CN111705081B

CN111705081B - Construction and application of adenovirus carrying human RhoGDI3 gene shRNA

Info

Publication number: CN111705081B
Application number: CN202010498909.XA
Authority: CN
Inventors: 姚文娟; 梁秀瑛; 祁妍; 戴凡
Original assignee: Nantong University
Current assignee: Nantong University
Priority date: 2020-06-04
Filing date: 2020-06-04
Publication date: 2022-12-02
Anticipated expiration: 2040-06-04
Also published as: CN111705081A

Abstract

The invention discloses a construction and application of an adenovirus carrying a humanized RhoGDI3 gene shRNA, belonging to the technical field of biological medicines. The adenovirus contains shRNA for inhibiting the expression of a human RhoGDI3 gene, and the sequence of the shRNA is shown as SEQ ID NO.1 and SEQ ID NO. 2. The adenovirus of the invention can realize the in vivo knockout of RhoGDI3 gene, achieve the effect of inhibiting the hyperplasia of intima of blood vessels, and is used for preparing the medicine for treating the vascular diseases.

Description

Construction and application of adenovirus carrying human RhoGDI3 gene shRNA

Technical Field

The invention belongs to the technical field of biological medicines, and particularly relates to construction of an adenovirus carrying a humanized RhoGDI3 gene shRNA and application of the adenovirus in preparation of drugs for treating vascular remodeling diseases.

Background

Rho-specific guanylate dissociation inhibitor (RhoGDI) is critical for the homeostasis of Rho proteins and cross talk between family members. There are three subtypes of RhoGDI: rhoGDI1, rhoGDI2, rhoGDI3, which play an important role in many cell functions, such as cell proliferation and migration. RhoGDI1 (also known as RhoGDI alpha or ARHGDIA) is the most abundant one of the most specific in this family and is expressed ubiquitously. RhoGDI2 (also known as RhoGDI beta, ly-GDI, D4-GDI or ARHGDIB) is usually highly expressed in hematopoietic cells, but is also found in other cells, such as cancer cells. RhoGDI3 (also known as RhoGDI gamma or ARHGDIG) is specifically expressed in lung, brain and testis. Many studies have shown that RhoGDI expression is significantly altered in a range of cancers.

The inventors found in previous studies that RhoGDI3 is significantly highly expressed during proliferation of Vascular Smooth Muscle Cells (VSMCs) induced by human platelet-derived growth factor BB (PDGF-BB), and thus considered that RhoGDI3 may be closely related to Vascular remodeling. Vascular remodeling is thought to be the pathophysiological basis for cardiovascular diseases (such as hypertension, atherosclerosis, and restenosis), and the shift of VSMCs from a contractile phenotype to a proliferative synthetic phenotype plays a key role in vascular development and remodeling. Currently, there is no effective RhoGDI3 inhibitor or drug that reduces its synthesis, so that the purpose of effective and stable RhoGDI3 knockout in vitro and in vivo can be achieved by preparing recombinant adenovirus, and the recombinant adenovirus can be used for treating vascular diseases such as vascular intimal thickening or vascular restenosis.

Disclosure of Invention

The invention aims to provide an adenovirus carrying a human RhoGDI3 gene shRNA, which can realize the in vivo knockout of the RhoGDI3 gene, achieve the effect of inhibiting the hyperplasia of intima of blood vessels and can be used for treating vascular remodeling diseases.

In order to achieve the purpose, the invention adopts the following technical scheme:

an adenovirus carrying a human RhoGDI3 gene shRNA is characterized in that: the adenovirus contains shRNA for inhibiting the expression of a human RhoGDI3 gene, and the sequence of the shRNA is shown as SEQ ID NO.1 and SEQ ID NO. 2.

The method for constructing the adenovirus comprises the following steps:

step 1, designing and synthesizing shRNA shown in SEQ ID NO.1 and SEQ ID NO.2 aiming at a target gene RhoGDI 3;

step 2, annealing the synthesized shRNA, performing ligation reaction on the vector pAdM-shRNA-GFP which is subjected to enzyme digestion by BamH I and Hind III by using DNA ligase, transforming DH5 alpha competent bacteria, extracting a plasmid, and performing sequencing verification;

and 3, transfecting the virus vector successfully connected with the interference sequence to HEK293 cells to obtain the adenovirus.

The application of the adenovirus in preparing the medicine for treating vascular diseases.

Further, the vascular disease is intimal thickening or restenosis of the blood vessel.

The recombinant adenovirus prepared by the invention carries the shRNA sequence of RhoGDI3, can realize the purpose of effectively and stably knocking out the gene in vitro and in vivo, can selectively aim at the RhoGDI3 subtype, has no influence on the other two RhoGDI subtypes, thus not influencing the physiological functions of the two RhoGDI subtypes and greatly reducing the side effects generated by common inhibitors.

The recombinant adenovirus of the invention can be used for treating vascular diseases such as vascular intimal thickening or vascular restenosis and the like.

Drawings

FIG. 1 is a map of the hollow plasmid of example 1.

FIG. 2 shows the results of the electrophoretic detection of the cleavage of the adenovirus vector in example 1.

FIG. 3 shows the results of the specific detection of adenovirus in example 1.

FIG. 4 is the results of the vascular HE staining in example 2.

Detailed Description

The following examples further illustrate the present invention but are not to be construed as limiting thereof. Modifications or substitutions to methods, procedures, or conditions of the invention may be made without departing from the spirit and scope of the invention. The experimental methods and reagents of the formulations not specified in the examples are in accordance with the conventional conditions in the art.

DMEM high-glucose medium was purchased from gibioc, cat #: c11965500BT

HEPES solution 1M was purchased from HyClone, cat #: SH30237.01

Penicillin-streptomycin solution (100 x) was purchased from petunia, cat #: c0222

Fetal bovine serum was purchased from Gibico, cat No.: 1122050

0.25% trypsin was purchased from HyClone, cat # cat: SH30042.01

10xPBS was purchased from Biyun day, cargo number: ST476

DMSO was purchased from solarbo, cat #: d8372

Example 1

Construction of adenovirus

1. Selection of pAdM-shRNA-GFP as an adenovirus vector

FIG. 1 is a schematic diagram of the adenovirus vector pAdM-shRNA-GFP and the key sites therein, the target fragment being inserted at the BamH I and Hind III sites.

2. Design of primers

3. Adenovirus vector construction for shRNA carrying human RhoGDI3 gene

1. The vector was digested, then the digestion was detected by electrophoresis on 1% agarose gel, and the vector was recovered using a gel recovery kit.

The enzyme digestion system is as follows:

components of reaction solution	Volume of
		Plasmid (1. Mu.g/. Mu.L)	1μL
10×Buffer	3μL
		BamH I	1μL
Hind III	1μL
		ddH ₂ O	24μL
Total	30μL

Adding sample, mixing, and enzyme-cutting at 37 deg.C for 1-2h (without adding AP).

2. Annealing: the primers were then centrifuged instantaneously, and (nmol. Times. 10). Mu.L of H was added to the dry primer powder ₂ O, mother liquor diluted to 100. Mu.M.

The annealing reaction system is as follows:

components of reaction solution	Volume of
		RhoGDI3_F	1μL
RhoGDI3_R	1μL
		Buffer 3.1(NEB)	3μL
ddH ₂ O	25μL
		Total	30μL

Reaction procedure:

3. connecting: diluting the annealing product by 100 times, and connecting the annealing product with the enzyme-cut vector.

The linking system is as follows:

composition (I)	Volume of
		Diluted annealed product	2μL
Enzyme digestion vector	2μL
		10×T4 Buffer	1μL
T4 DNA ligase (10U/. Mu.L)	1μL
		ddH ₂ O	4μL
Total	10μL

Mixing, centrifuging instantly, and connecting at 22 deg.C for 2h.

4. And (3) transformation: the ligation products were transformed into E.coli DH 5. Alpha. Competent cells, spread on correspondingly resistant LB plates for resistance selection.

The method comprises the following specific steps:

(1) Taking prepared DH5a competence from-80 ℃ and placing in ice bath;

(2) After the DH5a competent cells are thawed, taking 1 mu L of the ligation product to 20 mu L of the DH5a competent cells, fully mixing the ligation product uniformly, and standing the mixture in ice bath for 30 minutes;

(3) Putting the centrifuge tube into a 42 ℃ water bath kettle for 40 seconds (the centrifuge tube is not required to be shaken during the process), then quickly moving the centrifuge tube into an ice bath, and standing for 2 minutes;

(4) Add 200. Mu.L of sterile LB medium (without antibiotics) to the centrifuge tube, mix well and shake for 1 hour at 37 ℃ on a shaker at 200 rpm. Aims to express related resistance marker genes on plasmids and recover thalli;

(5) Spreading into solid culture medium plate with corresponding resistance;

(6) Incubated overnight in an incubator at 37 ℃.

5. And (4) extracting plasmid for sequencing verification after single colony culture.

The sequencing result verifies that the recombinant plasmid is successfully constructed.

4. Recombinant adenovirus package carrying human RhoGDI3 gene shRNA and preparation

1. Enzyme digestion

Enzyme digestion system:

composition of matter	Volume of
		Plasmid DNA	20 μ L (about 2-3 μ g)
10×buffer	5μL
		dd H ₂ O	24.5μL
Pac1	0.5μL
		Total volume	50μL

At 37 deg.C for 3hr;95 ℃,5min and 50 μ L.

2.1% agarose gel electrophoresis detection, the electrophoresis shows two bands, one band is 3kb or about 5kb, and the other band is about 30 kb. As shown in fig. 2.

3. Transfection (transfection 6 well plate)

(1) Preparing Mix1 from 250 mu L of DMEM and 8 mu L of PEI, and standing for more than 5min;

(2) Preparing Mix2 from 250 mu L DMEM and the recombinant plasmid after enzyme digestion;

(3) Mixing Mix1 and Mix2, shaking and mixing uniformly, centrifuging and standing for 30min (generally more than 30min so as to have enough time to form a DNA-PEI complex);

(4) Laying 6-well plate HEK293 cells during standing, with cell number of about 0.3-0.5 × 10 ⁶ Per well;

(5) The mixture after standing was added dropwise to 6-well plate cells. Cross mixing and placing in CO ₂ Culturing in an incubator.

4. Amplification and detoxification steps

(1) Blowing down the cells with CPE in the six-hole plate and the culture medium, adding the cells into a 10cm dish, shaking up, and placing the dish in CO ₂ Culturing in an incubator for 2-3 days, and collecting toxin;

(2) Collecting 10cm disc cells with CPE effect, moving the disc cells into a 15mL centrifuge tube by using an electric pipette gun, and marking the disc cells correspondingly; 3500rpm, centrifuging for 7min;

(3) After centrifugation, the tube was removed, the supernatant was decanted (the virus requiring amplification in large amounts was decanted into a fresh 15mL tube and stored for a short period in a 4 ℃ freezer, or-80 ℃ if stored for a long period), and the remainder was pipetted clean with a 200. Mu.L gun. The precipitate was then redissolved with 1mL of 1xA195;

(4) Continuously blowing and beating the precipitate by using A195 to ensure complete redissolution, then respectively sucking the precipitate into 1.5mL EP tubes, and making corresponding marks;

(5) Putting the prepared EP tube into dry ice for freezing for 6-10min, then putting the tube into a dry thermostat, setting the temperature to 37.0 ℃, taking out the tube when a little ice blocks remain in the tube, reversing the tube by hand, uniformly mixing the tube and the tube, and repeatedly freezing and thawing for four times;

(6) After freezing and thawing, centrifuging for 2min at 12000g by using an EP tube;

(7) The supernatant was transferred to a two-dimensional code tube with a 1mL gun and then stored in a refrigerator at-80 ℃.

5. Bulk amplification and detoxification step

(1) The collected virus supernatant is evenly dripped into 10cm plates, and is placed in CO after being evenly mixed ₂ Culturing in an incubator for 2-3 days, and collecting toxin.

(2) Collecting 10cm disc cells with CPE effect, respectively transferring to a 50mL centrifuge tube by using an electric pipette, and marking correspondingly;

(3) Centrifuging at 3500rpm for 7min, and collecting supernatant and cell precipitate respectively;

(4) Adding NaCl and PEG8000 into virus supernatant, shaking for 30min for three times, and standing at 4 deg.C overnight. The cell pellet was stored at-80 ℃ for subsequent experiments.

6. Treatment before purification

(1) Viral supernatant treatment

1) Centrifuging the supernatant overnight at 4 deg.C, 3500g, centrifuging at 4 deg.C for 30min;

2) Centrifuging, removing supernatant, and collecting virus precipitate;

3) The virus pellet was resuspended in 2mL A195 and collected in 15mL tubes.

(2) Cell pellet treatment

1) The cell pellet was resuspended in 6mL of A195, mixed well, and freeze-thawed four times repeatedly. During freeze thawing, putting the sample in dry ice for freezing for 12-15 minutes, then taking the sample to a water bath kettle at 37 ℃ for melting for 2-3 minutes, and repeating the steps for four times;

2) After freezing and thawing, 3500g, centrifuging at 4 deg.C for 30min, and collecting supernatant and precipitate (cell debris);

3) Mixing the supernatant with the resuspended viral pellet; after resuspending the cell debris with 2mL A195, 0.5mL 5mol/L NaCl was added to a final concentration of 1mol/L.

(3) Ultrasonic disruption of cells

1) Ultrasonically crushing the resuspended cell fragments for 3-4 times (AMPL value is 30%,30 s/time, and the interval is 20-30s each time) until the liquid is not viscous;

2) After the ultrasonic treatment is finished, subpackaging the liquid into 2 EP tubes, and centrifuging at 12000rpm and 4 ℃ for 10min;

3) After centrifugation, the mixture was mixed with the virus supernatant and the cell pellet-treated sample.

7. Purification and concentration

(1) And (3) purification: iodixanol density gradient centrifugation

1) Preparing iodixanol with different concentrations according to a certain proportion;

2) Taking a super-ionization tube, adding iodixanol with different concentrations layer by using an electric pipette, firstly adding 4.2mL of a 60% layer, then adding 5mL of a 40% layer, secondly adding 6mL of a 25% layer, and finally adding 9mL of a 15% layer;

3) Adding the treated virus liquid to the uppermost layer;

4) And (4) carrying out ultra-high speed centrifugation at 48000rpm for 2 hours and 30 minutes, and before centrifugation, balancing the corresponding ultracentrifuge tube, wherein the error is controlled within 0.1 g.

(2) Concentrating

1) After centrifugation, puncturing the bottom of the ultrafiltration tube by using a needle, discarding the first 5mL, and collecting the 6mL to 10mL solutions into a 15mL tube;

2) The collected 5mL of liquid was diluted to a volume of 15mL with PBS + PF68 and then filtered through a 0.20 μm filter;

3) Placing the filtered liquid in a 15mL ultrafiltration tube, centrifuging for 50min at 3500g, discarding the liquid if the volume is not ideal, adding PBS + PF68 into the ultrafiltration tube for dilution, and centrifuging again for a time determined by the viscosity degree of the solution;

4) Repeatedly blowing and beating the residual liquid in the ultrafiltration tube, sucking the liquid into a virus storage tube, and finally adding 5 xA 195 storage liquid until the final solubility of the storage liquid is 1x, and marking the name and the date;

5) And (3) vortexing, shaking and uniformly mixing the collected viruses, centrifuging, and sucking 10 mu L of virus liquid for titer detection.

5. Recombinant adenovirus titer and specificity detection

1. Adenovirus treatment to disrupt viral coat

Composition of matter	Volume of
		Virus liquid	5μL
Proteinase K (5 ug/. Mu.L)	1μL
		Ultra-pure water	4μL

The enzyme was inactivated by incubation at 37 ℃ for 30min and then heated to 95 ℃ for 5 min.

2. Centrifuging at 12000rpm for 2min, and collecting supernatant

3、QPCR

(1) Copy number of plasmid standard, 7 gradient dilution concentrations: 2.58E + 12vp/uL, 2.58E + 11vp/uL, 2.58E + 10vp/uL, 2.58E + 9vp/uL, 2.58E + 8vp/uL and 2.58E + 7vp/uL, and ultrapure water is used as a negative control.

(2) PCR reaction systems were prepared, and 20. Mu.L of each sample was used.

Composition of matter	Volume of
		2X SYBRGreen buffer	10μL
F. R primer mixture	0.8μL
		Ultrapure water	7.2μL
Viral samples or standards	2μL

The primer sequence is as follows:

F:GATCCGCCTGAAGGAAGGTGTTGATTATTC(SEQIDNO.3)

R:GGTGTTGATTATCTCTTGAATAATCAAC(SEQIDNO.4)

(3) Performing a PCR reaction

5min at 95 ℃; 15sec at 95 ℃; 15sec at 60 ℃;72 ℃ for 15sec;40 cycles

(4) Number of virus particles

Number of virus particles (number/mL) = relative value to standard × 1000

4. Specificity detection

Taking out the product obtained in the step 3	1.5μL
		10 XTaq enzyme buffer	2μL
dNTP	0.4μL
		Taq enzyme	0.3μL
DMSO	1μL
		F, R primer mixture	4μL
Ultrapure water	10.9μL

The primer sequence is as follows:

F:GATCCGCCTGAAGGAAGGTGTTGATTATTC(SEQIDNO.3)

R:GGTGTTGATTATCTCTTGAATAATCAAC(SEQIDNO.4)

performing a PCR reaction program:

95℃4min；95℃30sec；64℃45sec；72℃1min 1cycles

95℃30sec；62℃45sec；72℃1min 2cycles

95℃30sec；60℃45sec；72℃1min 3cycles

95℃30sec；58℃45sec；72℃1min 26cycle

10min at 72 ℃; at 4 ℃ infinite

And (3) running the PCR product, cleaning the PCR product, comparing the size of the strip, diluting the PCR product of the universal primer, adding ultrapure water for 3 times for sequencing if the specific primer can not run out of the strip or has no specific primer, and comparing the sequence.

The electrophoresis results are shown in FIG. 3, and the sizes of the bands after PCR of the universal primers of the target genes are correct.

Example 2

Recombinant shRhoGDI3 adenovirus reduces intimal hyperplasia-level vascular stenosis

Constructing a vascular stenosis model by an LCCA method.

Mice were anesthetized with 10% chloral hydrate (0.3 mL/100 g) by intraperitoneal injection, and a 1-1.5cm incision was made in the center of the neck after hair removal, and the right common carotid artery was isolated and exposed without treatment as a control. The left common carotid artery was then isolated and its distal end ligated with suture. The skin was sutured and then given normal feeding. After 14 days of molding, the experimental animals were anesthetized and sacrificed, the left common carotid artery was rapidly isolated, the blood vessels were washed with pre-cooled physiological saline, and stored in a refrigerator at-80 ℃.

2. Tail vein injection of 0.1mL virus solution (titer 1X 10) ¹⁰ pfu)

3. The left carotid artery was taken and examined for intima/media ratio by HE staining.

HE staining procedure was as follows:

(1) Cleaning separated common carotid artery after two weeks of molding with normal saline, sucking to dry with filter paper, storing a part of the common carotid artery in a refrigerator at-80 ℃, and fixing the rest in 4% paraformaldehyde;

(2) Cutting a left and right carotid artery injury section of 0.5cm, carrying out OCT embedding, and carrying out frozen section by using a freezing microtome according to the thickness of 5 mu m;

(3) Staining the OCT embedded section with hematoxylin staining solution for 5min, washing with double distilled water for 1min, differentiating with hydrochloric acid for 30s, soaking in double distilled water for 15min, and staining with eosin staining solution for 2min;

(4) Dehydrating the dyed slices by using ethanol, and making the slices transparent by using dimethylbenzene;

(5) And (5) observing and photographing under a microscope.

As shown in FIG. 4, compared with the sham (sham) group, the vascular intima of mice in the LCCA group was significantly thickened and the luminal diameter was narrowed, and the vascular intimal hyperplasia in the recombinant shRhoGDI3 adenovirus treated group was significantly reduced and the luminal diameter was enlarged. The result shows that the knock-down of RhoGDI3 can obviously relieve the intimal hyperplasia and the vascular stenosis, and the recombinant shRhoGDI3 adenovirus can be used for treating cardiovascular diseases such as vascular restenosis and the like.

Sequence listing

<110> university of southeast university

<120> construction of shRNA adenovirus carrying human RhoGDI3 gene and application thereof

<130> 20200604

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 64

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

gatccgcctg aaggaaggtg ttgattattc aagagataat caacaccttc cttcaggttt 60

ttta 64

<210> 2

<211> 64

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

agcttaaaaa acctgaagga aggtgttgat tatctcttga ataatcaaca ccttccttca 60

ggcg 64

<210> 3

<211> 30

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

gatccgcctg aaggaaggtg ttgattattc 30

<210> 4

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

ggtgttgatt atctcttgaa taatcaac 28

Claims

1. Application of shRNA adenovirus carrying human RhoGDI3 gene in preparation of drugs for treating vascular diseases, wherein the adenovirus contains shRNA for inhibiting expression of the human RhoGDI3 gene, and the sequence of the shRNA is shown as SEQ ID NO.1 and SEQ ID NO. 2.

2. Use according to claim 1, characterized in that: the vascular disease is intimal thickening or restenosis.