CN107557384A - A kind of genetic conversion system for inducing plant to downgrade and its structure and application - Google Patents

Abstract

The invention discloses a kind of genetic conversion system for inducing plant to downgrade and its structure and application, the genetic system is the genetic conversion system that SIP1 family genes induction plant is downgraded；The structure of the system includes（1）The extraction of tomato RNA；（2）The RNA reverse transcriptions of the genes of SlGT 33；（3）The clone of the genes of SlGT 33 and the structure of silence expression vector.The application of the system is to be used to induce tomato plant to downgrade.The genetic conversion system of present invention induction dwarfing plants can be used to cultivate tomato dwarfed plant, obtained tomato plant have can high-density planting, make full use of space and soil, strengthen photosynthetic efficiency, improve yield, low water consumption rate, it is resistant to lodging the advantages that.

Description

A kind of genetic conversion system for inducing plant to downgrade and its structure and application

Technical field

The present invention relates to a kind of genetic conversion system for inducing plant to downgrade and its structure and application, particularly a kind of induction The genetic conversion system and its structure and it cultivates the method for tomato dwarfed plant using this that plant is downgraded.

Background technology

Tomato (scientific name：Solanum lycopersicum Mill.var) belong to annual or herbaceos perennial, strain High 1-2 rice；Winglike compound leaf or drastic crack；Stem easily lodges；Cyme；Berry.Tomato originates from the Andes area of South America, Still there are most of wild species to be distributed on Peru, Ecuador and other places.Tomato can grow, tie in the case of long-day and short-day Real, suitable raw temperature range is wider, requires not strict to edaphic condition, nowadays, the main vegetable that tomato has been planted as world wide Dish crop.Dwarfing plants are a kind of important economical characters, because its can high-density planting, make full use of space and soil, strengthen Photosynthetic efficiency, the advantage such as yield, low water consumption rate, resistant to lodging is improved, is an important research side for breeding high-yield kind To.Induce the factor downgraded more, including cultivation step, growing environment, introduce a fine variety, biological regulator, virus and mutagenesis etc., And still there is limitation the problems such as caused safety issue, the long-term effect of mutagenesis, thorough Analysis on Mechanism in mutagenic processes.Kind The dwarfing research of eggplant just has started to from the middle period of eighties of last century, and at present, the exploration of dwarfing plants is progressively from biological regulator point Analyse to genetic research transition, a variety of dwarf-type tomato mutating varieties are particularly found that, such as Micro-Tom, Tom Thumb, Dwarf stone etc..Transgenic technology is to obtain the important channel of inheritance stability dwarfted varieties.Many phases with downgrading Correlation gene is accredited：It can be led after protein coding gene mutation in the approach such as the synthesis of gibberellin, signal transduction, metabolic regulation Plant is caused to downgrade, this is metabolized the gene variation phase in route of synthesis with bioactive substances such as sterol parahormone, auxin, polyamines Seemingly.

The transcription factor being had found in plant kingdom has kind more than 60, such as bHLH, MADS-box, MYB, WD40, WRKY, AP2/ ERF, YABBY, HB-box and NAC etc..Kato etc. has found that NAC families transcription factor ANAC036 genes are mainly in the leaf of arabidopsis Expressed in piece, overexpression ANAC036 genes generate the plant of half dwarfing；In rice, CYTOKININ- is overexpressed RESPONSIVE GATA TRANSCRIPTION FACTOR1 (Cga1) gene induces the Chlorophyll synthesis of plant leaf blade, and leads Plant half is caused to downgrade；HLH transcription factor INCREASED LEAF INCLINATION1 in Brassinosteroids signal pathway The overexpression of BINDING bHLH1 (IBH1) gene causes the serious dwarfing of plant；Deng.It can be seen that in the tune that grows of plant In control, transcription factor has played vital effect.However, up to the present, the correlation of Trihelix transcription factor families Contribution of the gene in terms of dwarfed plant is cultivated has not been reported.

The Research progress on Function of GT-1 subfamily genes：GT-1 is the Trihelix transcription factors being found first.GT members Part finds and separated in pea photoresponse gene rbs-3A promoter regions first, and the promoter region is Box II.Then, Also GT elements are contained in the promoter of other non-photoresponse genes, as identical promoters sequence (GT-2box and GT-3box) is present In the phyA promoters of rice, it can activate the expression of related gene in dark situation.The function of GT-2 subfamily genes is ground Study carefully progress：GT-2 name is derived from it and contains two DNA binding domain homologous with GT-1.The function of the subfamily gene is more Powerful, the resistance of its major function and plant, the development of floral organ are relevant.It is reported that the function of SH4 subfamily genes with from The development of layer is related.The function of GT γ subfamily genes is related to the environment stress of plant.

The functional study of SIP1 subfamily genes is found：Kitakura etc. reports that tobacco NtSIP1 transcribes as Trihelix Another subfamily gene of factor family is found, and it promotes the combination of 6b albumen and downstream gene promoter, realizes plant The cell propagation of thing.ASIL1 (Arabidopsis 6b-interacting protein 1-like1) and arabidopsis 2S3 starts Sub-district interaction.Asil1 mutant have accumulated 2S albumin and fatty acid grease, and this is closely similar with the lipid in seed.Gao Show that ASIL1 identifies GT elements Deng research, repeated with 2S RY very close.Kuromori etc. is pointed out, is deposited in SIP1 subfamilies In a fusion, i.e. 3 ' the terminal fusions coded sequence of aspartic acid/glutamate/uridine kinase.In arabidopsis and In rice, these genes exist in Parent.Although the function of this fusion has not determined, they induce plant short Change, and form light green and lopsided leaf.The results of study such as Geraldo are shown, contains only the albumen of coiled-coil structures FRIGIDA (FRI) has raised the gene expression for repressor FLOWERING LOCUS C (FLC) of blooming, and causes plant to receive Vernalization treatment and the custom for spending winter.The small subunit for being mutated cap binding protein cap-binding complex (CBC) suppresses FRI activity.CBC can be with FRI in vivo and external direct interaction, and the substantial connections of this cap sequences of FRI and 5 ' can be by The rapid cDNA of RNA ligase mediation is expanded to confirm.Missing CBC20 weakens FLC expression, improves FLC shearings mRNA Content.FRI, which can recover this missing, to be influenceed, and recovered part FLC expression and shear ability.Although the gene with Trihelix families have no direct contact, but coiled-coil structures cause it to be assigned to SIP1 subfamilies.However, arrive mesh Before untill, Trihelix transcription factor family SIP1 subfamilies gene induction dwarfing plants research also have no report.

Therefore, in the prior art, cultivate tomato dwarfed plant to have not been reported so that existing tomato plant is present can not be high Density is planted, it is impossible to make full use of space and soil, photosynthetic efficiency is low, yields poorly, and water rate is high, it is not resistant to lodging the problems such as.

The content of the invention

It is an object of the present invention to provide a kind of genetic conversion system and its structure that induce plant to downgrade.The present invention lures The genetic conversion system for leading dwarfing plants can be used to cultivate tomato dwarfed plant, and obtained tomato plant has can high density kind Plant, make full use of space and soil, strengthen photosynthetic efficiency, improve yield, low water consumption rate, it is resistant to lodging the advantages that.

Technical scheme：A kind of genetic conversion system for inducing plant to downgrade, the genetic system is SIP1 family The genetic conversion system that race gene induction plant is downgraded.

A kind of construction method for the genetic conversion system that foregoing induction plant is downgraded, including (1) SlGT-33 genes RNA extraction；(2) the RNA reverse transcriptions of SlGT-33 genes；(3) clone of SlGT-33 genes；(4) structure of silent carrier.

In the construction method for the genetic conversion system that foregoing induction plant is downgraded, the extraction of described tomato RNA；It is kind Eggplant tissue is put into liquid nitrogen is put into mortar after quick-frozen 10~20s, after grinding, takes 98-102mg powder to be put into 1.5mL centrifuge tubes, 0.8-1.2mL RNAiso Plus extracts reagents are added, concussion mixes, and after being stored at room temperature 4-6min, mixed liquor is at 3-5 DEG C 13100rpm centrifuges 4-6min, and Aspirate supernatant 880-920 μ L are put into new 1.5mL centrifuge tube, and add chloroform 245-265 μ L, after mixing, normal temperature stands 4-6min；12500-13500rpm centrifuges 13-17min at 3-5 DEG C of mixed liquor, draws For the superiors supernatant liquid 180-220 μ L in new 1.5mL centrifuge tube, it is the different of 99-100% to add 180-220 μ L concentration Propyl alcohol, mixing of turning upside down, is stored at room temperature 4-6min, and 13000-13200rpm at 3-5 DEG C of mixed liquor is centrifuged into 8-12min, fallen Fall supernatant, and add 1mL70 ethanol, 13000-13200rpm centrifuges 50-70s at 3-5 DEG C, outwells supernatant, blots residual Liquid, normal temperature standing and drying；The μ l of deionized water 20~30 dissolvings of sterilizing are added after to be dried, are produced.

In the construction method for the genetic conversion system that foregoing induction plant is downgraded, the RNA of described SlGT-33 genes is anti- Transcription；It is the reagent for adding following reaction system in the centrifuge tube of sterilizing under sterile environment：Tomato RNA 0.8-1.2 μ L, primer 1.8-2.2 μ L, deionized water 10-12 μ L, the centrifuge tube for having added reagent is put into PCR instrument, 74-76 DEG C of incubation 4- 6min；Incubation is put into rapidly cooled on ice 4-6min after terminating, and adds 4-6 times of buffer buffer solutions (5 × Reaction Buffer) after 4 μ L, dNTP2 μ L, moloney murine leukemia virus reverse transcriptase 0.8-1.2 μ L and deionized water 8-10 μ L, it is placed on The upper 40-44 DEG C of incubation 50-70min of PCR, then 70-74 DEG C of incubation 8-12min is increased to, take out, subzero 20 DEG C of preservations；Described Primer is 1.8-2.2mmoL/L oligodT.

In the construction method for the genetic conversion system that foregoing induction plant is downgraded, the clone of described SlGT-33 genes； It is as follows using primer SlGT-33-F and SlGT-33-R amplification tomato dna SlGT-33, reaction system reagent：2× PrimeSTAR Mix, 12.5 μ L；SlGT-33-F, 1.0 μ L；SlGT-33-R, 1.0 μ L；The μ L of cDNA templates 1.0；The μ of sterilized water 9.5 L；After adding well, expanded after being placed in PCR instrument, the condition of amplification is as follows：98 DEG C of denaturation, 2min；58 DEG C, 30s of renaturation, piece Section fixes 72 DEG C, 10min, obtains PCR amplified production；

The structure of described silent carrier；It is that PCR amplified production is connected on pMD18-T carriers, is sequenced, is cloned The coded sequence of fragment, restriction enzyme site, synthetic primer SlGT-33-F and SlGT-33-R, respectively with positive and anti-are added in 5' To mode be connected on intermediate carrier pHANNIBAL, be then attached on whole carrier pBIN19, acquisition contain SlGT-33 bases The silence of cause expresses whole carrier；Described SlGT-33-F is：5'CTTCCTGTTCACGACCCTTC 3'；Described SlGT-33- R：5'CTCTCAATTTTGGACCCCC 3'.

The genetic conversion system application that described induction plant is downgraded before a kind of, for inducing tomato plant to downgrade.

It is described to be used to induce tomato plant to downgrade in the genetic conversion system application that preceding described induction plant is downgraded； It is that SlGT-33 gene transfers infect tomato cotyledon to Agrobacterium and Agrobacterium.

In the genetic conversion system application that preceding described induction plant is downgraded, described SlGT-33 gene transfers to agriculture bar Bacterium；It is 50mg/L rifampins and the YEB of 500mg/L streptomysin solid medium in content by Agrobacterium LBA4404 strain Upper line, cultivated 2-3 days at 25-30 DEG C；Escherichia coli HB101/pRK2013 (Helper) strain is containing 5050mg/L's Rule on the culture medium of kanamycins, be sealed in 35-39 DEG C of incubator and cultivate 16-18h, taken containing SlGT-33 genes Silence expresses whole carrier monoclonal in the culture dish of the YEB culture mediums without antibiotic, forms the bacterial plaque of 0.4-0.6cm length, Then mixing for Helper bacterial strains and Agrobacterium and whole carrier is taken in the same way, after mixing, at 25-30 DEG C Culture 2-3 days；With oese by the bacterial plaque of co-cultivation in the rifampin containing 50mg/L, 500mg/L streptomysin and 50mg/L Kanamycins culture medium on rule, cultivated 2-3 days at 25-30 DEG C；Monoclonal is taken, is bacterium colony PCR, extracts plasmid PCR, Shake bacterium propagation；Bacterium is protected, extracts plasmid.

In the genetic conversion system application that preceding described induction plant is downgraded, described Agrobacterium infects tomato cotyledon；It is Under sterile environment, by AC⁺⁺Seed be utilized respectively 20~40ml mass concentrations 0.8-1.2% sodium hypochlorite, 20~40ml 75% ethanol and 20~40ml saturation sodium phosphates carry out disinfection processing；Sterilized water is added after being disposed, in 25-30 DEG C of shaking table Upper 110rpm shakes culture；It is to be grown it is neat after, the seed of germination is seeded into the MS of no antibiotic under sterile environment Cultivated on culture medium, until growing 0.8-1.2cm cotyledon, cotyledon is cut into 2-3 small pieces in gnotobasis condition, and being put into content is After soaking 1h in the liquid MS medium of 0.2 μ g/mL 2,4-D and 10 μ g/mL kinetins, take out, be placed on the filter paper of sterilizing and inhale Dry residual liquid, it is placed on the solidified MS media that content is 1 μ g/mL IAA and 1.75 μ g/mL zeatin, illumination box It is middle with after newspaper parcel culture 1 day, add in Agrobacterium and soak 15 minutes, then blot Liquid Residue with the filter paper to sterilize, again It is put on MS solid mediums, is cultivated 2 days in incubator；It is 500 μ g/mL carboxylics Bian Qing that the cotyledon of co-cultivation is tiltedly inserted into content Mycin, 75 μ g/mL kanamycins, 1.75 μ g/mL zeatin and 1.0 μ g/mL IAA MS culture mediums on, cultivated in incubator, Time per 18-22 days changes a subculture, until forming callus, seedling can be grown by continuing culture to callus, Cut seedling root induction into the MS culture mediums that content is 50 μ g/mL kanamycins and 250 μ g/mL carboxylic Bian penicillin；Take root Seedling afterwards can further cut two plants, regerminate and take root, and produce more transfer-gen plants.

In the genetic conversion system application that foregoing induction plant is downgraded, described Agrobacterium infects tomato cotyledon；It is nothing In the environment of bacterium, by AC⁺⁺Seed be utilized respectively the sodium hypochlorite of 30ml mass concentrations 1.0%, 30ml75% ethanol and 30ml Saturation sodium phosphate carries out disinfection processing；Sterilized water is added after being disposed, 110rpm shakes culture on 25-30 DEG C of shaking table； It is to be grown it is neat after, the seed of germination is seeded on the MS culture mediums of no antibiotic under sterile environment and cultivated, until Grow 0.8-1.2cm cotyledon, cotyledon is cut into 2-3 small pieces in gnotobasis condition, and it is 0.2 μ g/mL 2 to be put into content, 4-D and After soaking 1h in the liquid MS medium of 10 μ g/mL kinetins, take out, be placed on the filter paper of sterilizing and blot residual liquid, place On the solidified MS media that content is 1.0 μ g/mL IAA and 1.75 μ g/mL zeatin, wrapped up in illumination box with newspaper After culture 1 day, add in Agrobacterium and soak 15 minutes, then blot Liquid Residue with the filter paper of sterilizing, be re-applied to the training of MS solids Support on base, cultivated 2 days in incubator；The cotyledon of co-cultivation is tiltedly inserted into content as 500 μ g/mL carboxylic Bians penicillin, 75 μ g/mL On the μ g/mL zeatin of kanamycins 1.75 and 1.0 μ g/mL IAA MS culture mediums, cultivated in incubator, the time of every 20 days is more Change a subculture, until forming callus, continuing culture to callus can grow seedling, cut seedling to content be 50 Root induction in the MS culture mediums of μ g/mL kanamycins and 250 μ g/mL carboxylic Bian penicillin；Seedling after taking root can be further Two plants are cut, regerminates and takes root, produces more transfer-gen plants.

Applicant has carried out substantial amounts of experimental study to the present invention, and part test is as follows：

1st, bioinformatic analysis

Utilize Solanaceae private database Sol Genomics Network (SGN, http://solgenomics.net/) inspection The gene information of rope SIP1 subfamilies, then utilize albumen private database Pfamdatabase (http:// Pfam.sanger.ac.uk/ the accuracy of assay) is carried out.Utilize Multiline websites (http:// Multalin.toulouse.inra.fr/multalin/ sequence alignment) is carried out, finds out introne or extron, is utilized DNAMAN does the comparison of amino acid sequence, and analyzes the uniformity for the GT-2 subfamily amino acid sequences for coming from different plant species； Biological evolution tree is built using software MEGA5.1.

2nd, gene silencing expression vector is built, and carries out genetic transformation

The extraction of total serum IgE：Conventional method is that RNAiso Plus extracts reagents carry out manual extraction, is specifically operated Journey is summarized as follows：After tomato tissue materials, it is put into rapidly quick-frozen in liquid nitrogen；After selected materials are put into mortar, liquid nitrogen grinding needs Carefully, 100mg powder is chosen to be put into 1.5mL centrifuge tubes (amount containing the more material selection of carbohydrate or quinones substance is less than 100mg More than 50mg), 1mL RNAiso Plus extracts reagents are added, acutely concussion mixes, and is stored at room temperature 5min；By at 4 DEG C of mixed liquor 13100rpm centrifuges 5min；The μ L of Aspirate supernatant 900 are put into new 1.5mL centrifuge tube, and add three chloromethanes newly to break a seal The μ L of alkane 255, turn upside down during mixing, normal temperature stands 5min；13100rpm centrifuges 15min at 4 DEG C of mixed liquor, and it is clear to draw the superiors The μ L of clear liquid body 200 are in new 1.5mL centrifuge tube, the equal isopropanol stoste of addition volume, mixing of turning upside down, and room temperature is quiet Put 5min；By 13100rpm centrifugations 10min at 4 DEG C of mixed liquor；Supernatant is outwelled, and adds 1mL75% ethanol, is carefully washed Protein residues, 13100rpm centrifugations 1min at 4 DEG C；Supernatant is outwelled, residual liquid need to blot, normal temperature standing and drying；Wait to do The deionized water of sterilizing, fully dissolving are added after dry；Agarose gel electrophoresis examines total serum IgE purity and concentration.

RNA reverse transcriptions：Under sterile environment, the reagent of following reaction system is added in 0.2mL centrifuge tube：RNA 1μ L, primer (2 mM/ls of oligodT) 2 μ L, the μ L of deionized water 11；The centrifuge tube added is put into PCR instrument, 75 DEG C incubate Educate 5min；Incubation is put into rapidly cooled on ice 5min after terminating, and is separately added into the μ L of mix reagent 16, the preparation of the mix reagent Method：5 times of the μ L of buffer buffer solutions 4, dNTP 2 μ L, the μ L of reverse transcriptase M-mLV 1 and the μ L of deionized water 9；By all bodies Upper 42 DEG C of PCR is placed on after system's mixing to incubate 1 hour, then is increased to 72 DEG C of incubation 10min, is finally taken out, is put into subzero 20 DEG C long Kubo is deposited.

Gene cloning：Concrete operations are as follows：Total length tomato dna is expanded using primer SlGT-33-F and SlGT-33-R SlAW034575, reaction system reagent are as follows：2 × PrimeSTAR Mix, 12.5 μ L；SlGT-33-F, 1.0 μ L；SlGT-33- R, 1.0 μ L；The μ L of cDNA templates 1.0；The μ L of sterilized water 9.5.After adding well, expanded after being placed in PCR instrument, the condition of amplification is such as Under：98 DEG C of denaturation, 2min；58 DEG C of renaturation, 30s, fragment fixes 72 DEG C, 10min.After obtaining PCR amplified production, using fine jade Sepharose electrophoresis speculates PCR primer concentration and clip size.

The structure of silent carrier：Compared by bioinformatic analysis, it is 455bp to find SlGT-33-like gene sizes Distinguished sequence, synthetic primer,

SlGT-33-F：5'CTTCCTGTTCACGACCCTTC 3'

SlGT-33e-R：5'CTCTCAATTTTGGACCCCC 3'；

It is connected on pMD18-T carriers and is sequenced after high-fidelity PCR amplification.As a result Fig. 1 is seen, comparison result shows after sequencing Although showing there are two base mutations, Pass Test requirement.

SlGT-33-EcoRI-XbaI-F：5'CGGAATTCTCTAGACTTCCTGTTCACGACCCTTC3'

SlGT-33-KpnI-HindIII-R：5'GGGGTACCAAGCTTCTCTCAATTTTGGACCCCC3'；

Synthetic primer 5' again adds restriction enzyme site again, and intermediate carrier is connected in a manner of forward and reverse On pHANNIBAL, it is then attached on whole carrier pBIN19.Whole carrier structure such as Fig. 2 of acquisition：

The Agrobacterium Conjugative tiansfer of binary plasmid：Fragment containing SlGT-33 silence fragments is transferred in Agrobacterium, needed Escherichia coli HB101/pRK2013 (Helper) booster action is wanted, is comprised the following steps that：By the Agrobacterium LBA4404 of storage Strain, rule on the YEB of the streptomysin of rifampin, 500 mg/litres in 50 mg/litres solid medium, trained at 28 DEG C The size for supporting monoclonal is 0.5-1 millimeters (2-3 days)；Escherichia coli HB101/pRK2013 (Helper) strain slowly melts, Rule on the culture medium of the kanamycins containing 50 mg/litres, be sealed in culture 16-18 hours in 37 DEG C of incubator, directly To growing containing obvious monoclonal；Picking SlGT-33 silence end carrier monoclonals are in the training of the YEB culture mediums without antibiotic Support in ware, form the bacterial plaque of about 0.5 centimetre of size, then picking heper bacterial strains and Agrobacterium and end in the same way Carrier mixes, and slowly to mix, mixing it is more uniform better, at 28 DEG C culture arrive bacterial plaque amount reproduction period (2-3 days)；With oese by the bacterial plaque of co-cultivation in the rifampin containing 50 mg/litres, the streptomysin of 500 mg/litres and 50 Rule on the culture medium of the kanamycins of mg/litre, the size of culture to monoclonal is 0.5-1 millimeters (2-3 days) at 28 DEG C； Picking monoclonal, bacterium colony PCR is, extracts plasmid PCR, primer used selects to examine the primer of whole carrier or intermediate carrier The positive carries out shaking bacterium propagation；Bacterium is protected, extracts plasmid.

The Agrobacterium of cotyledon is infected:Comprise the following steps that：

Under sterile environment, by AC⁺⁺Seed carried out disinfection place using sodium hypochlorite, 75% ethanol and saturation sodium phosphate Reason；The seed being disposed adds sterilized water, the 110rpm under dark on 28 DEG C of shaking table, shakes culture；It is to be grown it is neat after, The seed of germination is seeded on the MS culture mediums of no antibiotic under sterile environment and cultivated, until growing 1 cm Cotyledon size after prepare infection processs；The cotyledon for reaching 1 cm distinguishes each partial application in two under the conditions of gnotobasis, It is put into the liquid MS medium (0.2 μ g/mL 2,4-D and 10 μ g/mL KT) containing hormone and soaks 1 hour, is placed on sterilizing Residual liquid is blotted on filter paper, is placed on solidified MS media (1 μ g/mL IAA and 1.75 μ g/mL ZT), illumination box Middle newspaper parcel culture 1 day；Preculture is soaked into 15min, Ran Houyong in the Agrobacterium for the suspension that the cotyledon of one day adds The filter paper of sterilizing blots Liquid Residue, is re-applied on MS solid mediums, is cultivated 2 days in incubator；The cotyledon of co-cultivation is oblique It is inserted on 500 μ g/mL Carb+75 μ g/mL Kan+1.75 μ g/mL ZT+1.0 μ g/mL IAA MS culture mediums, incubator Middle culture；The time of every 20 days or so changes a resistance culture base, until forming callus；After a period of time, callus Tissue can grow seedling, cut seedling (MS+50 μ g/mL Kan and 250 μ g/mL Carb) root induction into root media； Seedling after taking root can further cut two plants, regerminate and take root, more transfer-gen plants are produced, for follow-up Experiment.

3rd, transfer-gen plant is identified

Transfer-gen plant is identified using the gene that kanamycins can be encoded on whole carrier as according to progress.PCR amplifications carry The sequence of body kanamycin gene successfully indicates as transgenosis, because AC⁺⁺In do not have encode kanamycins gene order. Comprise the following steps that：Choose by tomato transgenic healing tissue development and Lai plant and AC⁺⁺Blade is as test material, difference Extract DNA；Using the DNA of extraction as template, detected using conventional r-Taq enzyme systems as standard.

Regular-PCR program：94 DEG C, 5min；[94 DEG C, 30 seconds, 56 DEG C, 30 seconds, 72 DEG C, 60 seconds], totally 35 circulations；Finally 72 DEG C, 10min, 4 DEG C preservations；Proper amount of PCR primer is taken, from 1.2% agarose gel electrophoresis, 120V, 20-25min.

The identification of transgene efficiency：Using fluorescent quantitative PCR technique, cryptiogene is detected using the quantitative primer of design Efficiency.

4th, tomato transgenic plant is obtained

The plant observation phenotype of transgenosis is accredited as, and collects T0 for seed, after planting harvests first filial generation seed, after planting Second filial seed is harvested, then after being identified by transgenosis, positive plant is just tomato transgenic plant.

Experimental result

1st, the molecular cloning of SlGT-33 genes and homologous compare are analyzed

SlGT-33 gene (gene I/Ds：Solyc12g043090 full length fragment), found after sequencing, its total length is 1125 bases, intronless, encode 374 amino acid.

SlGT-33 gene nucleotide series：

ATGGATGACATTGAGGATAATGGGAGATATCCTTCCAACCCTTATGGCATGAACCAGGGTTATGAGTCATCCAATCG CCAGAAGCTTCCTGTTCACGACCCTTCTTATTCAAGGCATGTCGACAATCAGTATGTGGAGGAGGCGGATGATGATG AAGAAGTTGATGGCGAAGAAGAAGAAGATGATGATGGCGAAGAAAATGGTGTTCAGCGGATAGGGAAAGATGTGTTT GATGACGATGATGATGATGATGATGAGTATGGTGATTTGCAGAGGCATCAAAAGAAGAGGAAGTTAAAGAGCTTGTT ATCAAGTTATGAGTTTGCACCTCGAGTACCACCACCATCTACTACAGCTGCAACTGCTCCTAAGCCTTCATTTGGTG GTAGGAATCCACTTTCAGATTGGTCTGAAAATGAGACATTTATTTTGCTTGATGCATGGGGCACTAGGTTTGTTCGA CATGGGAGGAAGAGTCTTCGATCAGAGGAATGGCAAGAAGTTGCAGACAGAGTGTCACGGGGGTCCAAAATTGAGAG GACAGACACCCAATGTCGTAACCGTTTGGATACTTTGAAAAAGAAATACAAAAAGGAGAAGATGAAGTTTGCAGAGA CTGGAAGTAGCACTAGCAAGTGGGTGTACTTCAAAAAGATGGACATGTTACTAACATCAACTCCCCAGAAAGCTGGT GTTTCATGTGGAATGGACTCTGGAGAGTATGTTTTCATGAGCCCAAAAGCTTATCTGAATCGTGCTAATGGCTTGGA TGAGATGAGGGACAGTCCTGCTAACTCAGAATCTGCTGATGGTGAGGAGGATGGTTCAGAGGATCTTCCACCAAAAA GATCAAGAAATGTACAACCAGGAGGGAACGGGAATGGGAATGGACATTCTTTCAAATTAATAGCAGATTCTATCCAT AAATTTAGTGAGATATATGTGAAGATTGAGAATAGCAAGAGACAGCAAATGATGGAACTGGAGAAAATGAGGATGGA CTTCCACCGAGAATTGGAACTCCAAAAGAGGCAAATTATGGAGAGAGCTCAGGCAGAAATTGCAAGAATACGTCAAG GAAGTGATGAAGAGAACGACATGTCTGCTGAAAATGTTAGTGGATGA。

The amino acid of the gene code can form Trihelix domains, the 4th spiral and a conservative central domain, As shown in Figure 3.

2nd, the identification of transgenic line

3rd, the seedling of silence strain is downgraded

AC⁺⁺After having cultivated 70 days in greenhouse with transfer-gen plant, the highly significant of silence plant is less than AC⁺⁺, it is only right According to 50% or so (such as Fig. 5).The average internode length of silence plant, which is also significantly less than, to be compareed, only AC⁺⁺The 25- of plant 30%.In addition, the compound leaf structure of silence plant is constant, but the overall dimensions of compound leaf substantially diminish.Therefore, SlGT-33 is suppressed The induced expression of gene plant is substantially downgraded.

4th, the inflorescence of silence strain is formed ahead of time

Along with gradually growing up for seedling, the inflorescence of silence strain forms the time earlier than AC⁺⁺.Fig. 6 is shown, when silence plant When growing into 7-8 piece true leaves, AC⁺⁺Plant only has 4-5 piece true leaves；When silence plant strain growth is to 11-12 piece true leaves, AC⁺⁺Plant Only given birth to 7-8 piece true leaves.Usual 7-8 piece true leaves are the periods that tomato forms the first tire inflorescence, and 11-12 piece true leaves are tomato shapes Into the period of second fetus inflorescence.Therefore, silence SlGT-33 promotes plant and forms inflorescence ahead of time.In addition, the growth of silence plant After being suppressed, but the speed of germinating of its lateral bud is significantly faster than that control.Research explanation, SlGT-33 genes can promote to plant above Strain is downgraded.

Beneficial effect：The tomato plant that the present invention obtains have can high-density planting, make full use of space and soil, strengthen Photosynthetic efficiency, improve yield, low water consumption rate, it is resistant to lodging the advantages that.

Brief description of the drawings

Fig. 1 is that sequencing result figure on pMD18-T carriers is connected to after high-fidelity PCR amplification；

Fig. 2 is whole carrier structure figure；

Fig. 3 is amino acid Multiple sequence alignments SIP1 (SlGT-33) Transcription factor analysis figure；

Fig. 4 is silence efficiency identification；

Fig. 5 is outdoor silence strain and AC⁺⁺The phenotype of seedling；

Fig. 6 is outdoor silence strain and AC⁺⁺The phenotype of seedling.

Embodiment

The present invention is further illustrated with reference to the accompanying drawings and examples, but be not intended as to the present invention limit according to According to.

Embodiment 1.

A kind of genetic conversion system for inducing plant to downgrade, its construction method are：

(1) extraction of tomato RNA；Tomato tissue is put into liquid nitrogen and is put into mortar after quick-frozen 15s, after grinding, takes 100mg powder End is put into 1.5mL centrifuge tubes, adds 1.0mL RNAiso Plus extracts reagents, and concussion mixes, and after being stored at room temperature 5min, is mixed Close liquid 13100rpm at 3-5 DEG C and centrifuge 5min, the μ L of Aspirate supernatant 900 are put into new 1.5mL centrifuge tube, and add three The μ L of chloromethanes 255, after mixing, normal temperature stands 5min；13000rpm centrifuges 15min at 3-5 DEG C of mixed liquor, draws the superiors' clarification The μ L of liquid 200 add the isopropanol that 200 μ L concentration are 99%, mixing of turning upside down, room temperature in new 1.5mL centrifuge tube 5min is stood, 13000rpm at 3-5 DEG C of mixed liquor is centrifuged into 10min, outwells supernatant, and adds 1mL75% ethanol, 3-5 DEG C Lower 13000rpm centrifuges 60s, outwells supernatant, blots residual liquid, normal temperature standing and drying；It is to be dried after add sterilizing nothing from The sub- μ l of water 25 dissolvings, are produced；

(2) the RNA reverse transcriptions of SlGT-33 genes：Under sterile environment, following reaction is added in the centrifuge tube of sterilizing The reagent of system：μ L of tomato RNA 1.0, primer 2 .0 μ L, the μ L of deionized water 11, the centrifuge tube for having added reagent is put into PCR instrument, 74-76 DEG C of incubation 5min；Incubation is put into rapidly cooled on ice 5min after terminating, and add 5 times buffer buffer solutions (5 × Reaction Buffer) after 4 μ L, dNTP 2 μ L, the μ L of moloney murine leukemia virus reverse transcriptase 1.0 and the μ L of deionized water 9, 40-44 DEG C of incubation 60min on PCR is placed on, then is increased to 70-74 DEG C of incubation 10min, is taken out, subzero 20 DEG C of preservations；Described draws Thing is 2.0mmoL/L oligodT；

(3) clone of SlGT-33 genes：Utilize primer SlGT-33-F and SlGT-33-R (gene I/D:SlAW034575, See Solanaceae genome website https://solgenomics.net/) amplification total length tomato dna SlAW034575, reaction system Reagent is as follows：2 × PrimeSTAR Mix, 12.5 μ L；SlGT-33-F, 1.0 μ L；SlGT-33-R, 1.0 μ L；The μ of cDNA templates 1.0 L；The μ L of sterilized water 9.5；After adding well, expanded after being placed in PCR instrument, the condition of amplification is as follows：98 DEG C of denaturation, 2min；It is multiple 58 DEG C, 30s of property, fragment fixes 72 DEG C, 10min, obtains PCR amplified production；

The structure of described silent carrier；PCR amplified production is connected on pMD18-T carriers, sequencing, obtains clone's piece The coded sequence of section, restriction enzyme site, synthetic primer SlGT-33-F and SlGT-33-R, respectively with forward and reverse are added in 5' Mode be connected on intermediate carrier pHANNIBAL, be then attached on whole carrier pBIN19, acquisition contain SlGT-33 genes Silence express whole carrier；Described SlGT-33-F is：SlGT-33-R described in 5'CTTCCTGTTCACGACCCTTC 3'： 5'CTCTCAATTTTGGACCCCC 3'。

For inducing induction tomato plant to downgrade, concrete operation method is：

(1) SlGT-33 gene transfers are to Agrobacterium；By Agrobacterium LBA4404 strain, content be 50mg/L rifampins and Rule on the YEB of 500mg/L streptomysin solid medium, cultivated 2-3 days at 25-30 DEG C；Escherichia coli HB101/ PRK2013 (Helper) strains are rule on the culture medium of the kanamycins containing 5050mg/L, are sealed in 35-39 DEG C of culture 16-18h is cultivated in case, takes the silence containing SlGT-33 genes to express whole carrier monoclonal in the YEB culture mediums without antibiotic Culture dish in, form the bacterial plaque of 0.4-0.6cm length, then take Helper bacterial strains and Agrobacterium in the same way with carrying eventually Body mixes, and after mixing, is cultivated 3 days at 25-30 DEG C；The bacterial plaque of co-cultivation is being contained 50mg/L's with oese Rule on the culture medium of the kanamycins of rifampin, 500mg/L streptomysin and 50mg/L, cultivated 2-3 days at 25-30 DEG C； Monoclonal is taken, is bacterium colony PCR, extracts plasmid PCR, shakes bacterium propagation；Bacterium is protected, extracts plasmid；

(2) Agrobacterium infects tomato cotyledon：Under sterile environment, by AC⁺⁺Seed be utilized respectively 30ml mass concentrations 1.0% sodium hypochlorite, the ethanol of 30ml 75% and 30ml saturation sodium phosphates carries out disinfection processing；Added after being disposed sterile Water, 110rpm shakes culture on 25-30 DEG C of shaking table；It is to be grown it is neat after, the seed of germination is broadcast under sterile environment Kind to cultivating on the MS culture mediums of no antibiotic, until growing 0.8-1.2cm cotyledon, cotyledon is cut into gnotobasis condition 2-3 small pieces, after being put into content to soak 1h in the liquid MS medium of 0.2 μ g/mL2,4-D and 10 μ g/mL kinetins, take out, It is placed on the filter paper of sterilizing and blots residual liquid, is placed on content as 1 μ g/mL IAA and the solid MS of 1.75 μ g/mL zeatin On culture medium, with after newspaper parcel culture 1 day in illumination box, add in Agrobacterium and soak 15 minutes, then with sterilizing Filter paper blots Liquid Residue, is re-applied on MS solid mediums, is cultivated 2 days in incubator；The cotyledon of co-cultivation is tiltedly inserted into Content is 500 μ g/mL carboxylic Bians penicillin, 75 μ g/mL kanamycins, 1.75 μ g/mL zeatin and 1.0 μ g/mL IAA MS trainings Support on base, cultivated in incubator, the time per 18-22 days changes a subculture, until forming callus, continues culture extremely Callus can grow seedling, cut seedling and induced into the MS culture mediums that content is 50 μ g/mL Kan and 250 μ g/mL Carb Take root；Seedling after taking root can further cut two plants, regerminate and take root, produce more transfer-gen plants.

Embodiment 2.

A kind of genetic conversion system for inducing plant to downgrade, its construction method are：

(1) extraction of tomato RNA；Tomato tissue is put into liquid nitrogen and is put into mortar after quick-frozen 20s, after grinding, takes 102mg powder End is put into 1.5mL centrifuge tubes, adds 1.2mL RNAiso Plus extracts reagents, and concussion mixes, and after being stored at room temperature 6min, is mixed Close liquid 13100rpm at 3-5 DEG C and centrifuge 6min, the μ L of Aspirate supernatant 920 are put into new 1.5mL centrifuge tube, and add three The μ L of chloromethanes 265, after mixing, normal temperature stands 6min；12500-13500rpm centrifuges 17min at 3-5 DEG C of mixed liquor, draws most upper The layer μ L of supernatant liquid 220 add the isopropanol that 220 μ L concentration are 100%, turned upside down mixed in new 1.5mL centrifuge tube It is even, 6min is stored at room temperature, 13200rpm at 3-5 DEG C of mixed liquor is centrifuged into 12min, outwells supernatant, and add 1mL80% second Alcohol, 13200rpm centrifugations 70s, outwells supernatant, blots residual liquid, normal temperature standing and drying at 3-5 DEG C；Add and go out after to be dried The μ l of deionized water 30 dissolvings of bacterium, are produced；

(2) the RNA reverse transcriptions of SlGT-33 genes：Under sterile environment, following reaction is added in the centrifuge tube of sterilizing The reagent of system：μ L of tomato RNA 1.2, primer 2 .2 μ L, the μ L of deionized water 12, the centrifuge tube for having added reagent is put into PCR instrument, 74-76 DEG C of incubation 4-6min；Incubation is put into rapidly cooled on ice 6min after terminating, and add 6 times buffer buffer solutions (5 × Reaction Buffer) after 4 μ L, dNTP 2 μ L, the μ L of moloney murine leukemia virus reverse transcriptase 1.2 and the μ L of deionized water 10, 40-44 DEG C of incubation 70min on PCR is placed on, then is increased to 70-74 DEG C of incubation 8-12min, is taken out, subzero 20 DEG C of preservations；Described Primer is 1.8-2.2mmoL/L oligodT；

(3) clone of SlGT-33 genes：Utilize primer SlGT-33-F and SlGT-33-R (gene I/D:SlAW034575, See Solanaceae genome website https://solgenomics.net/) amplification total length tomato dna SlAW034575, reaction system Reagent is as follows：2 × PrimeSTAR Mix, 12.5 μ L；SlGT-33-F, 1.0 μ L；SlGT-33-R, 1.0 μ L；The μ of cDNA templates 1.0 L；The μ L of sterilized water 9.5；After adding well, expanded after being placed in PCR instrument, the condition of amplification is as follows：98 DEG C of denaturation, 2min；It is multiple 58 DEG C, 30s of property, fragment fixes 72 DEG C, 10min, obtains PCR amplified production；

(4) structure of the silent carrier described in；PCR amplified production is connected on pMD18-T carriers, sequencing, acquisition gram The coded sequence of grand fragment, restriction enzyme site is added in 5', synthetic primer SlGT-33-F and SlGT-33-R, respectively with positive and Reverse mode is connected on intermediate carrier pHANNIBAL, is then attached on whole carrier pBIN19, and acquisition contains SlGT-33 The silence of gene expresses whole carrier；Described SlGT-33-F is：SlGT- described in 5'CTTCCTGTTCACGACCCTTC 3' 33-R：5'CTCTCAATTTTGGACCCCC 3'.

For inducing induction tomato plant to downgrade, concrete operation method is：

(1) SlGT-33 gene transfers are to Agrobacterium；By Agrobacterium LBA4404 strain, content be 50mg/L rifampins and Rule on the YEB of 500mg/L streptomysin solid medium, cultivated 2 days at 25-30 DEG C；Escherichia coli HB101/ PRK2013 (Helper) strains are rule on the culture medium of the kanamycins containing 5050mg/L, are sealed in 35-39 DEG C of culture 18h is cultivated in case, takes the silence containing SlGT-33 genes to express whole carrier monoclonal in the YEB culture mediums without antibiotic In culture dish, the bacterial plaque of 0.4-0.6cm length is formed, then takes Helper bacterial strains and Agrobacterium and whole carrier in the same way Mix, after mixing, cultivated -3 days at 25-30 DEG C；The bacterial plaque of co-cultivation is being contained 50mg/L's with oese Rule on the culture medium of the kanamycins of rifampin, 500mg/L streptomysin and 50mg/L, cultivated 3 days at 25-30 DEG C；Take Monoclonal, bacterium colony PCR is, extracts plasmid PCR, shake bacterium propagation；Bacterium is protected, extracts plasmid；

(2) Agrobacterium infects tomato cotyledon：Under sterile environment, by AC⁺⁺Seed be utilized respectively 40ml mass concentrations 1.2% sodium hypochlorite, the ethanol of 40ml 75% and 40ml saturation sodium phosphates carries out disinfection processing；Added after being disposed sterile Water, 110rpm shakes culture on 25-30 DEG C of shaking table；It is to be grown it is neat after, the seed of germination is broadcast under sterile environment Kind to cultivating on the MS culture mediums of no antibiotic, until growing 0.8-1.2cm cotyledon, cotyledon is cut into gnotobasis condition 2-3 small pieces, it is 0.2 μ g/mL 2 to be put into content, after soaking 1h in the liquid MS medium of 4-D and 10 μ g/mL kinetins, is taken out, It is placed on the filter paper of sterilizing and blots residual liquid, is placed on content as 1 μ g/mL IAA and the solid MS of 1.75 μ g/mL zeatin On culture medium, with after newspaper parcel culture 1 day in illumination box, add in Agrobacterium and soak 15 minutes, then with sterilizing Filter paper blots Liquid Residue, is re-applied on MS solid mediums, is cultivated 2 days in incubator；The cotyledon of co-cultivation is tiltedly inserted into Content is 500 μ g/mL carboxylic Bians penicillin, 75 μ g/mL kanamycins, 1.75 μ g/mL zeatin and 1.0 μ g/mL IAA MS trainings Support on base, cultivated in incubator, the time per -22 days changes a subculture, until forming callus, continues culture to more Injured tissue can grow seedling, cut seedling and induce life into the MS culture mediums that content is 50 μ g/mL Kan and 250 μ g/mL Carb Root；Seedling after taking root can further cut two plants, regerminate and take root, produce more transfer-gen plants.

Sequence table

<110>The south of Guizhou Province college of education of nationality

<120>A kind of genetic conversion system for inducing plant to downgrade and its structure and application

<130> 2017

<141> 2017-09-12

<160> 5

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1125

<212> DNA

<213>Solanaceae tomato genus (Lycopersicon esculentum Mill)

<400> 1

atggatgaca ttgaggataa tgggagatat ccttccaacc cttatggcat gaaccagggt 60

tatgagtcat ccaatcgcca gaagcttcct gttcacgacc cttcttattc aaggcatgtc 120

gacaatcagt atgtggagga ggcggatgat gatgaagaag ttgatggcga agaagaagaa 180

gatgatgatg gcgaagaaaa tggtgttcag cggataggga aagatgtgtt tgatgacgat 240

gatgatgatg atgatgagta tggtgatttg cagaggcatc aaaagaagag gaagttaaag 300

agcttgttat caagttatga gtttgcacct cgagtaccac caccatctac tacagctgca 360

actgctccta agccttcatt tggtggtagg aatccacttt cagattggtc tgaaaatgag 420

acatttattt tgcttgatgc atggggcact aggtttgttc gacatgggag gaagagtctt 480

cgatcagagg aatggcaaga agttgcagac agagtgtcac gggggtccaa aattgagagg 540

acagacaccc aatgtcgtaa ccgtttggat actttgaaaa agaaatacaa aaaggagaag 600

atgaagtttg cagagactgg aagtagcact agcaagtggg tgtacttcaa aaagatggac 660

atgttactaa catcaactcc ccagaaagct ggtgtttcat gtggaatgga ctctggagag 720

tatgttttca tgagcccaaa agcttatctg aatcgtgcta atggcttgga tgagatgagg 780

gacagtcctg ctaactcaga atctgctgat ggtgaggagg atggttcaga ggatcttcca 840

ccaaaaagat caagaaatgt acaaccagga gggaacggga atgggaatgg acattctttc 900

aaattaatag cagattctat ccataaattt agtgagatat atgtgaagat tgagaatagc 960

aagagacagc aaatgatgga actggagaaa atgaggatgg acttccaccg agaattggaa 1020

ctccaaaaga ggcaaattat ggagagagct caggcagaaa ttgcaagaat acgtcaagga 1080

agtgatgaag agaacgacat gtctgctgaa aatgttagtg gatga 1125

<210> 2

<211> 20

<212> DNA

<213>Artificial sequence ()

<400> 2

cttcctgttc acgacccttc 20

<210> 3

<211> 19

<212> DNA

<213>Artificial sequence ()

<400> 3

ctctcaattt tggaccccc 19

<210> 4

<211> 34

<212> DNA

<213>Artificial sequence ()

<400> 4

cggaattctc tagacttcct gttcacgacc cttc 34

<210> 5

<211> 33

<212> DNA

<213>Artificial sequence ()

<400> 5

ggggtaccaa gcttctctca attttggacc ccc 33

Claims (10)

1. A kind of 1. genetic conversion system for inducing plant to downgrade, it is characterised in that：The genetic system is that SIP1 family genes lure Lead the genetic conversion system of plant dwarfing.
2. A kind of 2. construction method for the genetic conversion system that induction plant as claimed in claim 1 is downgraded, it is characterised in that：Bag Include（1）The extraction of tomato RNA；（2）Tomato total serum IgE reverse transcription；（3）The clone of SlGT-33 genes；（4）The structure of silent carrier.
3. 3. the construction method for the genetic conversion system that induction plant is downgraded as claimed in claim 2, it is characterised in that：Described The extraction of tomato RNA；It is that tomato tissue is put into liquid nitrogen and is put into mortar after quick-frozen 10 ~ 20s, after grinding, takes 98-102mg powder It is put into 1.5mL centrifuge tubes, adds 0.8-1.2mL RNAiso Plus extracts reagents, concussion mixes, and is stored at room temperature 4-6min Afterwards, mixed liquor 13100 rpm at 3-5 DEG C centrifuge 4-6min, and Aspirate supernatant 880-920 μ L are put into new 1.5mL centrifugation Guan Zhong, and chloroform 245-265 μ L are added, after mixing, normal temperature stands 4-6min；12500- at 3-5 DEG C of mixed liquor 13500rpm centrifuges 13-17min, draws the superiors supernatant liquid 180-220 μ L in new 1.5mL centrifuge tube, adds 180-220 μ L concentration is 99-100% isopropanol, mixing of turning upside down, 4-6min is stored at room temperature, by 3-5 DEG C of mixed liquor 13000-13200 rpm centrifuge 8-12 min, outwell supernatant, and add 1mL70 ethanol, 13000-13200rpm at 3-5 DEG C 50-70s is centrifuged, supernatant is outwelled, blots residual liquid, normal temperature standing and drying；The deionized water 20 that addition sterilizes after to be dried ~ 30 μ l dissolve, and produce.
4. 4. the construction method for the genetic conversion system that induction plant is downgraded as claimed in claim 2, it is characterised in that：Described The RNA reverse transcriptions of SlGT-33 genes；It is the examination for adding following reaction system in the centrifuge tube of sterilizing under sterile environment Agent：Tomato RNA 0.8-1.2 μ L, primer 1.8-2.2 μ L, deionized water 10-12 μ L, PCR instrument is put into by the centrifuge tube for having added reagent On, 74-76 DEG C of incubation 4-6min；Incubation is put into rapidly cooled on ice 4-6min after terminating, and adds 4-6 times of buffer bufferings Liquid（ 5×Reaction Buffer）4 μ L, dNTP 2 μ L, moloney murine leukemia virus reverse transcriptase 0.8-1.2 μ L and without from After sub- water 8-10 μ L, 40-44 DEG C of incubation 50-70min on PCR is placed on, then is increased to 70-74 DEG C of incubation 8-12min, is taken out, zero Lower 20 DEG C of preservations；Described primer is 1.8-2.2mmoL/L oligodT.
5. 5. the construction method for the genetic conversion system that induction plant is downgraded as claimed in claim 2, it is characterised in that：Described The clone of SlGT-33 genes；It is to utilize primerSlGT-33- F andSlGT-33- R expands tomato dnaSlGT-33, reaction system Reagent is as follows：2 × PrimeSTAR Mix, 12.5 μ L；SlGT-33- F, 1.0 μ L；SlGT-33- R, 1.0 μ L；The μ of cDNA templates 1.0 L；The μ L of sterilized water 9.5；After adding well, expanded after being placed in PCR instrument, the condition of amplification is as follows：98 DEG C of denaturation, 2min；It is multiple 58 DEG C, 30s of property, fragment fixes 72 DEG C, 10min, obtains PCR amplified production；

   The structure of described silent carrier；It is that PCR amplified production is connected on pMD18-T carriers, is sequenced, obtains cloned sequence Coded sequence, add restriction enzyme site, synthetic primer in 5'SlGT-33- F andSlGT-33- R, respectively with forward and reverse Mode be connected on intermediate carrier pHANNIBAL, be then attached on whole carrier pBIN19, acquisition contain SlGT-33 genes Silence express whole carrier；DescribedSlGT-33- F is：5' CTTCCTGTTCACGACCCTTC 3'；

   Described SlGT-33-R：5' CTCTCAATTTTGGACCCCC 3'.
6. 6. the genetic conversion system application that a kind of induction plant as any one of claim 1-5 is downgraded, its feature exist In：For inducing tomato plant to downgrade.
7. 7. the genetic conversion system application that induction plant is downgraded as claimed in claim 6, it is characterised in that：Described is used to lure Lead tomato plant dwarfing；It is that SlGT-33 gene transfers infect tomato cotyledon to Agrobacterium and Agrobacterium.
8. 8. the genetic conversion system application that induction plant is downgraded as claimed in claim 7, it is characterised in that：Described SlGT- 33 gene transfers are to Agrobacterium；It is 48-52mg/L rifampins and 490-510mg/L in content by Agrobacterium LBA4404 strain Rule on the YEB of streptomysin solid medium, cultivated 2-3 days at 25-30 DEG C；Escherichia coli HB101/pRK2013 （Helper）Strain is rule on the culture medium of the kanamycins containing 5000-5100mg/L, is sealed in 35-39 DEG C of incubator Middle culture 16-18h, the silence containing SlGT-33 genes is taken to express whole carrier monoclonal in the YEB culture mediums without antibiotic In culture dish, the bacterial plaque of 0.4-0.6cm length is formed, then takes Helper bacterial strains and Agrobacterium and whole carrier in the same way Mix, after mixing, cultivated 2-3 days at 25-30 DEG C；The bacterial plaque of co-cultivation is being contained into 48-52mg/ with oese Rule on the culture medium of the kanamycins of L rifampin, 490-510mg/L streptomysin and 48-52mg/L, at 25-30 DEG C Culture 2-3 days；Monoclonal is taken, is bacterium colony PCR, extracts plasmid PCR, shakes bacterium propagation；Bacterium is protected, extracts plasmid.
9. 9. the genetic conversion system application that induction plant is downgraded as claimed in claim 7, it is characterised in that：Described Agrobacterium Infect tomato cotyledon；It is under sterile environment, by AC⁺⁺Seed be utilized respectively 20 ~ 40ml mass concentrations 0.8-1.2% secondary chlorine Sour sodium, the ethanol of 20 ~ 40ml 75% and 20 ~ 40ml saturation sodium phosphates carry out disinfection processing；Sterilized water is added after being disposed, 110 rpm shake culture on 25-30 DEG C of shaking table；It is to be grown it is neat after, the seed of germination is seeded under sterile environment Do not have to cultivate on the MS culture mediums of antibiotic, until growing 0.8-1.2cm cotyledon, cotyledon is cut into 2-3 in gnotobasis condition Small pieces, it is 0.1-0.3 μ g/mL 2 to be put into content, after soaking 1h in the liquid MS medium of 4-D and 8-12 μ g/mL kinetins, Take out, be placed on the filter paper of sterilizing and blot residual liquid, it is 0.8-1.2 μ g/mL IAA and 1.65-1.85 μ g/ to be placed on content On the solidified MS media of mL zeatin, with after newspaper parcel culture 1 day in illumination box, add in Agrobacterium and soak 10- 20 minutes, Liquid Residue then is blotted with the filter paper of sterilizing, is re-applied on MS solid mediums, is cultivated 2-3 days in incubator；Will The cotyledon of co-cultivation is tiltedly inserted into content as 490-510 μ g/mL carboxylic Bians penicillin, 70-80 μ g/mL kanamycins 1.65- On 1.85 μ g/mL zeatin and 0.8-1.2 μ g/mL IAA MS culture mediums, cultivated in incubator, the time per 18-22 days is more A subculture is changed, until forming callus, seedling can be grown to callus by continuing culture, and cut seedling is to content Root induction in the MS culture mediums of 48-52 μ g/mL kanamycins and 240-260 μ g/mL carboxylic Bian penicillin；Seedling after taking root can Further to cut two plants, regerminate and take root, produce more transfer-gen plants.
10. 10. the genetic conversion system application that induction plant is downgraded as claimed in claim 9, it is characterised in that：Described agriculture bar Bacterium infects tomato cotyledon；It is under sterile environment, by AC⁺⁺Seed be utilized respectively 30ml mass concentrations 1.0% sodium hypochlorite, The ethanol of 30ml 75% and 30ml saturation sodium phosphates carry out disinfection processing；Sterilized water is added after being disposed, in 25-30 DEG C of shaking table Upper 110 rpm shakes culture；It is to be grown it is neat after, the seed of germination is seeded into the MS of no antibiotic under sterile environment Cultivated on culture medium, until growing 0.8-1.2cm cotyledon, cotyledon is cut into 2-3 small pieces in gnotobasis condition, and being put into content is After soaking 1h in the liquid MS medium of 0.2 μ g/mL 2,4-D and 10 μ g/mL kinetins, take out, be placed on the filter paper of sterilizing Residual liquid is blotted, is placed on the solidified MS media that content is 1.0 μ g/mL IAA and 1.75 μ g/mL zeatin, illumination With after newspaper parcel culture 1 day in incubator, add in Agrobacterium and soak 15 minutes, then blot residual with the filter paper of sterilizing Liquid, it is re-applied on MS solid mediums, is cultivated 2 days in incubator；It is 500 μ g/ that the cotyledon of co-cultivation is tiltedly inserted into content On the MS culture mediums of mL carboxylic Bians penicillin, the μ g/mL zeatin of 75 μ g/mL kanamycins 1.75 and 1.0 μ g/mL IAA, culture Cultivated in case, the time of every 20 days changes a subculture, until forming callus, continuing culture to callus can grow Seedling, cut seedling root induction into the MS culture mediums that content is 50 μ g/mL kanamycins and 250 μ g/mL carboxylic Bian penicillin； Seedling after taking root can further cut two plants, regerminate and take root, produce more transfer-gen plants.