CN104531714A

CN104531714A - Gene expressing bevacizumab applicable to plant expression system, recombinant vector, and construction method and application of bevacizumab-producing plant

Info

Publication number: CN104531714A
Application number: CN201510035897.6A
Authority: CN
Inventors: 陈磊; 于为常
Original assignee: Shenzhen Research Institute of CUHK
Current assignee: Shenzhen Research Institute of CUHK
Priority date: 2015-01-23
Filing date: 2015-01-23
Publication date: 2015-04-22

Abstract

The invention belongs to the technical field of bioengineering, and discloses a gene expressing bevacizumab applicable to a plant expression system, a recombinant vector, and a construction method and application of a bevacizumab-producing plant. The gene expressing bevacizumab comprises a gene expressing a heavy chain of the bevacizumab and a gene expressing a light chain of the bevacizumab, wherein the gene expressing the heavy chain of the bevacizumab has a nucleotide sequence as shown in SEQ ID NO:1 or a nucleotide sequence obtained through substitution, deletion or addition of one or more nucleotides based on the nucleotide sequence as shown in SEQ ID NO:1; and the gene expressing the light chain of the bevacizumab has a nucleotide sequence as shown in SEQ ID NO:2 or a nucleotide sequence obtained through substitution, deletion or addition of one or more nucleotides based on the nucleotide sequence as shown in SEQ ID NO:2. The gene expressing the bevacizumab can be used for constructing a bevacizumab-producing plant expression system, and the obtained plant can express the bevacizumab. Thus, a novel method is provided for preparation of the bevacizumab.

Description

Be applicable to the gene of the expression rhuMAb-VEGF of plant expression system, recombinant vectors and produce construction process and the application of rhuMAb-VEGF plant

Technical field

The invention belongs to technical field of bioengineering, be particularly applicable to the gene of the expression rhuMAb-VEGF of plant expression system, recombinant vectors and produce construction process and the application of rhuMAb-VEGF plant.

Background technology

Along with molecular biological development, at the beginning of the eighties, scientists starts to utilize genetic engineering technique to develop antibody, and defines novel interdisciplinary technology---an antibody biotechnology (Antibodybiotechnology) gradually.It is with DNA recombinant technology for means, proceeds in eucaryon or prokaryotic cell prokaryocyte and express after being transformed artificially by the antibody gene that animal lymph cell produces, and produces and has immunocompetent antibody or its functional fragment.

At present, the expression system of genetic engineering antibody mainly contains mammalian cell, intestinal bacteria, yeast, insect and plant, and different expression systems cuts both ways.1) mammalian cell expression system: rat bone marrow tumour cell is optimal expressive host, in addition the clone in some bone-marrow-derived lymphocytes source is also had, these cells have the cell device of a whole set of complete synthesis, assembling, immunoglobulin,exocrine, can produce complete antibody molecule.The advantage of mammalian cell expression be antibody polypeptides chain correctly can be assembled, folding and glycosyl changes into activated entire molecule, the antibody of q.s can be expressed, but production cost is high.2) Escherichia coli system: intestinal bacteria have been widely used in expressing antibody function segment, and as Fab, Fv and scFv, but it can't express complete antibody molecule at present.Utilize escherichia coli expression small molecular antibody, there is the advantage that scale is large, speed is fast and cost is low, but a major issue in prokaryotic expression is how effectively to control to transcribe initial, carries out the expression envisioned.3) yeast expression system: yeast can be expressed effectively, assemble and secretion has immunocompetent antibody or its functional fragment, but because yeast is different from the modification situation of mammalian cell to the glycosylation of polypeptide, thus have impact on ACDC (relying on the cytotoxicity of complement-mediated of the antibody) effect of antibody, think the genetic engineering antibody expression system that yeast has been not at present.4) plant expression system: United States Medicine biologist Hiatt reported first in 1989 expression of antibody in plant.His result of study is the successful example that human use's foreign cell expresses antibody, has broken the boundary between animals and plants kind, has caused great interest and the great attention of organic sphere.Research shows, one large advantage of Expressing Antibodies in Plants total length heavy chain and light chain to be assembled into the whole antibody (and the maximum antibody fragment that intestinal bacteria can be assembled is monovalent Fab fragment) with Fc region, the functional identification antigen of these antibody capables conjugated antigen.

Research shows, in plant, give expression to the frontier that the whole antibody with functional identification antigen and binding characteristic or partial antibody fragment are antibody genetic engineering research, it has the following advantages: (1) high expression level amount.In plant, express antibody, the productive rate of recombinant antibodies can reach 4% of plant total protein, and this is that general eukaryotic expression system institute is inaccessiable; (2) low cost.Expressing recombinant antibody in plant, available extensive field planting, condition is relatively simple, cheap; (3) exogenous antibodies gene fragment can be integrated into genetic stability in karyomit(e), does not affect the growth of plant simultaneously; (4) transgenic plant strain can be preserved simply by the form of seed for a long time very much; (5) vegetable cell equally can carry out correct assembling and post-production to the recombinant antibodies albumen of expressing with mammalian cell, and its expression product can also keep good biological characteristics; The antibody of simultaneously expressing due to plant expression system exists with dimeric forms, and therefore the avidity of expression product is high, contributes to the function comprehensively playing antibody.

RhuMAb-VEGF, commodity are called Arastin (Avastin), are the Humanized monoclonal antibodies of restructuring, for the cancer therapy well selling medicine of Roche Holding Ag's research and development, produced by Chinese hamster ovary cell expression system, molecular weight is approximately 149,000 dalton.RhuMAb-VEGF obtains the approval of FDA on February 26th, 2004, and be that first, the U.S. gets the Green Light the medicine of Tumor suppression vasculogenesis of listing, its sales volume in 2009 reaches 5,900,000,000 dollars.Before approval is used for the treatment of mammary cancer, this medicine is also used for the treatment of lung cancer, colorectal carcinoma and the rectum cancer by the approval of pencil office of the U.S., and gets permission to be used for the treatment of mammary cancer in Europe.The mechanism of action of rhuMAb-VEGF is: by suppressing the hindrance blocks of vascular endothelial growth factor (Vascular Endothelial Growth Factor, VEGF) to the blood supply of tumour, Tumor suppression spreads in vivo, strengthens chemotherapy effect.VEGF is the key regulatory person of tumor-blood-vessel growth, and is unique a kind of angiogenesis factor being expressed in whole tumour life cycle.The continuous expression of VEGF, and the genetic stability of VEGF and endotheliocyte (observations based on preclinical study), " directly and continue target in VEGF " can be made to become a kind of important antitumor strategy, therefore, as the inhibitor of vascular endothelial growth factor, rhuMAb-VEGF action effect is good, applied range.But current rhuMAb-VEGF cost of manufacture is high, expensive, seriously limits its promotion and application, so also need to research and develop new rhuMAb-VEGF preparation method.As a kind of excellent gene engineering expression system, plant expression system is preferred rhuMAb-VEGF expression system beyond doubt.At present, also not about the report that the plant expression system producing rhuMAb-VEGF is relevant.

Summary of the invention

In view of this, goal of the invention of the present invention be to provide a kind of be applicable to the expression rhuMAb-VEGF of plant expression system gene, recombinant vectors and produce construction process and the application of rhuMAb-VEGF plant.Adopt the gene of expression rhuMAb-VEGF provided by the invention successfully to construct the plant expression system producing rhuMAb-VEGF, gained plant can express rhuMAb-VEGF, for the preparation of rhuMAb-VEGF provides novel method.

In order to realize goal of the invention of the present invention, the present invention adopts following technical scheme:

The invention provides a kind of gene being applicable to the expression rhuMAb-VEGF of plant expression system, it comprises the gene of expressing rhuMAb-VEGF heavy chain and the gene of expressing rhuMAb-VEGF light chain;

The gene of this expression rhuMAb-VEGF heavy chain has:

(I) nucleotide sequence as shown in SEQ ID NO:1;

Or (II) and described nucleotide sequence as shown in SEQ ID NO:1 have the >=sequence of 70% homology;

Or (III) nucleotide sequence as shown in SEQ ID NO:1 is substituted, lacks or adds the nucleotide sequence of one or more Nucleotide acquisition;

The gene of this expression rhuMAb-VEGF light chain has:

(i) nucleotide sequence as shown in SEQ ID NO:2;

Or (ii) has >=sequence of 70% homology with nucleotide sequence as shown in SEQ ID NO:2;

Or (iii) nucleotide sequence as shown in SEQ ID NO:2 is substituted, lacks or adds the nucleotide sequence of one or more Nucleotide acquisition.

In the present invention, the heavy chain of rhuMAb-VEGF has the aminoacid sequence as shown in SEQ ID NO:3.The light chain of rhuMAb-VEGF has the aminoacid sequence as shown in SEQ ID NO:4.

In some embodiments of the invention, the gene of the expression rhuMAb-VEGF heavy chain in the gene of expression rhuMAb-VEGF provided by the invention has the nucleotide sequence as shown in SEQ ID NO:1, is labeled as BHC.

In other embodiment of the present invention, the gene of the expression rhuMAb-VEGF light chain in the gene of expression rhuMAb-VEGF provided by the invention has the nucleotide sequence as shown in SEQ ID NO:2, is labeled as BLC.

Preferably, the gene of expression rhuMAb-VEGF provided by the invention the plant expression system that is suitable for, be specially paddy rice.In some embodiments of the invention, expression rhuMAb-VEGF provided by the invention gene the paddy rice that is suitable for be specially Japanese fine paddy rice.

Present invention also offers a kind of recombinant vectors, it is integrated with the gene of expression rhuMAb-VEGF heavy chain provided by the invention and/or the gene of described expression rhuMAb-VEGF light chain.

Express complete antibody with plant expression system and can adopt different strategies: one is heavy chain and light chain gene conversion of plant respectively, then obtains coexpression plant by sexual hybridization; Also with the carrier cotransformation same plant of two genes, can screen and obtain coexpression plant; Also can be gene constructed on same T-DNA two, render transgenic work is easier.Those skilled in the art can select suitable strategy according to practical situation, and then the combination of choice for use which or which recombinant vectors.

Preferably, in recombinant vectors provided by the invention, comprise the gene of described expression rhuMAb-VEGF heavy chain and the gene of described expression rhuMAb-VEGF light chain, i.e. plant binary expression vector, in the present invention, is called rhuMAb-VEGF plant binary expression vector.

Preferably, in recombinant vectors provided by the invention, carrier used is binary expression vector.

In some embodiments of the invention, in recombinant vectors provided by the invention, binary expression vector used is pBI serial carrier, pCAMBIA expression of plants serial carrier, pRTL serial carrier or the transformation product based on them.In other embodiment of the present invention, carrier used in recombinant vectors provided by the invention is specially plasmid pUN1301.

Preferably, being integrated in recombinant vectors provided by the invention is incorporated into the T-DNA region of used carrier.

Preferably, in recombinant vectors provided by the invention, in the gene of expression rhuMAb-VEGF heavy chain, the gene of expression rhuMAb-VEGF light chain, at least one is incorporated in described carrier with the form of expression cassette.

In some embodiments of the invention, in recombinant vectors provided by the invention, the gene of expressing rhuMAb-VEGF heavy chain and the gene of expressing rhuMAb-VEGF light chain are incorporated in described recombinant vectors with the form of expression cassette separately.In the present invention, the expression casette of expressing rhuMAb-VEGF heavy chain, expression casette the putting in order in recombinant vectors of expressing rhuMAb-VEGF light chain are not fixed.In some embodiments of the invention, in recombinant vectors provided by the invention, two expression cassettes arrange in the following order: express the expression casette of rhuMAb-VEGF heavy chain, express the tandem arrangement of the expression casette of rhuMAb-VEGF light chain.

In some embodiments of the invention, in recombinant vectors provided by the invention, the gene of expressing rhuMAb-VEGF heavy chain is incorporated in described recombinant vectors with the form of expression cassette, and this expression cassette comprises promotor, expresses gene, the terminator of rhuMAb-VEGF heavy chain.

Preferably, in recombinant vectors provided by the invention, when the gene of expressing rhuMAb-VEGF heavy chain is incorporated in recombinant vectors with the form of expression cassette, promotor used is constitutive promoter, organizing specific expression promotor or abduction delivering promotor.In some embodiments of the invention, promotor used is Ubi promotor, i.e. maize ubiquitin promoter.The promotor expressed in the expression casette of rhuMAb-VEGF heavy chain is not subject to the restriction of promotor provided by the invention, and those skilled in the art can select suitable promotor according to practical situation.

Preferably, in recombinant vectors provided by the invention, when the gene of expressing rhuMAb-VEGF heavy chain is incorporated in recombinant vectors with the form of expression cassette, terminator used is any type terminator.In some embodiments of the invention, terminator used is Nos terminator, i.e. nopaline syntase terminator.Express the terminator of the expression casette of rhuMAb-VEGF heavy chain not by the restriction of terminator provided by the invention, those skilled in the art can select suitable terminator according to practical situation.

In some embodiments of the invention, in recombinant vectors provided by the invention, the gene of expressing rhuMAb-VEGF light chain is incorporated in recombinant vectors with the form of expression cassette, and this expression cassette comprises promotor, expresses gene, the terminator of rhuMAb-VEGF light chain.

Preferably, in recombinant vectors provided by the invention, when the gene of expressing rhuMAb-VEGF light chain is incorporated in recombinant vectors with the form of expression cassette, promotor used is constitutive promoter, organizing specific expression promotor or abduction delivering promotor.In some embodiments of the invention, promotor used is Ubi promotor, i.e. maize ubiquitin promoter.Express the promotor of the expression casette of rhuMAb-VEGF light chain not by the restriction of promotor provided by the invention, those skilled in the art can select suitable promotor according to practical situation.

Preferably, in recombinant vectors provided by the invention, when the gene of expressing rhuMAb-VEGF light chain is incorporated in recombinant vectors with the form of expression cassette, terminator used is any type terminator.In some embodiments of the invention, terminator used is Nos terminator, i.e. nopaline syntase terminator.Express the terminator of the expression casette of rhuMAb-VEGF light chain not by the restriction of terminator provided by the invention, those skilled in the art can select suitable terminator according to practical situation.

Preferably, also riddled basins is integrated with in recombinant vectors provided by the invention.

Riddled basins is convenient to identify and screen the transformant or gained genetically engineered plants that import recombinant vectors, and the kind of riddled basins and number can be determined according to practical situation.

In other embodiment of the present invention, in recombinant vectors provided by the invention, riddled basins is incorporated in recombinant vectors with the form of expression cassette, and expression cassette comprises promotor, riddled basins, terminator.

In some embodiments of the invention, in recombinant vectors provided by the invention, when plant expression system used is paddy rice, riddled basins is wherein two, and one is hygromycin gene, is labeled as HptII; Another gene is beta-glucosiduronatase gene, is labeled as GUS.

In other embodiment of the present invention, in recombinant vectors provided by the invention, hygromycin gene is incorporated in recombinant vectors with the form of expression cassette, and expression cassette comprises promotor, hygromycin gene and terminator.In some embodiments of the invention, the promotor in hygromycin expression casette is 35S promoter, i.e. CaMV35S promotor.In other embodiment of the present invention, the terminator in hygromycin expression casette is T35S terminator, i.e. CaMV35S terminator.

In other embodiment of the present invention, in recombinant vectors provided by the invention, beta-glucosiduronatase gene is incorporated in recombinant vectors with the form of expression cassette, and expression cassette comprises promotor, beta-glucosiduronatase gene and terminator.In some embodiments of the invention, the promotor in beta-glucosiduronatase gene expression cassette is 35S promoter, i.e. CaMV35S promotor.In other embodiment of the present invention, the terminator in beta-glucosiduronatase gene expression cassette is Nos terminator, i.e. nopaline syntase terminator.

Preferably, in recombinant vectors provided by the invention, comprise the expression casette of rhuMAb-VEGF heavy chain, the expression casette of rhuMAb-VEGF light chain, hygromycin expression casette and beta-glucosiduronatase gene expression cassette.In recombinant vectors provided by the invention, the expression casette of rhuMAb-VEGF heavy chain, the expression casette of rhuMAb-VEGF light chain, hygromycin expression casette and putting in order of beta-glucosiduronatase gene expression cassette are not fixed.Can be connected by the nucleotide sequence of a section short between each expression casette, also can directly connect.In some embodiments of the invention, in recombinant vectors provided by the invention, four expression casettes are all incorporated into the T-DNA region of carrier, and these four expression casettes arrange in the following order: the tandem arrangement expressing beta-glucosiduronatase gene expression cassette, the expression casette of expression rhuMAb-VEGF heavy chain, the expression casette of expressing rhuMAb-VEGF light chain, hygromycin expression casette.In some embodiments of the invention, in recombinant vectors provided by the invention, four expression casettes, putting in order in recombinant vectors (5 '-3 ') as follows:

DNA molecular 1-DNA molecule 2-DNA molecule 3-DNA molecule 4

Wherein, DNA molecular 1 is for expressing beta-glucosiduronatase gene expression cassette, and DNA molecular 2 is the expression casette of expressing rhuMAb-VEGF heavy chain, and DNA molecular 3 is the expression casette of expressing rhuMAb-VEGF light chain, and DNA molecular 4 is hygromycin expression casette.Wherein DNA molecular 1, DNA molecular 2 are directly connected; DNA molecular 2, DNA molecular 3 are directly connected; DNA molecular 3, DNA molecular 4 are directly connected; And express the expression casette of rhuMAb-VEGF heavy chain, expression casette, the hygromycin expression casette of expression rhuMAb-VEGF light chain, the transcriptional orientation of these three expression casettes is identical, contrary with the transcriptional orientation of beta-glucosiduronatase gene expression cassette, by this recombinant vectors called after pUN1301-UBHLC.

Present invention also offers a kind of construction process of recombinant vectors provided by the invention, be integrated with in this recombinant vectors and express beta-glucosiduronatase gene expression cassette, express the expression casette of rhuMAb-VEGF heavy chain, express the expression casette of rhuMAb-VEGF light chain, hygromycin expression casette, four expression casettes are all incorporated into the T-DNA region of carrier, and these four expression casettes arrange in the following order: express beta-glucosiduronatase gene expression cassette, express the expression casette of rhuMAb-VEGF heavy chain, express the expression casette of rhuMAb-VEGF light chain, the tandem arrangement of hygromycin expression casette,

This construction process comprises the following steps:

Step 1: obtain a linker Nucleotide, a linker Nucleotide comprises following restriction enzyme site, and each restriction enzyme site arranges in the following order: SpeI-PacI-AscI-SacI-EcoRI-HindIII; Gained the one linker Nucleotide has nucleotide sequence as shown in SEQ ID NO:5, is cloned on carrier T pMD19simple, called after pMD19S-L by gained the one linker Nucleotide;

Step 2: obtain TNos terminator fragment, with SacI and EcoRI enzymolysis, be cloned on the pMD19S-L of step 1 gained, called after pMD19S-L-Tnos;

Step 3: obtain the gene of expressing rhuMAb-VEGF heavy chain, this gene has nucleotide sequence as shown in SEQ ID NO:1; The two ends of expressing the gene of rhuMAb-VEGF heavy chain at gained add restriction enzyme site PacI and AscI respectively, are cloned into pMD19S-L-Tnos afterwards, called after pMD19S-L-BHC-Tnos;

Step 4: take pUN1301 as template, amplified fragments Ubi promoter (i.e. Ubi promotor) makes its two ends introduce the restriction enzyme site of SpeI and PacI, step 3 gained pMD19S-L-BHC-Tnos is cloned into afterwards, called after pMD19S-L-UNBHC-Tnos with SpeI and PacI enzymolysis;

Step 5: obtain the 2nd linker Nucleotide, 2nd linker Nucleotide comprises following restriction enzyme site, and each restriction enzyme site arranges in the following order: HindIII*-SpeI-HindIII-BamHI, gained the 2nd linker Nucleotide has nucleotide sequence as shown in SEQ ID NO:6; Use HindIII and BamHI enzymolysis plasmid pUN1301, the 2nd linker Nucleotide is cloned on pUN1301, called after p1301-L; Use HindIII and BamHI enzymolysis plasmid p1301-L, use identical enzymolysis to be cloned on p1301-L PUbi promotor, called after pUN1301-L;

Step 6: obtain the gene of expressing rhuMAb-VEGF light chain, this gene has nucleotide sequence as shown in SEQ ID NO:2; After the two ends of the gene of gained expression rhuMAb-VEGF light chain add restriction enzyme site BamHI and SacI respectively, be cloned into pMD19simple, called after pMD19S-BLC;

Step 7: after using the two enzyme enzymolysis step 6 gained pMD19S-BLC and step 5 gained pUN1301-L of BamHI and SacI, gained is cloned on gained pUN1301-L containing the fragment expressing rhuMAb-VEGF light chain, called after pUN1301-L-BLC;

Step 8: use the two enzyme enzymolysis step 4 gained pMD19S-L-BHC-Tnos of SpeI and HindIII, obtain UNBHC-Tnos fragment; After using the two enzyme enzymolysis step 7 gained pUN1301-L-BLC of SpeI and HindIII, gained UNBHC-Tnos fragment is cloned on pUN1301-L-BLC, obtains recombinant vectors, namely obtain recombinant vectors, called after pUN1301-UBHLC.

Present invention also offers a kind of construction process producing rhuMAb-VEGF plant, it comprises the following steps:

Step 1: obtain the gene of expressing rhuMAb-VEGF heavy chain and the gene of expressing rhuMAb-VEGF light chain; The gene of this expression rhuMAb-VEGF heavy chain has nucleotide sequence as shown in SEQ ID NO:1 or the nucleotide sequence shown in SEQ IDNO:1 has >=and the sequence of 70% homology or the nucleotide sequence shown in SEQ ID NO:1 be substituted, lack or add the nucleotide sequence that one or more Nucleotide obtains;

The gene of this expression rhuMAb-VEGF light chain has nucleotide sequence as shown in SEQ ID NO:2 or the nucleotide sequence shown in SEQ ID NO:1 has >=and the sequence of 70% homology or the nucleotide sequence shown in SEQ ID NO:2 be substituted, lack or add the nucleotide sequence that one or more Nucleotide obtains;

Step 2: get step 1 gained and express the gene of rhuMAb-VEGF heavy chain, express the gene of rhuMAb-VEGF light chain, build rhuMAb-VEGF plant binary expression vector;

Step 3: step 2 gained rhuMAb-VEGF plant binary expression vector is imported plant tissue cell, through cultivating, screening, to obtain final product.

Preferably, in construction process provided by the invention, in step 3, plant tissue cell used is specially rice tissue cell.

Preferably, in construction process provided by the invention, in the rhuMAb-VEGF plant binary expression vector in step 2, be also integrated with riddled basins.In other embodiment of the present invention, when plant tissue cell used in step 3 is specially rice tissue cell, two riddled basins are integrated with: one is hygromycin gene, and another gene is beta-glucosiduronatase gene in rhuMAb-VEGF plant binary expression vector in step 2.

In some embodiments of the invention, in construction process provided by the invention, in rhuMAb-VEGF plant binary expression vector in step 2, express at least one gene in the gene of rhuMAb-VEGF heavy chain, the gene of expressing rhuMAb-VEGF light chain, hygromycin gene, beta-glucosiduronatase gene and be incorporated in plant binary expression vector with the form of expression cassette.

In some embodiments of the invention, in construction process provided by the invention, the rhuMAb-VEGF plant binary expression vector in step 2 is integrated with the expression casette of rhuMAb-VEGF heavy chain, the expression casette of rhuMAb-VEGF light chain, hygromycin expression casette and beta-glucosiduronatase gene expression cassette.In construction process provided by the invention, in rhuMAb-VEGF plant binary expression vector, the expression casette of the expression casette of rhuMAb-VEGF heavy chain, rhuMAb-VEGF light chain, hygromycin expression casette and putting in order of beta-glucosiduronatase gene expression cassette are not fixed.Can be connected by the nucleotide sequence of a section short between each expression casette, also can directly connect.In some embodiments of the invention, in construction process provided by the invention, in rhuMAb-VEGF plant binary expression vector, four expression casettes are all incorporated into the T-DNA region of plant binary expression vector, and these four expression casettes arrange in the following order: express beta-glucosiduronatase gene expression cassette, express the expression casette of rhuMAb-VEGF heavy chain, the tandem arrangement of the expression casette of expressing rhuMAb-VEGF light chain, hygromycin expression casette.In some embodiments of the invention, in construction process provided by the invention, four expression casettes, putting in order in rhuMAb-VEGF plant binary expression vector (5 '-3 ') as follows:

DNA molecular 1-DNA molecule 2-DNA molecule 3-DNA molecule 4

Wherein, DNA molecular 1 is for expressing beta-glucosiduronatase gene expression cassette, and DNA molecular 2 is the expression casette of expressing rhuMAb-VEGF heavy chain, and DNA molecular 3 is the expression casette of expressing rhuMAb-VEGF light chain, and DNA molecular 4 is hygromycin expression casette.Wherein DNA molecular 1, DNA molecular 2 are directly connected; DNA molecular 2, DNA molecular 3 are directly connected; DNA molecular 3, DNA molecular 4 are directly connected; And express the expression casette of rhuMAb-VEGF heavy chain, expression casette, the hygromycin expression casette of expression rhuMAb-VEGF light chain, the transcriptional orientation of these three expression casettes is identical, contrary with the transcriptional orientation of beta-glucosiduronatase gene expression cassette.

In some embodiments of the invention, in construction process provided by the invention, the rhuMAb-VEGF plant binary expression vector in step 2 is specially pUN1301-UBHLC.

In other embodiment of the present invention, in construction process provided by the invention, import the method adopted in step 3 and be specially agrobacterium-mediated transformation.

Present invention also offers the application that a kind of expression of plants utilizing construction process provided by the invention to build the product rhuMAb-VEGF obtained obtains rhuMAb-VEGF.

The invention provides a kind of be applicable to the expression rhuMAb-VEGF of plant expression system gene, recombinant vectors and produce construction process and the application of rhuMAb-VEGF plant.The gene of expression rhuMAb-VEGF provided by the invention, comprises the gene of expressing rhuMAb-VEGF heavy chain and the gene of expressing rhuMAb-VEGF light chain; The gene of this expression rhuMAb-VEGF heavy chain has nucleotide sequence as shown in SEQ ID NO:1 or the nucleotide sequence shown in SEQ ID NO:1 has >=and the sequence of 70% homology or the nucleotide sequence shown in SEQ ID NO:1 be substituted, lack or add the nucleotide sequence that one or more Nucleotide obtains; The gene of this expression rhuMAb-VEGF light chain has nucleotide sequence as shown in SEQ ID NO:2 or the nucleotide sequence shown in SEQ ID NO:2 has >=and the sequence of 70% homology or the nucleotide sequence shown in SEQ ID NO:2 be substituted, lack or add the nucleotide sequence that one or more Nucleotide obtains.Experimental result confirms, adopt the gene of expression rhuMAb-VEGF provided by the invention successfully to construct the paddy rice producing rhuMAb-VEGF, gained paddy rice can express rhuMAb-VEGF, prepares rhuMAb-VEGF provide novel method for utilizing plant expression system.

Accompanying drawing explanation

Plasmid involved in recombinant vectors process or the collection of illustrative plates of fragment is built in Fig. 1 embodiment 1;

Wherein, Fig. 1-A is carrier pMD19S-L; Fig. 1-B is carrier pMD19S-L-Tnos; Fig. 1-C is carrier pMD19S-L-BHC-Tnos; Fig. 1-D is carrier pMD19S-L-UNBHC-Tnos; Fig. 1-E is carrier pUN1301; Fig. 1-F is carrier p1301-L; Fig. 1-G is carrier pUN1301-L; Fig. 1-H is carrier pUN1301-L-BLC; Fig. 1-J is carrier pUN1301-UBHLC; Fig. 1-K is the T-DNA structure of carrier pUN1301-UBHLC;

Fig. 2 is GUS dyeing qualification result in embodiment 2, and wherein WT represents wild rice callus sample, and No. 1-6 pipe is different transgenic resistance callus samples;

Fig. 3 is PCR qualification result in embodiment 2, and wherein Vector is the plant binary expression vector of rhuMAb-VEGF is positive control; WT is wild rice DNA is negative control, and 1-15 is different transgenic paddy rice strain;

Fig. 4 is Southern blot qualification result in embodiment 2, wherein (a) for rhuMAb-VEGF heavy chain gene be that probe carries out hybridization gained band; (b) for rhuMAb-VEGF light chain gene be that probe carries out hybridization gained band; (c) for hygromycin gene be that probe carries out hybridizing the band obtained; WT is wild rice DNA sample; Swimming lane 1 to swimming lane 14 is different transgenic paddy rice DNA sample;

Fig. 5 is Northern blot qualification result in embodiment 2, and wherein swimming lane WT is wild rice RNA is negative control, and swimming lane 1-7 is different transgenic paddy rice RNA;

Fig. 6 is Western Blot qualification result in embodiment 2, and wherein swimming lane WT is wild rice albumen, and swimming lane 1-8 is different transgenic paddy rice samples.

Embodiment

The invention discloses a kind of be applicable to the expression rhuMAb-VEGF of plant expression system gene, recombinant vectors and produce construction process and the application of rhuMAb-VEGF plant.Those skilled in the art can with reference to present disclosure, obtain gene, the recombinant vectors of expressing rhuMAb-VEGF, realize its application, special needs to be pointed out is, all similar replacements and change apparent to those skilled in the art, they are all deemed to be included in the present invention.Preparation method of the present invention and application are described by preferred embodiment, related personnel obviously can not depart from content of the present invention, spirit and scope this paper preparation method and application are changed or suitably change with combination, realize and apply the technology of the present invention.

Provided by the invention a kind of be applicable to the expression rhuMAb-VEGF of plant expression system gene, recombinant vectors and produce used reagent and raw material in the construction process of rhuMAb-VEGF plant and application and all can be buied by market.

In order to enable those skilled in the art understand technical scheme of the present invention better, below in conjunction with embodiment, set forth the present invention further:

Embodiment 1 expresses the structure of the recombinant vectors of rhuMAb-VEGF

Experiment material:

Various restriction enzyme is purchased from NEB (http://www.neb-china.com/search.asp);

Ubi promotor and Tnos fragment derive from pUN1301;

PMD19simple plasmid is purchased from TaKaRa company (http://www.takara.com.cn/);

PUC57 plasmid is purchased from GenScript company (http://www.genscript.com/);

PUN1301 plasmid is purchased from Jin Weike (China) biotechnology center;

Hygromycin gene probe derives from pUN1301.

Experimental technique:

Express the gene of rhuMAb-VEGF heavy chain, express the acquisition of the gene of rhuMAb-VEGF light chain:

Codon optimized and synthesize rhuMAb-VEGF heavy chain and light chain gene with paddy rice, wherein, the gene of expressing rhuMAb-VEGF heavy chain has the nucleotide sequence as shown in SEQ ID NO:1; The gene of expression rhuMAb-VEGF light chain has the nucleotide sequence as shown in SEQ ID NO:2; Submitting gained gene sequence information to GenScript company synthetic gene fragment, is BHC by the genetic marker of expression rhuMAb-VEGF heavy chain, is BLC by the genetic marker of expression rhuMAb-VEGF light chain.The gene BHC that gained expresses rhuMAb-VEGF heavy chain is kept on plasmid pUC57, and this synthetic vectors is labeled as pUC57-BHC; The gene BLC that gained expresses rhuMAb-VEGF light chain is kept on plasmid pUC57, and this synthetic vectors is labeled as pUC57-BLC.

The structure of rhuMAb-VEGF binary expression vector:

1. design and synthesis Linker-1 (i.e. a linker Nucleotide): it comprises following restriction enzyme site, and restriction enzyme site puts in order as follows: SpeI-PacI-AscI-SacI-EcoRI-HindIII (it has nucleotide sequence as shown in SEQ IDNO:5), be cloned on carrier T pMD19simple, by gained recombinant vectors called after pMD19S-L, its plasmid map is shown in Fig. 1-A.

Concrete operations are:

Synthesize following Nucleotide:

Linker-1a：5’actagt ttaattaa ct ggcgcgcc gagctc ac gaattc aagctt a 3’；

Linker-1b：5’aagctt gaattc gt gagctc ggcgcgcc ag ttaattaa actagt a 3’；

By mole mixing such as Linker-1a and Linker-1b, 94 DEG C of 5min, are slowly cooled to room temperature, get 4.5 μ L and connect carrier T pMD19simple.

2. get TNos fragment, use SacI and EcoRI enzymolysis, be cloned on the pMD19S-L of step 1 gained, by gained recombinant vectors called after pMD19S-L-Tnos, its plasmid map is shown in Fig. 1-B.

3. with synthetic vectors pUC57-BHC for template, pcr amplification BHC fragment makes its two ends add restriction enzyme site Pac I and AscI, the fragment afterwards gained being contained BHC is cloned into step 2 gained pMD19S-L-Tnos, by gained recombinant vectors called after pMD19S-L-BHC-Tnos, and sequence verification, sequencing result is correct, and its plasmid map is shown in Fig. 1-C.

4. be template with pUN1301, design primer amplification fragment Ubi promoter also makes its two ends introduce the restriction enzyme site of SpeI and PacI, step 3 gained pMD19S-L-BHC-Tnos is cloned into SpeI and PacI enzymolysis, by gained recombinant vectors called after pMD19S-L-UNBHC-Tnos, and sequence verification, sequencing result is correct, and its plasmid map is shown in Fig. 1-D.

5. design and synthesis Linker-2 (i.e. the 2nd linker Nucleotide): it comprises following restriction enzyme site, and restriction enzyme site puts in order as follows: HindIII*-SpeI-HindIII-BamHI (it has nucleotide sequence as shown in SEQ ID NO:6).HindIII and BamHI enzymolysis plasmid pUN1301 is used (this plasmid to be integrated with gus gene expression cassette, HptII expression casette, its plasmid map is shown in Fig. 1-E), be cloned into by Linker-2 by gained recombinant vectors called after p1301-L on pUN1301, its plasmid map is shown in Fig. 1-F.

Concrete operations are:

Synthesize following Nucleotide:

Linker-2a：5’agcta actagt ct aagctt ac g3’；

Linker-2b：5’gatcc gt aagctt ag actagt t3’；

By mole mixing such as Linker-2a and Linker-2b, 94 DEG C of 5min, are slowly cooled to room temperature, get 10 μ L and are connected to the pUN1301 using HindIII and BamHI enzymolysis, obtain p1301-L.

Use HindIII and BamHI enzymolysis plasmid p1301-L, after promotor Ubi promoter is used identical enzymolysis, be cloned on p1301-L, by gained recombinant vectors called after pUN1301-L, its plasmid map is shown in Fig. 1-G.

6. with synthetic vectors pUC57-BLC for template, pcr amplification BLC fragment makes its two ends add restriction enzyme site BamHI and SacI, and afterwards gained is cloned into pMD19simple containing the fragment of BLC, called after pMD19S-BLC, and sequence verification, the result is correct.

7. use the two enzyme enzymolysis step 6 gained pMD19S-BLC and step 5 gained pUN1301-L of BamHI and SacI respectively, be cloned on gained pUN1301-L by gained BLC fragment, called after pUN1301-L-BLC, its plasmid map is shown in Fig. 1-H.

8. use the two enzyme enzymolysis step 7 gained pUN1301-L-BLC and step 4 gained pMD19S-L-BHC-Tnos of SpeI and HindIII respectively, gained fragment UNBHC-Tnos is cloned on pUN1301-L-BLC, obtain final carrier, called after pUN1301-UBHLC, its plasmid map is shown in Fig. 1-J, its T-DNA structure is shown in Fig. 1-K, and this structure comprises the nucleotide sequence (this nucleotides sequence column direction is that the LB end of T-DNA is to RB end) as shown in SEQ ID NO:7.

Embodiment 2 produces the structure of rhuMAb-VEGF plant

Experiment material:

Rice paddy seed " Japan is fine " is conventional transgenic material.

Agrobacterium (EHA105) derives from: Shanghai steps its bio tech ltd.

N ₆d ₂substratum: 3.9g/L Chu ' s N6 (Chu, 1975) (CHP01-50LT, 10402809, Caisson, USA), N6 VITAMIN, (2mg/L glycine, 0.5mg/L nicotinic acid, 1.0mg/L VITMAIN B1,0.5mg/L vitamins B ₆), 0.1g/L inositol, 1.0g/L caseinhydrolysate, 0.5g/L proline(Pro), 0.5g/L glutamine, 2mg/L 2,4 dichlorophenoxyacetic acid (2,4-D), 30g/L sucrose, 1M KOH regulates pH5.8,3.0g/L plant gel, 121 DEG C, 220KPa, sterilizing 20 minutes.

N ₆d ₂-Co substratum: N ₆d ₂in add 10g/L glucose, 1M KOH regulates pH5.5,3.0g/L plant gel, and 121 DEG C, 220KPa, sterilizing 10 minutes, treats that substratum is cooled to 50 DEG C, adds the Syringylethanone (Acetosyringone, AS) of 200uM.

N ₆d ₂-Se substratum: N ₆d ₂substratum is cooled to 50 DEG C, 121 DEG C, 220KPa, sterilizing 20 minutes, adds 50mg/L hygromycin B and 500mg/L cephamycin.

MS-Re substratum: 4.6g/L MS (M10400-50.0, P06968, rpi, USA), 2.0mg/L 6-benzyl aminoadenine (6-BA), 0.5mg/L naphthylacetic acid (NAA), 1.0mg/L kinetin (KT), 30g/L sucrose, 30g/L sorbyl alcohol, 1M KOH regulates pH5.8,3.0g/L Gelrite, 121 DEG C, 220KPa, sterilizing 20 minutes, is cooled to 50 DEG C, adds 50mg/L hygromycin B and 500mg/L cephamycin.

MS-HF substratum: 2.3g/L MS (M10400-50.0, P06968, rpi, USA), 30g/L sucrose, 1M KOH adjusts pH5.8,3.0g/L Gelrite, and 121 DEG C, 220KPa, sterilizing 20 minutes, is cooled to 50 DEG C, adds 50mg/L hygromycin B.

AAM substratum: 0.5g/L caseinhydrolysate, 68.5g/L sucrose, 36g/L glucose, 0.9g/L glutamine, 0.3g/L aspartic acid, 3g/L Repone K, 10mg/L Manganese sulfate pentahydrate, 3.0mg/L boric acid, 2.0mg/L Zinc Sulphate Heptahydrate, the acid of 0.25mg/L molybdate dihydrate is received, 0.025mg/L cupric sulfate pentahydrate, 0.025mg/L CoCL2 6H2O, 0.75mg/L potassiumiodide, 15mg/L Calcium dichloride dihydrate, 25mg/L magnesium sulfate heptahydrate, 4mg/L ethylenediamine tetraacetic acid (EDTA) (EDTA), 15mg/L sodium dihydrogen phosphate dihydrate, 1mg/L nicotinic acid, 1mg/L vitamins B ₆, 10mg/L vitamins B ₁, 100mg/L inositol, 176mg/L arginine, 75mg/L glycine, 1M KOH regulates pH to 5.2,0.22uM membrane filtration degerming.

Reagent needed for Southern blot:

Denaturation buffer: 20g/L NaOH, 87.75g/L NaCl;

Neutralization buffer: 60.05g/L Tris (Tutofusin tris), 87.75g/L NaCl, the concentrated hydrochloric acid of 37% regulates pH7.2;

Transfering buffering liquid (20 × SSC): 175.3g/L NaCl, 88.2g/L trisodium citrate, 4M hydrochloric acid regulates pH7.0;

Elution buffer W1:2 × SSC; 0.1%SDS (sodium laurylsulfonate) (M/V);

Elution buffer W2:0.5 × SSC; 0.1%SDS;

Elution buffer W3:11.607g/L toxilic acid, 8.775g/L NaCl, by solid NaoH adjust ph to 7.5, with front adding 0.3% polysorbas20;

Detect damping fluid S3:12.1g/L Tris, 5.85g/L NaCl, regulate pH 9.5;

Hybridization solution: 70g/L SDS, 50% methane amide, 25%20XSSC, 2% skim-milk (Roche), 50mL 1M sodium phosphate buffer (pH7.2), 1.0g/L dodecyl musculamine acid sodium;

Confining liquid S1:1% skim-milk (M/V) is dissolved in elution buffer W3;

DigiTAb reaction solution S2: Anti-Digoxigenin-AP is centrifugal 5 minutes with 10000 rpms, draws upper solution and is dissolved in confining liquid S1 with 1:10000.

The preparation of Northern blot damping fluid and reagent:

10 × MOPS electrophoretic buffer: with 700mL water dissolution 41.8g propanesulfonic acid (MOPS), with 2mol/LNaOH adjust pH to 7.0; Add 20mL 1mol/L sodium acetate and 20mL 0.5mol/L EDTA (pH8.0); With water constant volume to 1L; Add 1mL DEPC process spend the night after filtration sterilization;

RNA denaturation buffer: get 0.8mL 10 × MOPS electrophoretic buffer, add 2mL methane amide, 1.3mL37% formaldehyde, 0.04mL 0.5M EDTA, constant volume is to 4mL, and-20 DEG C save backup;

5 × BPB-Solution: bromjophenol blue (0.2%); Glycerine (50%); 1 × MOPS;

Elution buffer W3 solution: 0.1 × SSC; 0.1%SDS.

Experimental technique:

1. the induction of Rice Callus:

Fine for the Japan of maturation rice paddy seed is shelled, the alcohol disinfecting with 75% 30 seconds, then sterilize 25 minutes with 5% chlorine bleach liquor, rinsed with sterile water 3 times, puts on aseptic paper, Bechtop dries up, be inoculated in N ₆d ₂on callus inducing medium, each culture dish inoculates 15, and in 28 DEG C of light culture 4 weeks, period excision radicle, every two weeks subcultures once, obtained the callus of compact structure, for subsequent use.

2. the activation of agrobacterium tumefaciens:

1) Example 1 gained rhuMAb-VEGF binary expression vector pUN1301-UBHLC, is transformed in Agrobacterium EHA105, must have transformed the Agrobacterium of rhuMAb-VEGF plasmid.

Concrete operations are:

(1) agrobacterium tumefaciens competent cell is prepared

1. the mono-colony inoculation of picking EHA105 adds in the YEB liquid nutrient medium of 50mg/L Rif in 5mL, 28 DEG C, 200rpm shaking culture spends the night.

2. get 2mL bacterium liquid to proceed in 50mL YEB liquid nutrient medium and continue to be cultured to OD ₆₀₀be 0.3 ~ 0.4.

3. sterile centrifugation tube is proceeded to, ice bath 30min.

4. the centrifugal 5min of 5000rpm, abandons supernatant.

5. 2mL 20mmol/L CaCl is added ₂resuspended thalline.

6. often pipe 200 μ L is sub-packed in sterile centrifugation tube.In liquid nitrogen, proceed to-70 DEG C of Refrigerator stores after quick-frozen, first put during use and thaw on ice.

(2) by Recombinant Plasmid DNA into Agrobacterium tumefaciens EHA105

1. get the plasmid DNA of 2 μ g purifying, i.e. pUN1301-UBHLC, add in the competence EHA105 that 200 μ L thaw, mixing.

2. ice bath 5min, proceeds to freezing 1min in liquid nitrogen, puts rapidly 37 DEG C of water-bath 5min.

3. 800 μ L YEB liquid nutrient mediums are added, 28 DEG C, 250rpm preculture 4 ~ 5h.

4. centrifugal, reservation about 200 μ L supernatant liquors and bacterial sediment mix the YEB solid selection medium moving to additional 50mg/LRif, 50mg/L Km, the whole flat board of even spread with robbing head.After liquid is absorbed, seal with sealed membrane, be inverted cultivation 1 ~ 2d, 4 DEG C of preservations for 28 DEG C.

5. picking list colony inoculation adds in 7mL in the YEB liquid nutrient medium of 50mg/L Rif, 50mg/L Km, and 28 DEG C, 200rpm shaking culture is about 24h.

6. get 5mL bacterium liquid and extract plasmid, the plasmid solution getting more amount carries out enzyme and cuts detection, and residue bacterium liquid is kept in 4 DEG C.Cut the correct plasmid of qualification through enzyme, get the Agrobacterium bacterium liquid of its correspondence, add the glycerine that final concentration is 15%, mixing, be sub-packed in sterile centrifugation tube, every 50 μ L mono-manage, in liquid nitrogen, put into-70 DEG C of Refrigerator stores after quick-frozen.

2) Agrobacterium (EHA105) card be seeded in containing 50mg/L having transformed rhuMAb-VEGF plasmid is received in the LB liquid nutrient medium of mycin and 50mg/L Rifampin, 28 DEG C, rotating speed 200 rpms of shaking culture 18 hours.

3) 1mL step 2 is got) the cultured Agrobacterium of gained is placed in the centrifuge tube of 2mL sterilizing, rotating speed 6000 rpms, centrifugal 5 minutes, collect thalline, with the resuspended thalline of AAM liquid nutrient medium of 200 μ L, get 10 μ L bacterium liquid and be inoculated into 50mL and contain in the AAM liquid nutrient medium of 200 μMs of AS (Syringylethanone), 28 DEG C, rotating speed 160 rpms of shaking culture 2 hours, in order to the use of conversion.

3. Agrobacterium-mediated Transformation paddy rice embryo callus:

1) contaminate; Choose the callus particle (step 1 prepares) that diameter is the compact structure of 3 ~ 5mm, in the AAM bacterium liquid prepared, contaminate 10min;

2) Dual culture; Callus after contaminating is placed on bacterium liquid aseptic filter paper sucking tissue surface, is forwarded to Dual culture base N ₆d ₂on-Co, 26 DEG C of light culture 3 days;

3) select to cultivate; By the rinsed with sterile water 5 time of the Dual culture callus of 3 days containing 0.01% tween, then rinsing 10 minutes in containing the sterilized water of 500mg/L cephamycin, callus is placed on aseptic filter paper, Bechtop dries the water on callus, then be forwarded to Selective agar medium N ₆d ₂on-Se, 28 DEG C of light culture surroundings, obtain resistant calli;

4) differentiation culture; Be forwarded to by resistant calli on division culture medium MS-Re, 16 h light, 8 h dark, 28 DEG C are cultured to and differentiate green seedling.Be forwarded to by seedling on the bottled root media MS-HF of use sterilizing, after cultivating 2 weeks, the substratum cleaned on little shoot root forwards in water and cultivates 3 days, is then transplanted to land for growing field crops, to obtain 30 strains altogether, to be labeled as T1# to T30# respectively.

4. the qualification of rhuMAb-VEGF transgenic paddy rice:

4.1.GUS dyeing qualification rhuMAb-VEGF transgenic paddy rice:

Get the blade of the transgenic plant being transplanted to large Tanaka, the segment being cut into 2cm is placed in the centrifuge tube of 2mL; Resistant calli tweezers are divided into fritter, immerse (100mM sodium phosphate buffer in GUS staining fluid, pH=7.0, include 0.5mg/mL X-GluC, 1%Triton X-100,1%DMSO and 10mMEDTA), vacuumize 15min, 37 DEG C of insulation 12h, the ethanol decolorization with 85% several times, is taken pictures.

Detected result is shown in Fig. 2, and wherein WT represents wild rice callus sample, and No. 1-6 pipe is the resistant calli sample of different transgenic paddy rice strains, and the strain that wherein 1-6 represents respectively is: T1#, T2#, T3#, T4#, T5#, T6#.

From detected result, compare wild rice, the resistant calli sample of all transgenic paddy rices all creates macroscopic blueness, illustrates that beta-glucosiduronatase gene has successfully imported in transgenic paddy rice, has reacted the gene of expressing rhuMAb-VEGF and has also successfully imported in paddy rice.

4.2.PCR rhuMAb-VEGF transgenic paddy rice is identified:

PCR reaction soln is formulated as:

Premix Ex Taq Hot Start Version 10 μ L, genomic dna 500ng (transgenic paddy rice extraction), each 1 μ L of light chain, heavy chain forward and reverse primer 10 μMs, distilled water constant volume is to 20 μ L.PCR program is: 95 DEG C 5 minutes; 95 DEG C 20 seconds, 60 DEG C 20 seconds, 72 DEG C 1.5 minutes, 30 circulations; 72 DEG C 5 minutes.After PCR reaction terminates, get 5 μ L reaction solution electrophoresis detection.

PCR primer sequence used is:

Light chain forward primer, BLCFw:5 ' ATGAAGTACCTCCTCCCTACC3 ';

Light chain reverse primer, BLCRe:5 ' GCATTCGCCTCGGTTAAAGCTC3 ';

Heavy chain forward primer, BHCFw:5 ' ATGGAATTCGGATTGAGCTGG3 ';

Heavy chain reverse primer, BHCRe:5 ' CTTCCCCGGGCTGAGGCTAAG 3 ';

Detected result is shown in Fig. 3, and wherein Vector is the plant binary expression vector of rhuMAb-VEGF is positive control; WT is wild rice DNA is negative control, and 1-15 is different transgenic paddy rice strain, and the strain that 1-15 represents respectively is: T1#, T2#, T3#, T4#, T5#, T6#, T7#, T8#, T9#, T10#, T11#, T12#, T13#, T14#, T15#.From detected result, use the PCR primer molecular size range that obtains during its total length primer amplification to be then its full length gene size (the light chain gene total length of rhuMAb-VEGF be 708bp, heavy chain gene total length be 1416bp), the gene of gene and the expression rhuMAb-VEGF light chain successfully having imported and expressed rhuMAb-VEGF heavy chain is described in transgenic paddy rice strain.

4.3.Southern blot identifies rhuMAb-VEGF transgenic paddy rice:

1) prepare the probe of digoxigenin labeled: with rhuMAb-VEGF binary expression vector DNA for template, forward and reverse primer of light chain and heavy chain increases the probe of the digoxigenin labeled preparing light chain and heavy chain respectively.

PCR reaction soln is: plasmid DNA 10ng is as template, and light chain and the forward and reverse primer of heavy chain 10 μMs each 1 μ L, Premix Ex Taq Hot Start Version 15 μ L, the DIG-dUTP of 1 μ L, distilled water constant volume is to 30 μ L.Pcr amplification reaction program is: 95 DEG C 5 minutes; 95 DEG C 20 seconds, 60 DEG C 20 seconds, 72 DEG C 1.5 minutes, 30 circulations; 72 DEG C 5 minutes.After PCR reaction terminates, get 3 μ L reaction solution electrophoresis detection.

2) enzymolysis of rhuMAb-VEGF trans-genetic hybrid rice STb gene is turned: turn rhuMAb-VEGF trans-genetic hybrid rice blade STb gene 15 μ g, carry out enzymolysis with EcoR I restriction enzyme, 37 DEG C of reactions are spent the night.The enzyme digestion reaction system of each sample is: STb gene 15 μ g, CutSmart damping fluid 10 μ L, the EcoR I restriction enzyme of 100U, distilled water constant volume 100 μ L.Wherein using wild rice genomic dna as negative control, rhuMAb-VEGF binary expression vector is positive control.After enzyme digestion reaction terminates, loading 5 μ L carries out electrophoresis detection, purifying, is dissolved in 15 μ L distilled waters, 4 DEG C of for subsequent use or-20 DEG C of preservations.

3) electrophoresis of enzymolysis product: the enzymolysis product after purifying is splined on 1.0% sepharose, with 5V/cm electrophoresis 3 hours; Take pictures, the position of tagged molecule amount; Gel is put in 0.2N hydrochloric acid process 10 minutes, with distilled water rinsing once; Put into denaturation buffer process 30 minutes; Put into neutralization buffer process 30 minutes.

4) DNA is imprinted onto Hybond membrane: according to the size of sepharose, the sizeable Hybond membrane of clip, soaks with distilled water; Sheet glass is placed on pallet, gets 1 3M filter paper, soaks with transfering buffering liquid, put on a glass, removes the bubble in filter paper and sheet glass.Appropriate transfering buffering liquid is added in pallet; Gel is placed on filter paper, removes the bubble between gel and imprinting surface; Hybond membrane is placed on above gel, and is again vented bubble; Be placed on Hybond membrane after 2 3M filter paper (slightly larger than Hybond membrane) transfering buffering liquid is drenched; Around glue, put a circle insurance film, prevent the liquid in liquid pool from flowing directly to tissue layer (i.e. " short circuit " phenomenon) above gel.Filter paper is put a folded thieving paper, and then press the object of heavily about 300g, transfer is spent the night; Hybond membrane rinsing in the transfering buffering liquid of dilution 10 times once, is dried under being placed in super clean bench, dries 2 hours in 80 DEG C of baking ovens.

5) hybridize: roll wetting for the film aqua sterilisa after baking, put into hybrid pipe, add 30mL hybridization solution, be placed on 42 DEG C of prehybridizations 2 hours; Outwell prehybridization solution, then add the new hybridization solution of 10mL in 42 DEG C of preheatings; Take out ready-made probe, thawed on ice, joins in the hybridization solution of preheating, 42 DEG C of hybridized overnight.

6) aftertreatment is hybridized: pour out hybridization solution, pour 100mL elution buffer W1 in hybrid pipe into, under room temperature, wash-out 5 minutes, repeats once.Outwell elution buffer W1, add 100mL elution buffer W2, in 65 DEG C of wash-outs 15 minutes, repeat once; Take out film, put into the little square position being covered with preservative film, add elution buffer W3, wash-out 5 minutes; Outwell elution buffer W3, add 50mL confining liquid S1, incubated at room 15 minutes; Outwell confining liquid S1, add 10mL DigiTAb reaction solution S2, hatch 15 minutes; Film is taken out and puts into another box, add 100mL elution buffer W3, wash-out 15 minutes under room temperature, repeat wash-out once; Add the detection damping fluid S3 of 20mL, hatch 5 minutes; Outwell and detect damping fluid S3, add 2mL CSPD and hatch 5 minutes; Being taken out by film is laid on preservative film, is wrapped up, is placed on 37 DEG C and hatches 5 minutes.

7) development and fixing: the film wrapped is placed in camera obscura, X-film is placed on the film wrapped in dark place, close secretly press from both sides, 37 DEG C placement 30 minutes; Return in darkroom and take out film, put into developing solution and soak 2 minutes, at Shui Zhongchong once, then put into stop bath and soak 2 minutes, develop photographic film in flowing water, taking-up is dried.

Detected result is shown in Fig. 4, wherein sepharose (a) for rhuMAb-VEGF heavy chain gene be that probe carries out hybridization gained band; (b) for rhuMAb-VEGF light chain gene be that probe carries out hybridization gained band; (c) for hygromycin gene be that probe carries out hybridizing the band obtained; Swimming lane WT is wild rice DNA sample; Swimming lane 1 to swimming lane 14 is different transgenic paddy rice DNA sample, and the strain that 1-14 represents respectively is: T1#, T2#, T3#, T4#, T5#, T6#, T7#, T8#, T9#, T10#, T11#, T12#, T13#, T14#.Detected result shows: rhuMAb-VEGF heavy chain gene is the hybridising band that probe carries out hybridizing the 2.3kb obtained containing heavy chain gene segment; RhuMAb-VEGF light chain gene is the hybridising band that probe carries out hybridizing the 1.6kb obtained containing light chain gene segment.Hygromycin gene is that probe carries out hybridization and draws: wherein 1,8,13 (i.e. T1# strain, T8# strain, T13# strains) are for singly to copy transgenic event; 3,7,11,12 (i.e. T3# strain, T7# strain, T11#, T12# strains) are two copy transgenic events; Other are multiple copied transgenic event.The reason that between different strain, expression amount is different is: in different transgenic lines, T-DNA is radom insertion being incorporated in genome, and the copy number inserted also can be different.Impact due to transgene location effect makes expression amount between different transgenic lines there is difference, and gene transcription level is different and then cause the difference of expressing quantity.

Detected result shows, has successfully imported the gene of expressing rhuMAb-VEGF heavy chain, expresses the gene of rhuMAb-VEGF light chain in the DNA of transgenic paddy rice.

4.4.Northern blot analyzes the expression of rhuMAb-VEGF heavy chain gene

1) extraction of rice total RNA: adopt RNeasy Mini Kit Qiagen RNA to extract test kit and extract total serum IgE.

2) detection and quantitatively of rice total RNA quality: sample thief 1 μ L is splined in 0.8% sepharose, after the about 5min of 120V voltage, observes under ultraviolet lamp.Time quantitative, sample thief 1 μ L+99 μ L DEPC H ₂o, after mixing, Eppendorfs nucleic acid quantification detector (Eppendorfs AG22331, Hamburg) is surveyed the absorption value at 260nm, 280nm place, calculates output and the concentration of RNA.

3) denaturing treatment of RNA sample: get 1 μ g plasmid DNA and carry out enzymolysis, do positive control; Get 15 μ gRNA, add the Denaturation Buffer of equivalent; Get 3 μ g RNA Marker, the plasmid DNA that 40 ~ 80pg enzyme cuts, also adds the Denaturation Buffer of equivalent respectively simultaneously.60 DEG C of incubation 20min, put cooled on ice.

4) the formaldehyde gel denaturing electrophoretic of RNA: by the closed at both ends of scotch tape by offset plate, inserts glue comb; Join glue (1.5%), in Erlenmeyer flask, add 110mL DEPC H ₂o, 15mL 10 × MOPS electrophoretic buffer, 2.25g agarose, heating and melting, after being cooled to 65 DEG C, adding the formaldehyde solution of 25mL 37%, pours offset plate into, treat that it solidifies; In electrophoresis chamber, add 1 × MOPS electrophoretic buffer, glue is put into electrophoresis chamber; Get the sample that sex change is good, add BPB-Solution and the 1 μ L EB of 0.2 times of volume, mixing point sample, 70V electrophoresis 3.5h.

5) transferring film: glue is placed on DEPC-H ₂oscillation treatment 15min in O; Observe under ultraviolet lamp, take pictures, the position of tagged molecule amount, cuts glue; All the other steps are with Southern Blot.

6) Northern blot analyzes: hybridization temperature is 50 DEG C, and elution buffer W3 replaces the W2 of Southern Blot, and all the other steps are with Southern Blot.

Detected result is shown in Fig. 5, and wherein swimming lane WT is wild rice RNA is negative control, and to be the strain that different transgenic paddy rice RNA, 1-7 represent respectively be swimming lane 1-7: T1#, T2#, T3#, T4#, T5#, T6#, T7#.From experimental result, transgenic paddy rice all expresses rhuMAb-VEGF heavy chain, and the expression amount of the transgenic line wherein corresponding to swimming lane 5 is the highest, and the expression amount of the transgenic line corresponding to swimming lane 1 is minimum.

4.5.Western Blot analyzes the expression of rhuMAb-VEGF in transgenic paddy rice

1) sample preparation: with transgenic paddy rice blade for material, grind in liquid nitrogen.Take the ground leaf tissue of 30mg and add 30 μ L 2 × SDS damping fluids, vortex vibrates, and 70 DEG C of incubations 10 minutes, 13000 rpms centrifugal 10 minutes, gets supernatant in new centrifuge tube.

2) electrophoretic separation: sheet glass, sample comb, Spacer washing composition are cleaned, uses ddH ₂o rinses for several times, then uses ethanol, dries.Add Spacer by between two pieces of clean sheet glass, install sheet glass according to the prompting of Bio-RadMini II/III specification sheets.10% separation gel 8.0mL is prepared, mixing: 3.0mL ddH by such as lower volume ₂o; 2.1mL 1.0mol/LTris-HCl pH=8.8; 2.8mL 30%Acr-Bis; 80 μ L10%SDS; 56 μ L 10%AP; 6 μ L TEMED.To between sheet glass, record separation gel, cover one deck redistilled water immediately, glue and polymerizable after about 20 minutes.By glue 3.0mL as concentrated in lower volume preparation 6%, mixing: 2.0mL ddH ₂o; 400 μ L 1.0mol/LTris-HCl pH=6.8; 600 μ L 30%Acr-Bis; 36 μ L 10%SDS; 24 μ L 10%AP; 4 μ L TEMED.Inclined by upper strata redistilled water, filter paper blots, and records concentrated glue, inserts sample comb.After gelling is poly-, slowly extract sample comb.Install electrophoresis system, add electrode buffer, loading 10 μ L, 100V electrophoresis 2 hours.

3) transferring film: unload offset plate, peels off glue, is dipped in transfering buffering liquid by glue and balances 10min.According to the size clip film of glue and filter paper 6, pvdf membrane is put into methyl alcohol and soak saturated 3-5 and put into transfering buffering liquid second and balance 10min.Assembling transfer sandwich: be followed successively by 3 metafiltration paper, glue, pvdf membrane, 3 metafiltration paper from bottom to top, every layer put well after, to rush bubble with test tube.Plug electrode, 20V, 45 minutes.After transferring film terminates, cut off the electricity supply, take out Hybond membrane.

4) immuning hybridization and colour developing: film is put into distilled water and soak 10 minutes, takes out the confining liquid incubated at room 1 hour putting into 20mL 5% skim-milk.Add Peroxidase-conjugatedaffinipure Goat Anti-Human IgG (H+L) antibody (buying in Protein Tech company) of dilution 2000,4 DEG C are slowly shaken overnight incubation.15mL TBS-T washes 3 times, each 5min.Protein Detection (according to the operation of ThermoPierce ECL Western Blotting Substrate test kit).

Detected result is shown in Fig. 6, and wherein, swimming lane WT is wild rice albumen, and swimming lane 1-8 is different transgenic paddy rice samples, and the strain that 1-8 represents respectively is: T1#, T2#, T3#, T4#, T5#, T6#, T7#, T8#; Wherein band H size is about 50KDa, consistent with rhuMAb-VEGF heavy chain size; Band L size is about 25KDa, consistent with rhuMAb-VEGF light chain size.From detected result, different transgenic paddy rice all expresses rhuMAb-VEGF heavy chain and light chain.

Comprehensive above detected result is known, and the present embodiment have successfully been obtained the transgenic paddy rice of expressing rhuMAb-VEGF, and gained paddy rice can express rhuMAb-VEGF, prepares rhuMAb-VEGF provide novel method for utilizing plant expression system.

Below be only the preferred embodiment of the present invention, it should be pointed out that above-mentioned preferred implementation should not be considered as limitation of the present invention, protection scope of the present invention should be as the criterion with claim limited range.For those skilled in the art, without departing from the spirit and scope of the present invention, can also make some improvements and modifications, these improvements and modifications also should be considered as protection scope of the present invention.

Claims

1. be applicable to a gene for the expression rhuMAb-VEGF of plant expression system, it is characterized in that, it comprises the gene of expressing rhuMAb-VEGF heavy chain and the gene of expressing rhuMAb-VEGF light chain;

The gene of described expression rhuMAb-VEGF heavy chain has:

(I) nucleotide sequence as shown in SEQ ID NO:1;

The gene of described expression rhuMAb-VEGF light chain has:

(i) nucleotide sequence as shown in SEQ ID NO:2;

2. a recombinant vectors, is characterized in that, it is integrated with the gene of expression rhuMAb-VEGF heavy chain as claimed in claim 1 and/or the gene of described expression rhuMAb-VEGF light chain.

3. recombinant vectors according to claim 2, is characterized in that, described carrier is binary expression vector.

4. the recombinant vectors according to Claims 2 or 3, is characterized in that, described in be integrated into the T-DNA region being incorporated into described carrier.

5. the recombinant vectors according to any one of claim 2 to 4, is characterized in that, in the gene of described expression rhuMAb-VEGF heavy chain, the gene of described expression rhuMAb-VEGF light chain, at least one is incorporated in described carrier with the form of expression cassette.

6. recombinant vectors according to claim 5, it is characterized in that, the gene of described expression rhuMAb-VEGF heavy chain is incorporated in described carrier with the form of expression cassette, and described expression cassette comprises gene, the terminator of promotor, described expression rhuMAb-VEGF heavy chain.

7. the recombinant vectors according to claim 5 or 6, it is characterized in that, the gene of described expression rhuMAb-VEGF light chain is incorporated in described carrier with the form of expression cassette, and described expression cassette comprises gene, the terminator of promotor, described expression rhuMAb-VEGF light chain.

8. recombinant vectors as claimed in any of claims 2 to 7, is characterized in that, is wherein also integrated with riddled basins.

9. produce a construction process for rhuMAb-VEGF plant, it is characterized in that, comprise the following steps:

Step 1: obtain the gene of expression rhuMAb-VEGF heavy chain as claimed in claim 1 and the gene of described expression rhuMAb-VEGF light chain;

Step 2: the gene getting the gene of described expression rhuMAb-VEGF heavy chain, described expression rhuMAb-VEGF light chain, builds rhuMAb-VEGF plant binary expression vector;

Step 3: described rhuMAb-VEGF plant binary expression vector is imported plant tissue cell, through cultivating, screening, to obtain final product.

10. the application of the expression of plants acquisition rhuMAb-VEGF utilizing construction process as claimed in claim 9 to build the product rhuMAb-VEGF obtained.