CN109880830B - Peach polypeptide hormone synthetic gene PpRGF1 and application thereof - Google Patents

Abstract

The invention belongs to the technical field of plant genetic engineering, and relates to a peach polypeptide hormone synthetic genePpRGF1And applications thereof. The invention clones peach polypeptide hormoneGLVMembers of the gene family are obtainedPpRGF1And the expression mode of the gene in the solute type peach fruit ripening process is analyzed, and finally the gene is transferred into Micro-Tom tomatoes by an agrobacterium-mediated method to verify the function of the target gene, so that the function played by polypeptide hormone in the peach ripening process is favorably clarified from a molecular mechanism, the purposeful and targeted quality and character improvement of peaches is further realized, and the method has an active guiding function for cultivating new peach varieties.

Description

Peach polypeptide hormone synthetic gene PpRGF1 and application thereof

Technical Field

The invention belongs to the technical field of plant genetic engineering, and relates to a peach polypeptide hormone synthetic genePpRGF1And applications thereof.

Background

Solute type peach (MF) fruits are respiration jump type fruits, and under the action of ethylene, the fruits are rapidly softened to reach commodity maturity. Hard peach (SH) fruits do not release ethylene during ripening, do not soften whether they leave trees or collect, in the case of complete colour change and accumulation of high concentrations of sugar. Researches find that SH peach ethylene synthesis is hindered due to ethylene synthesis key geneACS1Is always expressed at a lower level, whereas MF peach fruitsACS1The expression of the gene rises rapidly with the ripening of the fruit. Further study found that in MF peaches, auxin inductionACS1The gene expression, in turn, induces ethylene synthesis, resulting in fruit softening. Auxin and ethylene jointly regulate the mature softening of peach fruits, however, the interaction mechanism between the auxin and the ethylene is not clear, and researches find that a peach gene for encoding hormone similar to GOLVEN polypeptideCTG134The gene has a regulation effect on the ripening of fruits, is obtained in mesocarp of the mature period of peach fruits, is expressed in a respiratory transition period and is up-regulated in the ripening process of the peach fruits, and responds to NAA and 1-MCP treatment, so that the implication of the gene is thatGLVThere may be an intermediate regulatory role between auxin and ethylene.

Disclosure of Invention

One of the purposes of the invention is to provide a peach polypeptide hormone synthesis genePpRGF1And the encoded protein.

The second purpose of the invention is to provide a peach polypeptide hormone synthesis genePpRGF1The recombinant vector of (1).

The invention also aims to provide a peach polypeptide hormone synthesis genePpRGF1And the application of the encoded protein and the recombinant vector in tomato breeding, in particular to the application in promoting tomato fruit ripening.

In order to realize the purpose, the invention adopts the following technical scheme:

the invention provides a peach polypeptide hormone synthetic genePpRGF1The sequence is shown in SEQ ID NO. 1.

The invention also provides a peach polypeptide hormone synthetic genePpRGF1The amino acid sequence of the coded protein is shown as SEQ ID NO. 2.

The invention also provides a synthetic gene containing the peach polypeptide hormonePpRGF1The recombinant vector of (1).

Preferably, the recombinant vector is an agrobacterium expression vector.

The invention also provides a peach polypeptide hormone synthetic genePpRGF1Peach polypeptide kinaseGene for synthesizing hormonePpRGF1Encoded protein and peach polypeptide hormone synthesis genePpRGF1The recombinant vector of (4) is applied to tomato breeding.

Preferably, the tomato breeding promotes tomato fruit ripening.

Preferably, the tomato breeding comprises the following steps:

a: construction of a synthetic gene containing the peach polypeptide hormonePpRGF1The recombinant vector of (1);

b: transforming the constructed recombinant vector into tomato tissue or cell;

c: and breeding and screening to obtain the transgenic tomato.

Compared with the prior art, the invention has the beneficial effects that:

1. the invention clones peach polypeptide hormoneGLVMembers of the gene family are obtainedPpRGF1And the expression mode of the gene in the solute type peach fruit ripening process is analyzed, and finally the gene is transferred into Micro-Tom tomatoes by an agrobacterium-mediated method to verify the function of the target gene, so that the method is favorable for clarifying a response mechanism of a hormone signal in the peach ripening process from a molecular mechanism, and has a positive guiding function for further realizing purposeful and targeted quality and character improvement of peaches and cultivating new peach varieties.

2. Relative to other transgenes, the plant phenotype is locally changed, such as the unilateral change of the leaf shape or the flower structure, or the change of the root length and the number of lateral roots, and the change of the fruit size or the fruit peel thickness,PpRGF1the gene promotes the expression of ethylene and maturation related genes to stimulate the release of ethylene in the fruit development process, thereby promoting the maturation of fruits.

Drawings

FIG. 1 peach polypeptide hormone synthetic genesPpRGF1The PCR amplification electrophoretogram of (1) in the figure, wherein-represents a negative control, + represents a positive control, M in the left band in the figure is DL 2000 marker, genePpRGF1The size of the gene fragment is 489 bp.

Fig. 2 peachPpRGF1And Arabidopsis thalianaAtGLVAnd (3) amino acid multiple sequence alignment.

Fig. 3 peachPpRGF1And Arabidopsis thalianaAtGLVEvolutionary tree。

FIG. 4 peach polypeptide hormone synthetic genesPpRGF1Relative expression levels in mature period of CN13 and CN16 fruits.

FIG. 5 peach polypeptide hormone synthetic genesPpRGF1Relative expression in different tissues during CN13 development.

FIG. 6 Observation of wild type tomato and transgenic tomato fruits at different developmental stages.

FIG. 7 comparison of ethylene release variation in different maturity stages for wild type tomato and transgenic tomato fruits.

FIG. 8 comparison of hardness changes in wild type tomato and transgenic tomato fruits at different developmental stages.

FIG. 9 quantitative analysis of ethylene synthesis and signal transduction related genes and maturation related genes in different time periods of wild type tomato and transgenic tomato fruits.

FIG. 10 comparison of postharvest morphology of wild-type tomato and transgenic tomato fruits.

In the drawing, GR indicates a green ripening stage, B indicates a color transition stage, B +3 indicates 2 days after color transition, B +6 indicates 6 days after color transition, R indicates a fruit ripening stage, S1 indicates a first exponential growth stage of a fruit, S2 indicates a core hardening initiation stage of a fruit, S3 indicates a second exponential growth stage of a fruit, S4I indicates a fruit early-stage jump, S4II indicates a fruit jump stage, and S4III indicates a fruit late-stage jump.

Detailed Description

The following examples are intended to illustrate the invention, but are not intended to limit the scope of the invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art. The test methods in the following examples are conventional methods unless otherwise specified.

The solute type variety 'Zhongyou Tao No. 13' (CN 13) and the hard type variety 'Zhongyou Tao No. 16' (CN 16) are provided by the peach breeding garden of Zhengzhou fruit tree institute of Chinese academy of agricultural sciences.

Example A peach polypeptide hormone Synthesis GenePpRGF1Separation and identification of

Test method

1. GenePpRGF1Separation of

Extracting peach pulp RNA by using a plant polysaccharide polyphenol kit (DP 441, Tiangen Biochemical technology (Beijing) Co., Ltd.), obtaining single-stranded cDNA by using a reverse transcription kit (Tiangen Biochemical technology (Beijing) Co., Ltd.), obtaining a gene by PCR (kit FastStart SYBR Green Master available from Roche Biotechnology Co., Ltd.) by using the single-stranded cDNA as a template and the following sequence as a primerPpRGF1The electrophoretogram of PCR amplification of the full-length sequence of (1) is shown in FIG. 1. GenePpRGF1The total length sequence of the protein is shown as SEQ ID NO. 1 in the sequence table and is 489bp in total, and the amino acid sequence of the codified protein is shown as SEQ ID NO. 2 in the sequence table and is 162 in total. Peach shapePpRGF1And Arabidopsis thalianaAtGLVThe amino acid sequences of the family were subjected to multiple sequence alignment and a phylogenetic tree was constructed, and the results are shown in FIGS. 2 and 3.

As can be seen from FIG. 2, the peachesPpRGF1And Arabidopsis thalianaAtGLVFamily proteins all contain a conserved C-terminal motif consisting of 13 amino acids.

As can be seen from FIG. 3, the peachesPpRGF1AndAtGLV1has the closest evolutionary relationship.

The primer sequence is as follows:

forward directionPpRGF1-F：5'-ATGTCTTCCATTGTTCTTCT-3'；

Reverse directionPpRGF1-R: 5'-CTAGGACTTTCTATTGTGAA-3' are provided. The annealing temperature for PCR was 58 ℃.

2. GenePpRGF1Analysis of expression

Fluorescent quantitative PCR operation steps: the total RNA of roots, stems, leaves, flowers and peach fruits in different development periods is extracted by adopting a polysaccharide polyphenol RNA extraction kit SK8662 (from the beginning of life, Shanghai), cDNA is synthesized by adopting a reverse transcription kit KR106 (Tiangen, Beijing), and qRT-PCR detection is carried out by using a Lignt-Cycler 480 II fluorescence quantifier by taking the cDNA as a template, and an amplification reaction is carried out by adopting SYBR Green I Master (Roche, Switzerland).

The total reaction volume was 15ul, including 100 ng cDNA (1 uL), 2 XLightcycler 480 SYBR Green I Master (7.5 uL), 0.5 umol. L-1 upstream and downstream primers (0.75 uL each) and RNase-free water (5 uL).

Reaction procedure: pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 30 s, annealing at 60 ℃ for 30 s, and extension at 72 ℃ for 30 s for 45 cycles. Each sample was replicated 3 times. Specific primers were designed for each transcript sequence using Primer Express 3.0.

The sequence of the quantitative primer is as follows:

positive direction Q PpRGF1-F：5'- TCTTCCAATAGGAGCAGCACT -3'；

Reverse Q PpRGF1-R：5'- CATTTGTGCTTTAGTAAGACGG -3'。

Detection by qRT-PCRPpRGF1The gene is expressed in different tissues of solute type 'nectarine No. 13' (CN 13) and different developmental stages of solute type 'nectarine No. 13' (CN 13) and hard type 'nectarine No. 16' (CN 16). The four sampling time points of the two varieties (CN 13 and CN 16) were S1, S2, S3, S4I, S4II and S4 III. SelectingActin（ppa007242m) As an internal control gene (Brandi et al, 2011), 2 was used^--ΔΔCTThe relative expression of the genes was calculated using the formula (Livak and Schmittgen, 2001), and the results are shown in FIGS. 4 and 5.

As can be seen from FIG. 4, the peach fruits have different developmental stages by the solute type (CN 13) and the hard type (CN 16)PpRGF1The expression comparison of the genes shows that the fruits are in the mature periodPpRGF1The expression in solute type (CN 13) was significantly higher than in hard type (CN 16), while the expression was up-regulated with ripening of the fruit, while the expression in hard type (CN 16) was barely detectable.

As can be seen from FIG. 5, the genesPpRGF1CN13 was expressed in different tissues of root, stem, leaf, flower and fruit, with the highest expression level in stem and fruit.

3、PpRGF1Gene function identification test

For the study ofPpRGF1Whether the gene participates in auxin and ethylene signal pathways in the peach maturation process to play a role or not is analyzed and identified through transgenic tomatoes.

3.1 construction of recombinant vectors

The target fragment obtained by PCR was cloned by pTOPO-blunt vector and then ligated to Com-pH2GW7.0 vector using one-step cloning kit (Vazyme, Nanjing Novozam Biotech Co., Ltd.). The primers are as follows:

G- PpRGF1-F：5'-AAAAAGCAGGCTTCATGTCTTCCATTGTTCTTCT-3'；

G- PpRGF1-R：5'-AGAAAGCTGGGTcCTAGGACTTTCTATTGTGAA-3'。

and detecting positive clones. The positive clones were then sent to Shanghai Biotechnology GmbH for sequencing.

3.2 screening of transgenic tomato Positive strains

Since peach has not established a high-efficiency mature genetic transformation system, the model plant Micro-Tom tomato is used forPpRGF1Functional verification of genes, tomato transformation methods were optimized with reference to Sun et al (2006), Bee Lynn Chew and Yu Pan (university of Nudingham). The surface of the Micro-Tom tomato seeds is disinfected by 75% alcohol, and after the seeds are rinsed for 3 times by sterile water, the seeds are disinfected by 10% sodium hypochlorite for 1 hour. Taking out, washing in sterile water for 6 times, and air drying on filter paper. Seeds were sown in 1/2MS medium with pH =5.9 containing 0.8% agar. The plants are in 14 h/10 h light dark, 25 ℃, 80% relative humidity and 250 mu mol m^-2 s^-1Culturing in a light-intensity tissue culture room.

Extracting sequencedPpRGF1-Com-pH2GW7.0The plasmid of the vector is transferred into agrobacterium GV3101 by a liquid nitrogen freeze-thaw method. Adjusting the concentration OD of the agrobacterium liquid to 0.5, carrying out dip-dyeing transformation on the Micro-Tom tomatoes by a leaf disc method, and differentiating leaves and roots on a rooting culture medium. After the seedlings grow into plantlets, DNA is extracted, and positive plants are identified by conventional PCR. (ii) harvesting of T₀After seed generation, positive plants were screened on 1/2MS medium containing kanamycin. The transgenic positive plant contains antibiotic gene, and after growing true leaf and main root on antibiotic-containing culture medium, transplanting it into soil to culture and harvesting T₁And (5) seed generation. T is₁After sowing seeds, use T₂The transgenic tomato generation observed differences from the wild type. The following experiments all utilize T₂Generation and progeny homozygous lines.

PCR molecular identification positive plant primers:

Com-pH2GW7.0F：5'-TTGGAGAGGACTCCGGTATT-3'；

Com-Adapter attB2：5'-GGGGACCACTTTGTACAAGAAAGCTGGGT-3'。

for confirmation of fragment insertion.

3 transformants with high expression were selectedPpRGF1Gene strain (A)PpRGF1-6，PpRGF1-8，PpRGF1-15) Comparison was made with the wild type as a representative strain.

EXAMPLE two genesPpRGF1Action in transgenic tomato

2.1 GenePpRGF1Effects on tomato fruit development

FIG. 6 is an observation of fruits of wild type tomato and transgenic type tomato at different developmental stages. As can be seen from FIG. 6, the transgenic tomato begins to turn color 41d after full bloom, the wild type tomato begins to turn color 45d after full bloom, i.e. the transgenic tomato matures about 4d earlier than the wild type tomato, and in addition, the transgenic tomato and the wild type tomato have the same color in the mature period.

2.3 GenePpRGF1Influence on tomato fruit hardness and ethylene Release amount

Ethylene measurements were performed on transgenic and wild type tomato fruits at different days post anthesis (37 dpa, 41dpa, 45dpa, 50dpa, 53dpa, 59 dpa). FIG. 7 is a comparison of the ethylene release variation of fruits of wild type tomato and transgenic type tomato at different maturity stages. As can be seen from FIG. 7, the ethylene release of both the wild type and the transgenic tomato showed a tendency of increasing and then decreasing; compared with wild tomato, the transgenic tomato has higher release amount and the time of the peak of ethylene release is earlier.

FIG. 8 is a comparison of the hardness changes of wild-type tomato and transgenic tomato fruits at different developmental stages. As can be seen from fig. 8, the firmness gradually decreased during the ripening of the tomato fruit, and the transgenic tomato was less firm than the wild type tomato.

2.4 GenePpRGF1Mechanism for regulating and controlling fruit ripening of tomatoes

To study furtherPpRGF1The regulation mechanism of the gene on fruit ripening uses qRT-PCRThe technology identifies the genes related to ethylene synthesis and signal transduction (such asACO1AndACS4) Maturation-associated genes (e.g., SEQ ID NO: S)E4、E8、RINAndCNRetc.) expression in different developmental stages of the fruit.

FIG. 9 is a quantitative analysis of ethylene synthesis and signal transduction related genes and maturation related genes in different stages of fruits of wild type tomato and transgenic type tomato. As can be seen from FIG. 9, the genes involved in ethylene synthesis and signal transduction during the development of wild-type and transgenic tomatoACO1AndACS4and maturation-associated genesE4、E8The expression trend of the tomato is the same as the ethylene release trend, and the ethylene release peak of the transgenic tomato appears earlier than that of the wild tomato; and in the mature period of the fruit, the mature related geneE4、E8、RIN、CNRShows that the expression level of the transgenic tomato fruit is obviously higher than that of the wild tomato fruit. Therefore, the transgenic tomato can promote the expression of ethylene and maturation related genes, and stimulate the release of ethylene in the fruit development process, thereby promoting the fruit maturation.

2.5 GenePpRGF1Influence on shrinkage and aging of tomato fruit

FIG. 10 is a comparison of postharvest morphology of wild type tomato and transgenic tomato fruits. As can be seen from fig. 10, the transgenic tomato fruit began to shrink after 14 days of standing at room temperature, and the wild type tomato fruit did not shrink; thus, compared to wild type tomato fruits, the transgenes accelerate the desiccation shrinkage of the tomato, which is detrimental to postharvest storage.

The above-mentioned embodiments are merely preferred embodiments of the present invention, which are merely illustrative and not restrictive, and it should be understood that other embodiments may be easily made by those skilled in the art by replacing or changing the technical contents disclosed in the specification, and therefore, all changes and modifications that are made on the principle of the present invention should be included in the scope of the claims of the present invention.

SEQUENCE LISTING

<110> Zhengzhou fruit tree institute of Chinese academy of agricultural sciences

<120> peach polypeptide hormone synthetic gene PpRGF1 and application thereof

<130> 2019

<160> 10

<170> PatentIn version 3.3

<210> 1

<211> 489

<212> DNA

<213> PpRGF1

<400> 1

atgtcttcca ttgttcttct cttttttctt tgtctttcta tccatgcatg caattcccga 60

cttctaggcc ttgttgataa gcaaagtggc agtaaatcct accattctgt tgaggatgta 120

gcgaaagtct taagtgagac tttaaagtca tcgatgatgc ctaccatctc agttgaatac 180

caagcacaac aaataaacgc tgaaacattc acccatgaaa gtatcccgac ggctcttttg 240

aggaaacaag ggcatgccaa tggaccagcc tcaggatatg atattattgc attatcttcc 300

caggttgagc tgaagaaatt gattgaaatg cagggattga agaggcaggc acggacatta 360

ctgggatctg caacacataa catggaggaa gacaaagatt cgaaggaaga tgaagctatt 420

gaggtcgtag gtgttatgga ttatgcacaa cctcacagga agccacccat tcacaataga 480

aagtcctag 489

<210> 2

<211> 162

<212> PRT

<213> protein encoded by PpGGF 1

<400> 2

Met Ser Ser Ile Val Leu Leu Phe Phe Leu Cys Leu Ser Ile His Ala

1 5 10 15

Cys Asn Ser Arg Leu Leu Gly Leu Val Asp Lys Gln Ser Gly Ser Lys

20 25 30

Ser Tyr His Ser Val Glu Asp Val Ala Lys Val Leu Ser Glu Thr Leu

35 40 45

Lys Ser Ser Met Met Pro Thr Ile Ser Val Glu Tyr Gln Ala Gln Gln

50 55 60

Ile Asn Ala Glu Thr Phe Thr His Glu Ser Ile Pro Thr Ala Leu Leu

65 70 75 80

Arg Lys Gln Gly His Ala Asn Gly Pro Ala Ser Gly Tyr Asp Ile Ile

85 90 95

Ala Leu Ser Ser Gln Val Glu Leu Lys Lys Leu Ile Glu Met Gln Gly

100 105 110

Leu Lys Arg Gln Ala Arg Thr Leu Leu Gly Ser Ala Thr His Asn Met

115 120 125

Glu Glu Asp Lys Asp Ser Lys Glu Asp Glu Ala Ile Glu Val Val Gly

130 135 140

Val Met Asp Tyr Ala Gln Pro His Arg Lys Pro Pro Ile His Asn Arg

145 150 155 160

Lys Ser

<210> 3

<211> 20

<212> DNA

<213> Positive PpRGF1-F

<400> 3

atgtcttcca ttgttcttct 20

<210> 4

<211> 20

<212> DNA

<213> reverse PpRGF1-R

<400> 4

ctaggacttt ctattgtgaa 20

<210> 5

<211> 21

<212> DNA

<213> Positive Q PpRGF1-F

<400> 5

tcttccaata ggagcagcac t 21

<210> 6

<211> 22

<212> DNA

<213> reverse Q PpRGF1-R

<400> 6

catttgtgct ttagtaagac gg 22

<210> 7

<211> 34

<212> DNA

<213> G- PpRGF1-F

<400> 7

aaaaagcagg cttcatgtct tccattgttc ttct 34

<210> 8

<211> 33

<212> DNA

<213> G- PpRGF1-R

<400> 8

agaaagctgg gtcctaggac tttctattgt gaa 33

<210> 9

<211> 20

<212> DNA

<213> Com-pH2GW7.0F

<400> 9

ttggagagga ctccggtatt 20

<210> 10

<211> 29

<212> DNA

<213> Com-Adapter attB2

<400> 10

ggggaccact ttgtacaaga aagctgggt 29

Claims (2)

1. Peach polypeptide hormone synthetic genePpRGF1The application in tomato breeding is characterized in that the tomato breeding is used for promoting the fruit ripening of tomatoes and accelerating the water loss and shrinkage of the tomatoes; the peach polypeptide hormone synthetic genePpRGF1In (1) orderShown in SEQ ID NO 1.

2. Use according to claim 1, characterized in that said tomato breeding comprises the following steps:

a: construction of hormone synthetic gene containing peach polypeptidePpRGF1The recombinant vector of (1);

b: transforming the constructed recombinant vector into tomato tissue or cell;

c: and breeding and screening to obtain the transgenic tomato.

Images