CN109055376B - Medicine for treating HPV infection and application thereof - Google Patents

Medicine for treating HPV infection and application thereof Download PDF

Info

Publication number
CN109055376B
CN109055376B CN201810937864.4A CN201810937864A CN109055376B CN 109055376 B CN109055376 B CN 109055376B CN 201810937864 A CN201810937864 A CN 201810937864A CN 109055376 B CN109055376 B CN 109055376B
Authority
CN
China
Prior art keywords
crrna
cas13a
cells
cas
crispr
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Fee Related
Application number
CN201810937864.4A
Other languages
Chinese (zh)
Other versions
CN109055376A (en
Inventor
胡争
田瑞
樊惟文
陈怡李
金庄
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
First Affiliated Hospital of Sun Yat Sen University
Sun Yat Sen University
Original Assignee
First Affiliated Hospital of Sun Yat Sen University
Sun Yat Sen University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by First Affiliated Hospital of Sun Yat Sen University, Sun Yat Sen University filed Critical First Affiliated Hospital of Sun Yat Sen University
Priority to CN201810937864.4A priority Critical patent/CN109055376B/en
Publication of CN109055376A publication Critical patent/CN109055376A/en
Application granted granted Critical
Publication of CN109055376B publication Critical patent/CN109055376B/en
Expired - Fee Related legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/7105—Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/20—Antivirals for DNA viruses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/90—Stable introduction of foreign DNA into chromosome
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22—Ribonucleases RNAses, DNAses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Virology (AREA)
  • Veterinary Medicine (AREA)
  • Mycology (AREA)
  • Epidemiology (AREA)
  • Communicable Diseases (AREA)
  • Oncology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicinal Preparation (AREA)

Abstract

The invention discloses a medicine for treating HPV infection and application thereof, and the medicine is used for targeted editing of crRNA sequence of human papilloma virus E6 protein mRNA as shown in SEQ ID NO: 1 or SEQ ID NO: 2 is shown in the specification; the designed crRNA can be used for constructing a Crispr/Cas13a system and can be used for treating HPV infection.

Description

Medicine for treating HPV infection and application thereof
Technical Field
The invention belongs to the technical field of biomedicine, and particularly relates to a medicine for treating HPV infection and application thereof.
Background
HPV (human papilloma virus) is a spherical DNA virus that causes squamous epithelial proliferation of human skin mucosa. The early gene E6 of HPV is an oncogene, encoding a viral protein, and plays a crucial role in the process of cell transformation and maintaining the malignant phenotype of transformed tissues. According to the HPV infection part, the clinical classification is: the low-risk skin type, the high-risk skin type, the low-risk mucosa type and the high-risk mucosa type, wherein the high-risk mucosa type comprises HPV-16 subtype, HPV18 subtype and the like.
The Crispr/Cas technology is a technology capable of carrying out site-specific gene modification on a DNA sequence of a gene of interest in living cells or tissues, is an emerging targeted gene editing technology, and can influence the expression of the gene from the DNA level. Currently, most genes are modified using the criprpr/Cas 9 system to treat viral infections; however, the prior art does not disclose the use of the criprpr/Cas 9 system for treating HPV infections, and even less human uses the criprpr/Cas 13a system for modifying the treatment of HPV infections.
Disclosure of Invention
Aiming at HPV-16 subtype synthesized specific crRNA, the invention adopts a Crispr/Cas13a system to treat HPV infection.
In order to achieve the purpose, the invention adopts the technical scheme that: the sequence of the crRNA is shown as SEQ ID NO: 1 or SEQ ID NO: 2, respectively.
In addition, the invention also provides a Crispr/Cas13a system, which comprises the crRNA.
As an improvement of the technical scheme, the Crispr/Cas13a system further comprises an expression vector, wherein the expression vector is pACYC 184.
In addition, the invention also provides application of the crRNA in preparation of a medicament for treating HPV infection.
In addition, the invention also provides application of the Crispr/Cas13a system in preparation of a medicament for treating HPV infection.
In addition, the invention also provides a medicament for treating HPV infection, and the medicament comprises the crRNA.
As an improvement of the above technical scheme, the medicament further comprises a medicament carrier for conveying the crRNA to a target site, and the medicament carrier is a liposome.
In addition, the invention also provides a medicament for treating HPV infection, which comprises the Crispr/Cas13a system.
As an improvement of the technical scheme, the drug also comprises a drug carrier for conveying the Crispr/Cas13a system to a target site, and the drug carrier is a liposome.
The invention has the beneficial effects that: the invention provides a medicine for treating HPV infection and application thereof, the designed crRNA is used for constructing a Crispr/Cas13a system, and after the Crispr/Cas13a system is introduced into HPV16 positive cells, the Crispr/Cas13a system can specifically recognize and combine with an HPV16E6 sequence, thereby obviously reducing the expression level of HPV16E 6mRNA, obviously inhibiting the proliferation of HPV16 positive cells and promoting the apoptosis of the HPV16 positive cells; the crRNA and Crispr/Cas13a system constructed by the invention can be used for treating HPV infection.
Drawings
FIG. 1 shows targeted editing of high risk HPV E6mRNA by the Crispr/Cas13a system of the invention;
FIG. 2 shows the relative expression of HPV16E 6mRNA after transfection of Siha cells with Crispr/Cas13 a; in the figure, Blank represents no treatment, Vector represents empty Vector (Vector only, no crRNA);
figure 3 shows the rate of apoptosis of cells after criprpr/Cas 13a transfection; wherein the transfected cells in FIG. 3A are SiHa cells, the transfected cells in FIG. 3B are Hela cells, and the transfected cells in FIG. 3C are HEK293 cells; in the figure, Blank represents no treatment and Vector represents empty Vector (Vector only, no crRNA).
Detailed Description
To better illustrate the objects, aspects and advantages of the present invention, the present invention will be further described with reference to the following detailed description and accompanying drawings.
construction of crRNA and Cas13a expression vector
The sequence information of E6mRNA of HPV16 is obtained from NCBI website, and 3 pieces of crRNA are designed and respectively comprise: 16E6CR1, 16E6CR2 and 16E6CR3 against HPV16E6 protein; the bold part of the sequence is the coding gene sequence of DR (directrepeat) sequence of the crRNA, the underlined part is the coding gene sequence of spacer sequence of the crRNA, and the sequence is as follows:
16E6CR1：
Figure BDA0001767684520000031
atgatctgcaacaagacatacatcgaccas shown in SEQ ID NO: 1 is shown in the specification;
16E6CR2：
Figure BDA0001767684520000032
aaaagcaaagtcatatacctcacgtcgcas shown in SEQ ID NO: 3 is shown in the specification;
16E6CR3：
Figure BDA0001767684520000033
ttaatacacctaattaacaaatcacacaas shown in SEQ ID NO: 2 is shown in the specification;
the crRNA and LshCas13a sequences (Cas13 protein, namely C2C2 protein) are cloned to an expression vector pACYC184, eukaryotic expression vector plasmids of Cas13a are constructed, after construction is finished, the correctness and no mutation of the constructed vector sequences are determined through conventional sequencing comparison, and the completely correct clones are selected for amplification and plasmid extraction.
qRT-PCR verification of HPV E6mRNA transcript levels after Siha cells were transfected by Crispr/Cas13a
Sample RNA extraction
1) The lysed cells (the Siha cells transfected by Crispr/Cas13 a) were frozen and left at room temperature for 5min to be completely lysed;
2) adding 0.2ml of chloroform into each 1ml of TRIZOL reagent cracked sample, and tightly covering a tube cover; after the tube body is manually and violently oscillated for 15s, incubating for 2-3 min at 15-30 ℃; centrifuging at 12000rpm at 4 deg.C for 15 min; after centrifugation, the mixed liquid is divided into a lower red phenol chloroform phase, an intermediate layer and a colorless water phase, and all RNA is distributed into the water phase; the volume of the upper aqueous layer was approximately 60% of the TRIZOL reagent added during homogenization;
3) transferring the upper layer of the water phase into a clean centrifugal tube without RNase, adding equal volume of isopropanol, mixing to precipitate RNA in the water phase, uniformly mixing, incubating at 15-30 ℃ for 10min, and centrifuging at 12000rpm at 4 ℃ for 10 min; at this point, the invisible RNA precipitate formed a gelatinous pellet at the bottom and on the side walls of the tube before centrifugation;
4) removing the supernatant, adding at least 1ml of 75% ethanol (75% ethanol formulated with DEPCH 2O) to each 1ml of TRIZOL reagent lysed sample, and washing the RNA pellet; mixing, centrifuging at 4 deg.C at 7000rpm for 5 min;
5) carefully absorbing most of the ethanol solution, and drying the RNA precipitate in air at room temperature for 5-10 min;
6) when dissolving RNA, 40. mu.l of RNase-free water was added and the mixture was repeatedly blown with a gun several times to dissolve the RNA completely, and the obtained RNA solution was stored at-80 ℃ for further use.
Reverse transcription reaction
1) RT reaction liquid is prepared according to the following components (the preparation of the reaction liquid is carried out on ice):
5×PrimeScript RT Master Mix(Perfect Real Time) 2μl
Total RNA ≤500ng
Rnase Free dH2o is complemented to 10 mu l;
2) after gentle and uniform mixing, carrying out reverse transcription reaction under the following conditions:
15min at 37 ℃ (reverse transcription)
5s at 85 ℃ (inactivation of reverse transcriptase)
Storing at 4 deg.C;
3) preparing PCR reaction liquid according to the following components (the preparation of the reaction liquid is carried out on ice):
Figure BDA0001767684520000041
the PCR Forward Pimer sequence is: GAACAGCAATACAACAAACC, as shown in SEQ ID NO: 4 is shown in the specification; the sequence of the PCRReverse Pimer is: CTGCAACAAGACATACATCG is as set forth in SEQ ID NO: 5, respectively.
Applied Biosystems 7500Fast Real-Time PCR System was used for Real Time PCR reaction, and the reaction procedure used was a two-step PCR amplification standard: 30s at 95 ℃; 5s at 95 ℃, 30-34 s at 60 ℃ and 40 cycles.
As shown in fig. 2, when crRNA in the criprpr/Cas 13a system is 16E6CR2, the decrease in HPV16E 6mRNA expression level in transfected Siha cells is not significant; when the crRNA in the CRISPR/Cas13a system is 16E6CR1 or 16E6CR3, the expression level of HPV16E 6mRNA in transfected Siha cells is obviously reduced. Due to the fact that the mRNA transcription mechanism of the E6 protein in HPV is complex, the inhibition of the mRNA expression level of the E6 protein is difficult to regulate, and the invention unexpectedly discovers that 16E6CR1 and 16E6CR3 designed according to the sequence information of the E6 protein can obviously reduce the mRNA expression level of HPV16E 6.
Crispr/Cas13a induces apoptosis
Preparation of cells
HPV 16-Positive cervical cancer cell line SiHa, HPV 18-Positive cervical cancer cell line HeLa and human embryonic Kidney cell line HEK293 complete Medium with DMEM containing 10% serum at 37 ℃ with 5% CO2Culturing in an incubator. When the cell fusion degree reaches 80%, digesting with 0.25% pancreatin, stopping digestion with DMEM complete culture medium, inoculating into 12-well plate, and culturing for 24 h.
Co-transfection of expression plasmids
After 24h, the cells are well adhered, and the cell fusion degree reaches 70 percent, so that the transfection can be carried out. Mu.g of Cas13a and 1. mu.g of 16E6CR1 or 16E6CR3 were transfected per well using the X-tremeGENEHP DNA transfection reagent from Roche as per the instructions, with an equal amount of empty vector as negative control. The transfected cells were continued at 37 ℃ with 5% CO2Culturing in an incubator.
Detection of apoptosis following plasmid transfection
After 48h of transfection, SiHa cells transferred into Cas13a/16E6CR1 and Cas13a/16E6CR3 were observed under a phase-contrast microscope to be largely rounded and floating (indicating apoptosis), while HeLa and HEK293 cells also transferred into Cas13a/16E6CR1 and Cas13a/16E6CR3 did not. After digestion with 0.25% pancreatin, the cells were collected, centrifuged at 300g for 5min at room temperature, washed once with PBS, and centrifuged at 300g for 5min at room temperature. Apoptosis was detected by using the AnnexinV-FITC/PI apoptosis detection kit (cat # KGA-107) of Nanjing Kayji organisms and the CytoFLEX flow cytometer (Beckman Co.).
As shown in FIG. 3, SiHa apoptosis rate after transfection of Cas13a/16E6CR1 and Cas13a/16E6CR3 reaches 40%; compared with the untreated group and the untreated group which are transferred with the same amount of empty vector, the apoptosis rate of the HeLa cells after the transfection of the Cas13a/16E6CR1 and the Cas13a/16E6CR3 is not obviously increased; compared with the untreated group and the group transferred with the same amount of empty vector, the HEK293 cell apoptosis rate after the transfection of the Cas13a/16E6CR1 and the Cas13a/16E6CR3 is not obviously increased.
As shown in fig. 1 and fig. 3, the criprpr/Cas 13a system expressed after the Cas13a and 16E6CR1 and 16E6CR3 targeting HPV16E6 are co-transfected into cells can rapidly recognize and bind with a target mRNA sequence, and then perform cleavage, so that the target mRNA is cleaved, and finally the expression of HPV16E6 protein is inhibited. The E6 protein can enhance the proliferation capacity of the cervical cancer cells and escape apoptosis through a series of mechanisms, and after the expression of the E6 protein is inhibited, the proliferation capacity of the cells is reduced, and the apoptosis is increased. Cas13a/16E6CR1 and Cas13a/16E6CR3 can only specifically recognize and bind to HPV16E6 sequences, but cannot recognize E6 sequences of other subtypes such as HPV 18. Therefore, Cas13a/16E6CR1 and Cas13a/16E6CR3 can only cause apoptosis of HPV16 positive cells (such as SiHa cells), but do not have the effect on HPV18 positive cells (such as HeLa cells) and HPV negative cells (such as HEK293 cells) and the like.
Effect of Crispr/Cas13a on cell proliferation
1) Digesting SiHa, HeLa and HEK293 cells in logarithmic growth phase with 0.25% pancreatin, stopping digestion in DMEM complete culture medium containing 10% fetal bovine serum, counting, inoculating to 96-well plate, totally 5-well plate, setting 3 groups of each cell on each well plate, each group has 5 multiple wells, the number of each cell is 5000, continuing to perform at 37 deg.C and 5% CO2Culturing in an incubator;
2) after 24h of transfection, Cas13a/16E6CR1 and Cas13a/16E6CR3 expression plasmids or equivalent empty vector expression plasmids are transfected, and the preparation method of the transfection mixture is the same as the above; adding 100 mul of complete culture medium into each well of a 96-well plate, wherein the adding amount of a transfection mixture is 20 mul (corresponding to the total amount of plasmid is 0.4 mug), and co-transfecting 4 well plates;
3) to 5 wells of the 5 th well plate, 10. mu.l of CCK-8 reagent (CK 04, product number) was added per well (100. mu.l of medium), and alternatively 5 wells without cells were added, 100. mu.l of medium and 10. mu.l of CCK-8 reagent per well, as Blank control at the time of detection; after 2h of light-shielding culture at 37 ℃, detecting the absorbance value (0 d data) at 490nm by a multifunctional microplate reader, recording the data, and calculating the average value and the standard deviation;
4) at the same time of the 2d, taking a 96-pore plate, and processing in the same way of 3) to obtain 1d data; by analogy, detecting the absorbance value at 490nm on days 3, 4 and 5 respectively to obtain data of 2d, 3d and 4 d; since the culture medium is consumed by the long-term culture, attention should be paid to changing the culture medium after the 2 nd day to ensure that the total amount of the liquid before adding CCK-8 is 100 μ l;
5) and summarizing data, and calculating the proliferation inhibition rate.
The results show that Cas13a/16E6CR1 and Cas13a/16E6CR3 only specifically inhibit SiHa cell proliferation, but have no effect on HeLa and HEK293 cell proliferation.
Finally, it should be noted that the above embodiments are intended to illustrate the technical solutions of the present invention and not to limit the scope of the present invention, and although the present invention has been described in detail with reference to the preferred embodiments, it should be understood by those skilled in the art that modifications and equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention.
Sequence listing
<110> secondary first hospital of Zhongshan university
<120> a medicine for treating HPV infection and application thereof
<130>2018
<160>5
<170>PatentIn version 3.3
<210>1
<211>56
<212>DNA
<213> artificially synthesized sequence
<400>1
ccaccccaat atcgaagggg actaaaacat gatctgcaac aagacataca tcgacc 56
<210>2
<211>56
<212>DNA
<213> artificially synthesized sequence
<400>2
ccaccccaat atcgaagggg actaaaactt aatacaccta attaacaaat cacaca 56
<210>3
<211>56
<212>DNA
<213> artificially synthesized sequence
<400>3
ccaccccaat atcgaagggg actaaaacaa aagcaaagtc atatacctca cgtcgc 56
<210>4
<211>20
<212>DNA
<213> artificially synthesized sequence
<400>4
gaacagcaat acaacaaacc 20
<210>5
<211>20
<212>DNA
<213> artificially synthesized sequence
<400>5
ctgcaacaag acatacatcg 20

Claims (9)

1. The crRNA used for targeted editing of human papilloma virus E6 protein mRNA is characterized in that the sequence of the crRNA is shown as SEQ ID NO: 1 or SEQ ID NO: 2, respectively.
2. A criprpr/Cas 13a system, comprising the crRNA of claim 1.
3. The criprpr/Cas 13a system of claim 2, further comprising an expression vector which is pACYC 184.
4. Use of a crRNA according to claim 1 in the preparation of a medicament for the treatment of HPV16 infection.
5. Use of the criprpr/Cas 13a system of claim 2 or 3 in the manufacture of a medicament for the treatment of HPV16 infection.
6. A medicament for treating HPV16 infection, comprising the crRNA of claim 1.
7. The drug of claim 6, further comprising a drug carrier for delivering the crRNA to the target site, wherein the drug carrier is a liposome.
8. A medicament for treating HPV16 infection, comprising the criprpr/Cas 13a system of claim 2 or 3.
9. The drug of claim 8, further comprising a drug carrier for delivery of the criprpr/Cas 13a system to a target site, the drug carrier being a liposome.
CN201810937864.4A 2018-08-16 2018-08-16 Medicine for treating HPV infection and application thereof Expired - Fee Related CN109055376B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201810937864.4A CN109055376B (en) 2018-08-16 2018-08-16 Medicine for treating HPV infection and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201810937864.4A CN109055376B (en) 2018-08-16 2018-08-16 Medicine for treating HPV infection and application thereof

Publications (2)

Publication Number Publication Date
CN109055376A CN109055376A (en) 2018-12-21
CN109055376B true CN109055376B (en) 2020-06-05

Family

ID=64687282

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201810937864.4A Expired - Fee Related CN109055376B (en) 2018-08-16 2018-08-16 Medicine for treating HPV infection and application thereof

Country Status (1)

Country Link
CN (1) CN109055376B (en)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110548134A (en) * 2019-09-10 2019-12-10 中国医学科学院病原生物学研究所 Application of Cas13a in antagonizing viruses
CN113528514B (en) * 2020-04-22 2023-05-05 中国科学院分子植物科学卓越创新中心 CRISPR-Cas12a based technology for interfering and blocking reverse transcription transposition of viruses

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108048466A (en) * 2017-12-21 2018-05-18 嘉兴市第医院 The crRNA and system of CRISPR-Cas13a systemic characteristics targeting people's RSPO2 genes and application
CN108285905A (en) * 2017-12-15 2018-07-17 国家纳米科学中心 A kind of method and its application for inhibiting gene expression dose in eukaryocyte based on CRISPR-Cas13a

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108285905A (en) * 2017-12-15 2018-07-17 国家纳米科学中心 A kind of method and its application for inhibiting gene expression dose in eukaryocyte based on CRISPR-Cas13a
CN108048466A (en) * 2017-12-21 2018-05-18 嘉兴市第医院 The crRNA and system of CRISPR-Cas13a systemic characteristics targeting people's RSPO2 genes and application

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
CRISPR/Cas系统干扰HP16E6基因对SiHa细胞增殖和凋亡影响;朱承义等;《中华肿瘤防治杂志》;20150930;第22卷(第18期);第1445-1450页 *
RNA targeting with CRISPR-Cas13;Omar O. Abudayyeh等;《NATURE》;20171012;第550卷;第280-284页 *

Also Published As

Publication number Publication date
CN109055376A (en) 2018-12-21

Similar Documents

Publication Publication Date Title
CN109055376B (en) Medicine for treating HPV infection and application thereof
US20090258928A1 (en) Methods and compositions for diagnosing and modulating human papillomavirus (hpv)
Zhang et al. Micro ribonucleic acid‐93 promotes oncogenesis of cervical cancer by targeting RAB11 family interacting protein 1
JP2019517471A (en) Compositions and methods using MIR-302 precursor as an anti-cancer drug to treat human lung cancer
CN110699487B (en) Antisense RNA for diagnosing avian leukosis virus tumorigenesis, preparation method, application and primer for constructing over-expression vector
CN114836418A (en) CRISPR-Cas13d system for knocking down porcine epidemic diarrhea virus
CN109735539B (en) PDL1/PDL2 super-enhancer-based control method for regulating expression of PDL1 and PDL2
CN104404076B (en) The method that human papillomavirus E 6/E 7 gene is knocked out using Zinc finger nuclease
CN108949827B (en) shRNA lentiviral expression vector for specifically inhibiting lung cancer PPARd gene expression and construction method and application thereof
CN102229928B (en) Small-interfering RNA (Ribonucleic Acid) of human RBBP6 (Retinoblastoma-binding Proteingene) and application thereof
CN110964727A (en) shRNA lentiviral expression vector construction method for specifically inhibiting c-myc gene expression and application thereof
CN104357451A (en) Small interfering ribonucleic acid (siRNA) for DD3 gene, and construction and application of expression vector thereof
CN112941183B (en) Application of non-coding gene miR-187-5p in primary liver cancer diagnosis and treatment
CN116284315B (en) SSX polypeptide and application thereof in treating synovial sarcoma
CN115896112B (en) Method for constructing gene deletion cell strain by targeting sgRNA of knocked-out human TMEM121 gene and application
CN111228292B (en) Application of human TPT1/TCTP gene in preparation of antitumor drugs
CN106267208B (en) Application of RPS15A gene and related medicine thereof
CN110055249B (en) siRNA for reducing expression of THEM6 gene, recombinant vector and application thereof
CN111118154B (en) Application of LINC01272 in preparation of tumor detection reagent and/or treatment drug
CN110117593B (en) Application of nucleic acid, recombinant vector and recombinant lentivirus for specifically reducing FAM84B gene expression
CN104560992B (en) It is a kind of to be used to prevent and treat human papilloma virus infection and the Microrna of cervical carcinoma
CN110129321B (en) siRNA for reducing LSG1 gene expression, recombinant vector and application thereof
CN111789957B (en) Application of combination of knockdown lncBCAS1-4_1 cell line and active vitamin D in preparation of antitumor drugs
CN110042101B (en) siRNA for reducing ROGDI gene expression, recombinant vector and application thereof
CN109988764B (en) siRNA for reducing NKIRAS2 gene expression, recombinant vector and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant
CF01 Termination of patent right due to non-payment of annual fee

Granted publication date: 20200605