACTTTAGGTTTTGGTTATCTCAATGAAGCCAACGCTACCAGCAAGAGTATTGCGCCTTTTGGGGTTGCACTTACTGGCAGCCATGCCCCTTTAAATGGTATTTTCTCTGCATCTAGG CTCACAAATGGTCCTTCGAAGATGGAGCCCCCTTCAGTCCAAAATAGCAGGCTCAAGTATACTGTGGATCCTGCAATGCAGCCTACTGAGTTAGTAGATCCTTACATGCAGTCTCTATCAGCGACCCCTTCAGTGAAATCAGAGTGTGCATCGCCGAGAAACAGTGGTCTTTTCGAAGAGCTGCTTCATGAACCTCATGCACTAAGATCTGGGAAGAGCCAACAACCATCGGTCCGAAGTTCAAGTTCTTCTGCTGGCACACCTTATGGGACTATGGTTAGCTCAGAATTTGATATGGGTCAGGAATATTGGGAAGAACAGCCCGGTTCTCTCCTCAGCGAATATGCTCACTTCAGTGGGAATTATTTGGCTGAATGCGCTCCTCCTGTTAGCGCTGCATCAACTGATATCTTTCCGCTCCCCAAGATTTCTCCTGCAGAAAGCCCTTCAATGGGCTCTGGCGAGCAGGCGTTAGAGCCTAAACATGAGTCAGCAGCTTCACGTACGTCATCTTGGAAACTTGAGGCATGA

ZmCCoAOMT1 gene ID: zm00001d036293

ZmDnaJ Gene ID Zm00001d013111

The technical solutions provided by the present invention are described in detail below with reference to examples, but they should not be construed as limiting the scope of the present invention.

Example 1 target Gene prediction of miRNA159

In order to study the regulation and control mechanism of miR159 and a (UUUGGAUUGAAGGGAGCUCUG) in corn, analysis was performed through an online prediction website (https:// www.zhaolab.org/psRNATarget /), and results with scores less than or equal to 2.5 were selected (Table 1). Through looking up the literature, two MYB family genes, zm00001d043131 (ZmMYB 138) and Zm00001d012544 (ZmMYB 74), in the predicted result are determined to be target genes of miR159a by combining transcriptome data. Predicted target genes were found in the transcriptome data sheet and the results plotted as a heat map (fig. 1), the data indicating that ZmMYB138 and ZmMYB74 were significantly up-regulated after virus infection of maize, particularly in complex infection.

Table 1 website predicts miR159a target and target gene with score less than or equal to 2.5

Example 2 ZmMYB138 and ZmMYB74 mutants promote MCMV infection

Mutants of Ds transposon insertion maize inbred B73-Ds 4-MYB74 mutant zmmyb74, ds6-MYB138 mutant zmmyb138 maize were purchased from MEILAM database company. To detect loss of the inserted Ds transposon in mutant maize, all mutants were sown in a climatic chamber at 24℃C 16h (light stage), 22℃C 8h (dark stage) with untreated maize B73 as control, samples were taken at 8d, mutant maize genomic DNA was extracted, and the mutants were amplified using the primer combinations zmmyb74-F/R+Ds3'BPrimer, zmmyb138-F/R+Ds5' BPrimer, respectively, with the amplification primer sequences shown in Table 2. The amplification procedure was as follows: 98 ℃ for 30s; 15s at 98 ℃, 15s at 58 ℃, 10s at 72 ℃ and 35 cycles; storing at 72 ℃ for 10min and 4 ℃ to detect the insertion condition of the Ds transposon of the mutant corn, wherein a band appears at a 270bp position of the wild corn, a band appears at a 500bp position of the zmmyb138 mutant corn, and a band appears at a 520bp position of the zmmyb74 mutant corn, which is shown in the figure 2, so that the Ds transposon of the mutant corn is successfully inserted. Then, a mutant corn resistance experiment is carried out, B73 which is not subjected to any treatment is used as a control, MCMV virus is inoculated, corn is inoculated in a friction inoculation mode, the corn is inoculated in a two-leaf period, the inoculation part is a first true leaf, and the whole leaf is rubbed for 30-40 times from the root of the leaf to the tip of the leaf. Recording disease index (Table 3) at 6-8d of virus inoculation, taking a picture and sampling (FIG. 3) at 9d of virus inoculation, and showing that mutant zmmyb138 corn shows more feeling to MCMV and heavier symptoms according to the disease index table and MCMV symptom map; mutations zmmyb74 and zmmyb138 showed a disease in MCMV with a slight exacerbation of symptoms.

TABLE 2 amplification primers

Zmmyb74-F	AAACTACTGGAACACACGA	SEQ ID NO.4
			Zmmyb74-R	AGATAACCAAAACCTAAAG	SEQ ID NO.5
zmmyb138-F	TCTCTCTCGCCTTTACCCG	SEQ ID NO.6
			zmmyb138-R	CTCCCCCTCGCTCTTCACC	SEQ ID NO.7
Ds5’BPrimer	ATACGATAACGGTCGGTACGG	SEQ ID NO.8
			Ds3’BPrimer	AACGGTAGAGGTATTTTACCGACC	SEQ ID NO.9

TABLE 3 disease index questionnaire for MCMV infected ZmMYB138 and ZmMYB74 mutants

And selecting different plants of zmmyb138 and zmmyb74 according to a disease index table for subsequent experiments, selecting 1-2 plants with light and heavy symptoms for each mutant, taking B73 which is not subjected to any treatment as a control, extracting total RNA of the plants, reversely transcribing cDNA, and carrying out RT-qPCR to detect the expression quantity change of zmmyb138 and zmmyb74 genes and the expression quantity change of MCMV in the mutants. The primers for RT-qPCR are shown in Table 4, and the reaction system, the reaction procedure are shown in tables 5 and 6:

table 4 RT-qPCR primers

Primer name	Primer sequences
			qZmMYB138-F	TGATCTTCTATCTGGGAACAGC	SEQ ID NO.10
qZmMYB138-R	GCATCGCTCAATGCAGGAAG	SEQ ID NO.11
			qZmMYB74-F	TTCATTTGCCAGGGCGTACT	SEQ ID NO.12
qZmMYB74-R	TCTCGCCACCGTTCAAATCA	SEQ ID NO.13

TABLE 5 RT-qPCR reaction System

The components	Volume of
		RT-qPCR enzyme	10μL
Forward primer	0.45μL
		Reverse primer	0.45μL
Template cDNA	2μL
		ddH ₂ O	7.1μL

TABLE 6 RT-qPCR reaction procedure

After the reaction, the relative expression level of the target gene/viral genome was calculated by using the ΔΔct method based on the CT value of each reaction measured by the instrument.

The quantitative RT-qPCR detection results are shown in fig. 4 and 5, and as can be seen from the A in fig. 4, the expression level of the ZmMYB138 is reduced by about 0.8 times in the mutant ZmMYB138-1-3, about 0.4 times in the ZmMYB138-2-1, about 0.5 times in the ZmMYB138-2-6 and about 0.6 times in the ZmMYB138-2-7, which shows that the silencing effect of the ZmMYB138 mutant on the gene ZmMYB138 is remarkable; as can be seen from B in FIG. 4, in the mutant ZmMYB138-1-3, the MCMV expression level is up-regulated by about 6 times, in ZmMYB138-2-1, up-regulated by about 3 times, in ZmMYB138-2-6, up-regulated by about 5 times, and in ZmMYB138-2-7, the experiment proves that the down-regulation of the ZmMYB138 expression can promote the infection of virus MCMV.

As can be seen from A in FIG. 5, in ZmMYB74-3, the expression level of the gene ZmMYB74 is down-regulated by about 0.6 times, and in ZmMYB74-8, the expression level of the gene Zmmyb74 is down-regulated by about 0.6 times, which shows that the silencing effect of the ZmMYB74 mutant on the gene ZmMYB74 is remarkable; as can be seen from B in FIG. 5, the expression level of the MCMV is up-regulated by about 5 times in the mutant ZmMYB74-3, and about 5 times in the ZmMYB74-8, so that the down-regulation of the expression of the ZmMYB74 can promote the infection of the virus MCMV.

The mutant zmmyb138-2-6 and zmmyb74-3 with obvious quantitative results are selected for Western Blot experiments, and the change of the expression quantity of the MCMV CP protein is detected, and the specific steps are as follows:

(1) Protein sample preparation

Extraction of total proteins in tissues. Plant tissue was crushed in a mortar or mill, all the way through in liquid nitrogen. Adding 500-600 uL protein lysate, adding PMSF (100 mM) into the lysate, wherein the PMSF has the function of preventing protease from degrading the extracted protein, so that the final concentration of PMSF is 1mM. Adding the cracking liquid, vibrating and uniformly mixing on a vibrating vortex instrument, homogenizing in a homogenizer at 4 ℃, standing for about 1-1.5 h, and placing on ice after the cracking is complete. Centrifuging at 4deg.C for 5min at 12000r/min, collecting supernatant, packaging into 1.5ml centrifuge tube, and storing at-20deg.C.

(2) Determination of protein content

Reference is made to the instructions for the determination of the concentration of the BCA protein in Biyundian.

(3)Western Blot

Preparing a sample, namely taking 50-100 uL of extracted protein liquid, adding a 5 XSDS-PAGE protein sample buffer, blowing and mixing uniformly, placing in a 98 ℃ metal bath, and standing for 5-7 min, wherein the protein is denatured and can be used for protein gel running.

The PAGE gel is prepared according to a preparation method of a rapid preparation kit of the PAGE gel provided by Shanghai elegance enzyme biomedical technologies, inc. About 30minPAGE gel is coagulated, a prepared electrophoresis buffer is added into an electrophoresis tank, the PAGE gel is placed in the electrophoresis tank, the middle area of two pieces of the PAGE gel is filled with the electrophoresis buffer, then a sample and a marker are sequentially added into a sample loading hole of the PAGA gel, bubbles in the sample loading hole are blown clean before sample loading, electrophoresis is carried out under 150V voltage, and after about 50min, bromophenol blue dye in the sample loading buffer runs to the boundary of the PAGE gel, and electrophoresis is stopped.

One of the two pieces of PAGE gel is subjected to coomassie brilliant blue (CDD) dyeing, the gel after running electrophoresis is placed in the coomassie brilliant blue dyeing liquid which is prepared, the gel is ensured to be completely covered by the dyeing liquid, the gel is placed on a shaking table, the gel is dyed on the shaking table until clear protein strips can be seen, and then the PAGE gel is soaked in clear water, so that the background is convenient to observe and photograph, the color fading is faster by hot water, and the photograph is taken out after about 1-2 d as a loading control.

Transferring one of the two pieces of PAGE gel, preparing transfer membrane liquid in advance, soaking a wet transfer instrument clamp, a sponge pad and filter paper in the transfer membrane liquid, shearing a PVDF membrane with proper size, soaking in anhydrous methanol for 1-2 min (the time cannot be too long), and soaking the PAGE gel in the transfer membrane liquid for 5min. Taking out the clamp of the wet transfer instrument, sequentially putting the sponge cushion, the soaked filter paper, the gel, the PVDF film, the soaked filter paper and the sponge cushion from the negative electrode to the positive electrode, carefully removing bubbles between the PVDF film and the gel by using a roller, transferring the film for 90min at 60V, and clearly seeing a marker, bromophenol blue dye and part of protein on the PVDF film after the film transfer is completed.

And the next step is to seal, put the PVDF membrane after membrane transfer into the prepared sealing liquid, ensure that the sealing liquid can completely submerge the PVDF membrane, and put the PVDF membrane on a shaking table for sealing for 1.5 hours.

Then, the primary antibody is incubated, after the blocking is finished, the monoclonal antibody is diluted in the same blocking liquid, the primary antibody of MCMV needs to be diluted 20000 times for use, the primary antibody needs to be ensured to completely submerge the PVDF membrane, and the primary antibody is placed on a shaking table and incubated for 2 hours at room temperature. After the end of the primary antibody incubation, the PVDF membrane was washed with TBST buffer for 5min and repeated 3 times.

Then, secondary antibody incubation was performed, and the washed PVDF membrane was placed in a secondary antibody diluted 2000-fold with TBST, and placed on a shaking table, and incubated at room temperature for 1h. After the secondary antibody incubation was completed, the PVDF membrane was washed with TBST buffer for 5min and repeated 3 times.

And finally, performing color development and photographing, namely sucking excessive water of the PVDF film by using water absorption paper, adding a proper amount of CDP-Star color development liquid (mixing the liquid A with the liquid B in equal proportion), completely smearing the PVDF film for a plurality of times by using the color development liquid, and developing until the strips are clear by using a chemiluminescence imaging system.

The Western Blot results are shown in FIG. 6, the results shown in FIG. 6 are consistent with the quantitative results of RT-qPCR, the MCMV expression level is up-regulated, and both the mutant zmmyb138-2-6 and zmmyb74-3 promote the infection of the virus MCMV. Both mutants ZmMYB138 and ZmMYB74 were shown to be more sensitive to MCMV, exacerbating and advancing symptoms, demonstrating disease resistance genes of ZmMYB138 and ZmMYB74 in corn.

EXAMPLE 3 silencing ZmMYBs promote MCMV infection

The conservation region of MYB is selected by taking CDS of ZmMYB138 as a template, a multi-gene silencing fragment with 220bp length MYB based on ZmMYB138 is designed, and the multi-gene silencing fragment is delivered to Huada company to be successfully inserted into two restriction sites of KpnI and XbaI of a vector. The CMVVIGS vector returned by the company is subjected to sequencing and PCR detection, the PCR detection result is shown in figure 7, and the sequencing and PCR detection result shows that the vector construction is successful when a band with proper size appears at about 500 bp.

The CMVVIGS vector plasmid constructed by the company is transformed into DH5 alpha escherichia coli competent cells, positive clones are selected for colony PCR, and agarose gel electrophoresis is carried out after the colony PCR is finished. And (3) extracting a coliform plasmid by selecting positive clones to perform agrobacterium transformation, infiltrating tobacco with agrobacterium, taking tobacco leaves of the present raw tobacco infiltrated with CMV VIGS, grinding to obtain grinding liquid, and inoculating corn by needling.

The specific operation steps are as follows;

1. coli transformation

(1) The preparation method of the escherichia coli LB culture medium comprises the following steps: 5g of Tryptone (Tryptone), 2.5g of Yeast extract (Yeast extract), 5g of NaCl solid, and 400mL of deionized water are added for dissolution, the volume is fixed to 500mL (2.25 g of agar powder is added for every 150mL of solid medium), and after subpackaging, the mixture is autoclaved at 121 ℃ for 30min.

(2) Taking out competent cells such as DH5 alpha or Trans T1 from the temperature of minus 80 ℃, placing in ice for waiting to melt, adding CMV vector plasmid constructed by a company after fungus blocks are melted, mixing uniformly by flicking the competent centrifugal tube bottom, placing in ice, and standing for 30min.

(3) Placing the mixed solution in the last step in a metal bath or a water bath kettle at 42 ℃, carrying out heat shock for 40-50 sec, quickly placing the centrifuge tube back on ice after the heat shock, and standing for 2min, wherein shaking of the centrifuge tube is avoided.

(4) Adding 650 mu L of LB liquid culture medium without any antibiotics into the mixed solution of the previous step, uniformly mixing, and then placing the mixed solution in a constant-temperature shaking incubator, and carrying out shaking recovery for 60min at 37 ℃ and 200 r/min.

(5) After the oscillating recovery is finished, the thalli are collected by centrifugation for 1min at the rotating speed of 5000r/min in a normal temperature high-speed centrifuge, the supernatant is poured into a super clean workbench, about 100 mu L of supernatant is reserved for lightly blowing and resuspension of the precipitated fungus blocks, and the sediment is evenly coated on LB solid medium containing the kana antibiotics until all the sediment is coated.

(6) The plate which is coated with the dry solution is placed in a constant temperature incubator at 37 ℃ for culturing for 12 to 16 hours, and positive clone single spots can grow after transformation.

2. Colony PCR

The positive clone single spot after the escherichia coli transformation is selected and cultured in an LB liquid culture medium for 6 to 8 hours in a constant temperature shaking incubator at 37 ℃, and colony PCR is carried out after bacterial liquid becomes muddy, and a PCR reaction system is shown in the table 7:

TABLE 7 colony PCR System

Colony PCR reaction procedure is shown in table 8:

TABLE 8 colony PCR reaction procedure

After colony PCR, agarose gel electrophoresis was performed.

3. Agarose gel electrophoresis

(1) According to the gel preparation amount and gel concentration, adding a certain amount of agarose powder, for example 1×agarose gel, into a triangular pyramid bottle containing a certain amount of TAE electrophoresis buffer solution, 150mL ddH ₂ To O, 3mL of 50 xTAE was added, and then 1.5g of agarose was weighed.

(2) The agarose is heated and dissolved in a microwave oven, and the agarose is repeatedly boiled for 4 to 6 times in the microwave oven, so that the agarose can be completely melted.

(3) The solution was cooled to about 50℃to 60℃at which time 1. Mu.L of DNA nucleic acid dye was added per 30mL of the solution and thoroughly mixed.

(4) The agarose solution was poured into a gum making tank and then a comb was inserted in place. The gel thickness is generally between 3 and 5 mm. The glue was left to set at room temperature after waiting about 30min.

(5) The solidified agarose gel was placed in a horizontal electrophoresis apparatus, and about 6. Mu.L of the sample was pipetted with a pipette, and carefully added to the gel well of the agarose gel.

(6) After the sample is dispensed, the electrophoresis tank cover is closed, the power supply is immediately switched on, the control voltage is kept at 200V, and the current is 300mA for running gel. Electrophoresis was stopped after about 20min, at which point the band position was visible. Observed in a gel imager and photographed.

4. Large intestine plasmid extraction

The coliform plasmid extraction refers to the instruction book of the plasmid extraction kit.

5. Agrobacterium transformation

(1) C58C1 competence stored at-80℃was placed in ice for thawing.

(2) Mu.g of CMV vector plasmid was added per 100. Mu.L of competent cells, gently mixed, placed in ice and allowed to stand for 10min.

(3) And (3) placing the mixed solution obtained in the last step in liquid nitrogen, and standing for 5min.

(4) Placing the mixed solution in ice, and standing for 5min.

(5) Adding 800 mu L of liquid LB into the mixed solution in the last step, placing the mixed solution in a constant-temperature shaking incubator, and carrying out shaking recovery for 2-3 h at 28 ℃ and 200 r/min.

(6) After the oscillating recovery is finished, centrifuging for 1min at a rotating speed of 5000r/min in a normal-temperature high-speed centrifuge, collecting thalli, pouring supernatant in an ultra-clean workbench, reserving about 100 mu L of supernatant, lightly blowing to resuspend precipitated bacterial blocks, uniformly coating on LB solid culture medium containing the kanna antibiotics and the rifampicin antibiotics until all the solid culture medium is coated, and growing positive clone single spots after conversion.

6. Agrobacterium-infiltrated tobacco

(1) Selecting positive clone single spots, placing the positive clone single spots in 1mL of liquid LB containing the carpaine and the rifampicin, placing the positive clone single spots in a constant-temperature shaking incubator, shaking and resuscitating the positive clone single spots for 24 hours at the temperature of 28 ℃ and the speed of 200r/min, sucking 100 mu L of the positive clone single spots after the bacterial liquid becomes turbid, and adding the positive clone single spots into 10mL of liquid LB containing the carpaine and the rifampicin antibiotics.

(2) After 10mL of bacterial liquid is mixed, the bacterial liquid is centrifuged for 10min in a normal temperature high speed centrifuge at 4000r/min, and the supernatant is poured off to leave bacterial precipitate.

(2) An agrobacteria infiltration buffer was prepared, 0.8132g MgCl2,0.7810g MES salt, and 0.0157g acetosyringone were weighed and dissolved in 400mL distilled water.

(3) Suspending the bacterial precipitate with 10mL of infiltration buffer solution, placing the bacterial precipitate in a constant temperature incubator, and resuscitating the bacterial precipitate at 28 ℃ for 4-6 h.

(4) In a normal temperature high speed centrifuge, the bacterial precipitate is collected by centrifugation at 4000r/min for 10min, the bacterial suspension OD value is regulated by suspending the precipitate with a proper concentration of infiltration buffer solution, and the CMV bacterial suspension OD value is about 0.5.

(5) After the CMV bacterial suspension and the bacterial suspension carrying CMV ZMBJ-2 are mixed uniformly, the bacterial suspension carrying the virus vector is injected into the lower epidermis of the leaf of the present cigarette by a needleless 1mL syringe, and the whole leaf is filled.

(6) The soaked raw tobacco is placed in an illumination incubator, the illumination is carried out for 24 ℃ and 16 hours, the darkness is carried out for 22 ℃ and 8 hours, and the sample is taken for the subsequent experiment after the culture for 3-4 days.

7. Needle punched inoculated corn

(1) Sampling the tobacco which is infiltrated and contains CMVVIGS, taking inoculated leaves, adding 0.01M PBS phosphate inoculation buffer solution according to the proportion of 700 mu L of each 1g of tobacco, putting the leaves in a sterilized and precooled mortar, adding the PBS phosphate inoculation buffer solution and a little carborundum, grinding until the tobacco is homogenized, transferring grinding liquid to a 2mL centrifuge tube by using a gun head with a head removed, and placing the tobacco in ice for standby.

(2) 60-70 corn seeds with consistent size and flat embryo are selected for each treatment, placed in deionized water, soaked for about 40min, the soaked seeds are placed on wet water absorbing paper, 15 mu L of grinding liquid is dripped into each corn seed embryo concave position, and the seeds are inoculated by needling, so that the embryo is prevented from being pricked by excessive force during operation.

(3) Marking, adding water, keeping moisture, sealing with preservative film, placing in a constant temperature incubator, culturing at 25deg.C in dark, planting in experimental soil after sprouting, culturing in an illumination incubator, illuminating at 20deg.C for 16 hr, and darkness at 18deg.C for 8 hr.

The MCMV challenge was inoculated 3d after the correct vector was inoculated into corn (secondary virus inoculation was performed on the basis of VIGS), and samples were taken 8d after MCMV virus inoculation, and the results are shown in fig. 8. It can be seen from fig. 8 that MCMV symptoms were all aggravated after CMV VIGS silenced MYB.

The RT-qPCR system in example 2 was used to quantitatively detect changes in the expression levels of ZmMYB138 and ZmMYB74 genes, and Western Blot was used to detect changes in the expression levels of MCMV virus, with CMV VIGS GFP as a control. As a result, as shown in FIG. 9, it can be seen from FIG. 9 that ZmMYB138 expression was down-regulated by about 0.5-fold (A), zmMYB74 was down-regulated by about 0.5-fold (B), and MCMV expression was up-regulated by about 5-fold (C) after silencing MYB and inoculating MCMV in corn.

As shown in FIG. 10, the Western Blot detection results show that the variation of the expression level of MCMVCP protein is consistent with the quantitative result of RT-qPCR, and the MCMV expression level is up-regulated. Experimental results show that the silencing MYB has a promoting effect on virus MCMV infection.

Example 4ZmMYB138 Regulation of ZmCCoAOMT1, zmDnaJ involvement in antiviral

In order to verify the relationship between ZmMYB138, zmMYB74 and possibly regulated ZmCCoAOMT1, zmDnaJ, the expression changes of both mutants and CMVQIGS MYB were detected by RT-qPCR, and the RT-qPCR results are shown in FIG. 11, FIG. 12. As can be seen, zmCCoAOMT1 was down-regulated about 0.4-0.5-fold in myb138 mutant (FIG. 11), zmDnaJ was down-regulated about 0.3-0.4-fold (FIG. 12), zmCCoAOMT1 was down-regulated about 0.2-0.4-fold in myb74 mutant, and ZmDnaJ was down-regulated about 0.2-fold; whereas ZmCCoAOMT1 was down-regulated about 0.4-fold in CMVVIGS MYB and inoculated MCMV, zmDnaJ was down-regulated about 0.4-fold. In conclusion, the expression levels of ZmMYB138 and ZmMYB74 were also down-regulated after the MYB family genes were silenced. And the expression quantity change trend of ZmCCoAOMT1 and ZmDnaJ in the mutant and CMV silencing vectors is basically consistent with the expression quantity change trend of ZmMYB138 and ZmMYB74, which shows that the ZmMYB138 regulates and controls the ZmCCoAOMT1 and the ZmDnaJ to participate in antiviral.

Example 5 plant more susceptible to disease after silencing ZmCCoAOMT1

The sequence of ZmCCoAOMT1 is found on a website (www.ncbi.nlm.nih.gov), a CMV VIGS vector is designed by using the CDS sequence of the ZmCCoAOMT1, the CMV VIGS vector is constructed by the Huada company, and PCR detection is carried out on the vector constructed by the company, and the detection result is shown in figure 13, so that the vector construction is successful. As shown in FIG. 14, the quantitative RT-qPCR detection results are shown in FIG. 14, and after CMVVIGS ZmCCoAOMT1, MCMV was inoculated, the ZmCCoAOMT1 expression level was down-regulated by about 0.4 times, and the MCMV expression level was up-regulated by about 3 times. The Western blot experiment results are shown in FIG. 15, and as can be seen from FIG. 15, MCMV is inoculated after CMVVIGS ZmCCoAOMT1, and MCMV CP protein is up-regulated. In conclusion, CMV VIGS ZmCCoAOMT1 has a stable silencing effect, the silencing efficiency can reach 40%, and the content of MCMV virus is increased after ZmCCoAOMT1 is silenced, so that ZmCCoAOMT1 is a gene for resisting MCMV in corn, and the over-expression of ZmCCoAOMT1 can enhance the resistance of corn to MCMV.

The foregoing is merely a preferred embodiment of the present invention and it should be noted that modifications and adaptations to those skilled in the art may be made without departing from the principles of the present invention, which are intended to be comprehended within the scope of the present invention.

Claims

Use of mir1599 a for combating maize chlorotic mottle virus infection.
Application of ZmMYB138 or ZmMYB74 genes in regulating and controlling maize chlorosis mottle virus resistance.
3. The use according to claim 2, wherein overexpression of ZmMYB138 or ZmMYB74 gene in maize is capable of increasing maize resistance to maize chlorotic mottle virus.
4. The biological material for improving the maize chlorosis mottle virus resistance is characterized by comprising ZmMYB138, zmMYB74 or ZmCCoAOMT1 gene overexpression vectors, and comprises an expression box, an expression vector, engineering bacteria and host cells.
5. Use of the biomaterial of claim 4 for the preparation of transgenic maize against maize chlorotic mottle virus and improvement of maize germplasm resources.
6. Use of an over-expressed ZmCCoAOMT1 gene or ZmDnaJ gene for increasing maize resistance to maize chlorotic mottle.