CN115838764B - Method for accurately detecting space-time expression of juvenile hormone receptor of drosophila melanogaster and application thereof - Google Patents

Abstract

The invention discloses a method for accurately detecting the space-time expression of a Drosophila juvenile hormone receptor and application thereof. Belongs to the technical field of insect gene editing. The method comprises the following steps: designing gRNA aiming at a target gene Met, carrying out PCR amplification and transcriptional synthesis; cas9mRNA preparation; constructing a homologous arm vector connected with Met; constructing a donor plasmid vector; cas9mRNA, gRNA, donor plasmid were transfected into drosophila, screened, identified. The constructed Met-mcherry knock-in drosophila can truly and accurately reflect the space-time expression of Met. The obtained drosophila can provide technical support for the subsequent research of Met functions. In addition, the method can be used for researching the molecular mechanism of the regulation and control juvenile hormone signal path.

Description

Method for accurately detecting space-time expression of juvenile hormone receptor of drosophila melanogaster and application thereof

Technical Field

The invention relates to the technical field of insect gene editing, in particular to a method for accurately detecting the space-time expression of a Drosophila juvenile hormone receptor and application thereof.

Background

Juvenole Hormone (JH) is a fat-soluble sesquiterpene hormone synthesized and secreted by the pharyngeal flank of insects, and since Wigglesworth first discovered and reported in 1934 when blood sucking stink Rhodnius prolixus was studied, roller et al determined the sesquiterpene structure of JH in 1967. There are 8 natural JHs in insects today, JH0, JHI, JHII, JHIII, 4-methyl JHI, JHB3, JHSB3 and Methyl Farnesate (MF), respectively. Of these, JHIII is the most common JH form, found in most of the lepidoptera, blattaria, hemiptera, hymenoptera, coleoptera, lepidoptera, diptera and other insects; whereas JH0, JHI, JHII and 4-methyl JHI are present only in lepidopteran insects; JHB3 and JHSB3 are specific to insects of the order Diptera, brevibacterium, and Hemiptera, respectively; MF has been considered JH in crustaceans, which lacks an epoxy group than JHIII, but recent studies have found that MF also has JH-like function in drosophila.

As the name suggests, the naming of JH is based on the early discovery that JH can allow insect larvae to maintain their larval status after periodic molting. When the larvae reach a critical weight, JH synthesis in the insect ceases, and the larvae become transformed into pupae or emerge into adults. While exogenous JH treatment can cause the generation of overage larvae or secondary pupae; in contrast, blocking JH synthesis results in premature metamorphosis in the insect. Thus, JH plays a role in maintaining the current state of larvae and preventing metamorphosis. Further researches show that JH plays an important role in the aspects of reproduction, diapause, behaviors, immunity, social grade determination and the like of insects. However, regardless of the chemical structure form or physiological function of JH in insects, its regulation is mediated by its receptor.

Research in a large number of insects in the last decade has demonstrated that Methoprene-tolerant (Met) is a JH intracellular receptor. JH is combined with ligand binding site in Met PASB structural domain, then promotes Met to enter nucleus and coactivator Taiman to form functional receptor complex, and then directly binds JH reaction element (JH response element, JHRE) (core sequence is Ebox: CACGTG) of JH target gene promoter region to regulate and control transcription expression of target gene. It is clear that regulation of insect growth and development etc. by JH is dependent on the spatial and temporal expression of the receptor Met and subcellular localization. However, the research on Met space-time expression is limited because no suitable Met antibody is obtained in scientific research laboratories at home and abroad.

At present, two main methods for indicating Met expression are reported at home and abroad: (1) Constructing UAS-Met-X transgenic drosophila (X is tag protein, such as UAS-Met-V5 drosophila), utilizing drosophila Gal4-UAS system to overexpress Met-tag protein, then utilizing tag protein antibody to detect expression positioning condition of Met, etc. The disadvantage of this method is that the tissue expression of Met is actually determined by Gal4, independent of Met itself expression, and that the method is exogenous over-expression of Met and thus does not truly reflect endogenous Met expression. (2) The bacterial artificial chromosome recombination technology is utilized to obtain Gal4 transgenic drosophila (Met-Gal 4) driven by Met promoter, then hybridization is carried out between the Met-Gal4 and UAS-GFP drosophila, and the space-time expression of Met is obtained by observing the expression condition of GFP. However, this technique is affected by factors such as the positional effect of recombinant chromosome insertion (which may cause peripheral gene deletion), the expression intensity of Gal4, and the conformation of the coupled reporter gene, and also cannot accurately reflect Met expression.

Therefore, how to provide a method for accurately detecting the spatial-temporal expression of Drosophila juvenile hormone receptor is a problem to be solved by those skilled in the art.

Disclosure of Invention

In view of the above, the invention provides a method for accurately detecting the space-time expression of Drosophila juvenile hormone receptor and application thereof.

In order to achieve the above purpose, the present invention adopts the following technical scheme:

a method for accurately detecting the spatial-temporal expression of a drosophila juvenile hormone receptor, comprising the following steps:

(1) Designing gRNA aiming at a target gene Met, carrying out PCR amplification and transcriptional synthesis;

(2) Cas9mRNA preparation;

(3) Constructing a homologous arm vector connected with Met;

(4) Constructing a donor plasmid vector;

(5) Cas9mRNA, gRNA, donor plasmid were transfected into drosophila, screened, identified.

Preferably: step (1) gRNA includes gRNA1, nucleotide sequence: GACCAGCACGCTGCGATGAC, as shown in SEQ ID No. 14; gRNA2 nucleotide sequence: GATGACGGGCTGATGGAACC as shown in SEQ ID No. 15.

Preferably: step (1) PCR system: 2 XM 5 Taq Hifi mix 30. Mu.l, 0.5 ng/. Mu.l plasmid scf-gRNA 6. Mu.l, 10. Mu.M gRNA universal reverse primer 3. Mu.l, 10. Mu.MgRNA 1 or gRNA2 3. Mu.l, ddH ₂ O18 μl; the PCR reaction conditions were: 95 ℃ 3min;95 ℃ for 30s,55 ℃ for 30s,72 ℃ for 20s,35 cycles; and at 72℃for 10min.

Preferably: the step (2) comprises: linearizing Cas9 plasmid MLM3613 using in vitro restriction enzyme PmeI; the enzyme digestion system is as follows: rCutSmart ^TM Buffer 7.5. Mu.l, plasmid MLM3613 20. Mu.g, 10000units/ml PmeI 1. Mu.l, add ddH ₂ O was added to 75. Mu.l.

Preferably: step (3) using primers Met-KI-5 and Met-KI-3, pBSK-R and pBSK-F, taking Drosophila W1118 genome and pBSK plasmid as templates, and obtaining fragments 1 and 2 by PCR, wherein the nucleotide sequence of the Met-KI-5 is shown as SEQ ID No. 6; the nucleotide sequence of Met-KI-3 is shown as SEQ ID No. 7; the nucleotide sequence of pBSK-R is shown as SEQ ID No. 12; the nucleotide sequence of pBSK-F is shown as SEQ ID No. 13; and (3) connecting the fragment 1 and the fragment 2 by adopting seamless cloning to obtain a vector connected into a Met homology arm, wherein the nucleotide sequence is shown as SEQ ID No. 3.

Preferably: the reaction system is as follows: 2X Phanta Max Buffer. Mu.l, 10mM each dNTP Mix 1. Mu.l, 10. Mu.M primer1 and 10. Mu.M primer2 each 2. Mu.l, phanta Max Super-Fidelity DNA Polymerase 1. Mu.l, 30-200 ng template 1. Mu.l, ddH ₂ O was added to 50. Mu.l; the PCR reaction conditions were: 3min segment 1 at 95℃or 30s segment 2;95℃15s,65℃15s fragment 1, or 60℃15s fragment 2, 72℃3min,35 cycles; and at 72℃for 5min.

Preferably: step (4) utilizing primers Met-KI-Mcherry-3F and Met-KI-Mcherry-5R, mcherry-5 and Mcherry-3, taking a vector connected with a Met homology arm and Mcherry as a template, and obtaining fragments 3 and 4 by PCR, wherein the nucleotide sequences of the Met-KI-Mcherry-3F are shown as SEQ ID No. 9; the nucleotide sequence of Met-KI-mcherry-5R is shown as SEQ ID No. 8; the nucleotide sequence of Mcherry-5 is shown as SEQ ID No. 10; the nucleotide sequence of Mcherry-3 is shown as SEQ ID No. 11; and (3) connecting the fragment 3 and the fragment 4 by adopting seamless cloning to obtain a donor plasmid vector, wherein the nucleotide sequence is shown as SEQ ID No. 5.

Preferably: and (3) identification: comprises identifying primers Met-KI-mch-5F and mcherry-5R, mcherry-3F and Met-KI-mch-3R; the nucleotide sequence of Met-KI-mch-5F is shown as SEQ ID No. 16; the nucleotide sequence of mcherry-5R is shown as SEQ ID No. 17; the nucleotide sequence of Mcherry-3F is shown as SEQ ID No. 18; the nucleotide sequence of Met-KI-mch-3R is shown as SEQ ID No. 19.

The invention also provides application of any one of the methods in constructing transgenic drosophila melanogaster.

Preferably: the method is used for researching the molecular mechanism of regulating and controlling the juvenile hormone signal path.

Compared with the prior art, the technical scheme provided by the invention provides a method for accurately detecting the space-time expression of the juvenile hormone receptor of the drosophila melanogaster and application thereof, and the obtained technical effect is that the constructed Met-mcherry knock-in drosophila melanogaster can truly and accurately reflect the space-time expression of the Met. The obtained drosophila can provide technical support for the subsequent research of Met functions. In addition, the method can be used for researching the molecular mechanism of the regulation and control juvenile hormone signal path.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings that are required to be used in the embodiments or the description of the prior art will be briefly described below, and it is obvious that the drawings in the following description are only embodiments of the present invention, and that other drawings can be obtained according to the provided drawings without inventive effort for a person skilled in the art.

FIG. 1 is a schematic diagram showing the construction principle of the Met-mcherry knock-in drosophila provided by the invention.

FIG. 2 is a diagram showing gel electrophoresis of identification of Met-mcherry positive Drosophila provided by the invention, A: carrying out a gel electrophoresis pattern of a PCR (polymerase chain reaction) product by taking Met-KI-mch-5F and mcherry-5R as primers and microinjection of Drosophila and wild W1118 Drosophila genome DNA as templates, wherein M is DL5000 DNA marker; KI5 is a positive clone drosophila group, and the theoretical length is 1954bp; WT is a negative control, wild type W1118 drosophila group; performing a gel electrophoresis pattern of a PCR product by taking Mcherry-3F and Met-KI-mch-3R as primers and microinjection of Drosophila and wild W1118 Drosophila genome DNA as templates; m is DL5000 DNA marker; KI3 is a positive clone drosophila group, and the theoretical length is 1791bp; WT was negative control, wild type W1118 drosophila group.

FIG. 3 is a graph showing subcellular localization of Met-mcherry in constructed fatty body tissues of Drosophila in different periods, wherein green fluorescence is an mcherry antibody indicating subcellular localization of Met-mcherry in the fatty body of transgenic Drosophila; blue is DAPI indicated nuclei; EW: short for early walk wandering; 96h AEL: for short 96 hours after spawning; 96h AEL+JH: drosophila fat bodies at 96 hours after spawning were cultured ex vivo by applying JH.

Detailed Description

The following description of the embodiments of the present invention will be made clearly and completely with reference to the accompanying drawings, in which it is apparent that the embodiments described are only some embodiments of the present invention, but not all embodiments. All other embodiments, which can be made by those skilled in the art based on the embodiments of the invention without making any inventive effort, are intended to be within the scope of the invention.

The embodiment of the invention discloses a method for accurately detecting the space-time expression of a Drosophila juvenile hormone receptor and application thereof.

The design key points of the Met-mcherry knock-in drosophila are shown in figure 1. Designing two gRNAs near a termination codon (TGA) locus of a gene encoding Met, so that two gaps are formed in the gene; a donor plasmid vector containing 5 'and 3' homology arms homologous upstream and downstream of the editing site and the mcherry nucleotide sequence (tag) was constructed simultaneously. Simultaneously injecting synthesized gRNA, cas9mRNA and donor plasmid vector into wild Drosophila W ¹¹¹⁸ And finally screening fertilized eggs under CRISPR/Cas9 mediated homologous recombination to obtain the Met-mcherry knock-in drosophila.

Example 1

Transcription synthesis of gRNA

gRNA1 (GACCAGCACGCTGCGATGAC, shown as SEQ ID No. 14) and gRNA2 (GATGACGGGCTGATGGAACC, shown as SEQ ID No. 15) are designed near the stop codon (TGA) site of the encoding Met gene by utilizing the Chopchop and cctop online websites, and the sequences of Shanghai biochemical synthesis are entrusted to obtain a transcription template of the gRNA by PCR amplification.

The PCR system (60 μl) was: 2 XM 5 Taq Hifi mix 30. Mu.l, plasmid scf-gRNA (0.5 ng/. Mu.l) 6. Mu.l, gRNA UniversalReverse primer (AAAAAAAAGCACCGACTCGGTGC CACTT) 10. Mu.M 3. Mu.l, gRNA1 or gRNA 210. Mu.M 3. Mu.l, ddH ₂ O 18μl。

The PCR reaction conditions were: 3min at 95 ℃;95 ℃ for 30s,55 ℃ for 30s,72 ℃ for 20s,35 cycles; and at 72℃for 10min.

The PCR product is purified, and the specific steps are as follows: new inlet EP tubes were prepared in the ultra clean bench, each with 100 μl ammonium acetate (5M) added; adding 2 times volume of absolute ethyl alcohol (400 mu l), and mixing uniformly in an upside-down manner; placing in a refrigerator at-20deg.C for 20min; centrifuging at-4deg.C for 15min at 14000rpm; carefully sucking the supernatant, and drying the precipitate for 10-15 min; add 10. Mu.l DEPC treated ddH ₂ O is dissolved. In vitro transcription of gRNA was performed using the T7 riboMAXTM Kit (promega).

The transcription system is as follows: buffer Mix 5. Mu.l, purified PCR template 4. Mu.l, enzyme 1. Mu.l. Incubation at 37deg.C for 35min, adding 0.5 μl of DNase, mixing, and incubating at 37deg.C in PCR instrument for 15min to remove DNA template, adding ddH treated with DEPC ₂ O to 60. Mu.l, adding 60. Mu.l of water saturated phenol/chloroform, centrifuging at 12000rpm for 5min, sucking 45. Mu.l of supernatant to 1.5ml of EP tube, adding 1/10 volume of sodium acetate for 5. Mu.l, mixing thoroughly, adding 2.5 times volume of 125. Mu.l of absolute ethanol (RNA-specific), -standing at 20℃for 20-30 min, centrifuging at 4℃for 15min at 14000rpm, carefully sucking supernatant once with 200. Mu.l of 70% ethanol (RNA-specific), centrifuging at 4℃for 5min at 14000rpm, sucking supernatant, precipitating in a 37℃oven for drying, ddH treated with DEPC of corresponding volume ₂ O dissolves the precipitate.

Example 2

Cas9mRNA preparation

Cas9 plasmid MLM3613 was first linearized using the in vitro restriction enzyme PmeI (NEB).

The enzyme digestion system is as follows: rCutSmart ^TM Buffer 7.5. Mu.l, plasmid MLM 361320. Mu.g, pmeI (10000 units/ml) 1. Mu.l, add ddH ₂ O was added to 75. Mu.l. The reaction was carried out at 37℃for 30min. Running electrophoresis of the digested plasmid to determine complete linearization, and the total amount is 70 μl; 2% SDS 23. Mu.l was added to a final concentration of 0.5%; protease K (20000. Mu.g/ml) was added to a final concentration of 100. Mu.g/ml, and the mixture was incubated at 50℃for 30min with a PCR instrument; transfer to a 1.5ml centrifuge tube, add 45. Mu.l chloroform and 45. Mu.l tris saturated phenol, centrifuge at 12000rpm for 5min, aspirate 90. Mu.l of supernatantTo a new centrifuge tube (inlet). Adding 10 μl of 1/10 volume 3M sodium acetate (pH 5.2), mixing thoroughly, adding 200 μl of pre-cooled absolute ethanol with 2 times of volume, mixing thoroughly, standing at-20deg.C for 30min, centrifuging at 4deg.C and 14000rpm for 15min, and sucking away supernatant; 100. Mu.l of 70% ethanol, 14000rpm,2min, the supernatant was aspirated, and the precipitate was dried and dissolved in 20. Mu.l of ddH ₂ O, the concentration is ensured to be more than 500 ng/. Mu.l.

Using the purified product as a template, using a mMESSAGET7 transcription kit (Ambion) performs in vitro transcription. The reaction system is as follows: 2 XNTP/CAP 10. Mu.l, GTP 4. Mu.l, 10 Xreaction buffer, 2. Mu.l (1-2. Mu.g) of the linear template (Psp 6-cas 9) and 2. Mu.l of Enzyme Mix. After 2h in an oven at 37℃30 μl ddH was added ₂ O, 30. Mu.l LiCl (mMESSAGE mM ACHINE@kit supply), -standing at 20℃for 30min; centrifuging at 14000rpm at 4deg.C for 15min; the supernatant was aspirated, washed once with 100. Mu.l of 70% ethanol, and centrifuged at 14000rpm for 5min at 4 ℃; the supernatant was aspirated off, the pellet was dried and dissolved in 14. Mu.l ddH ₂ O (mMESSAGE mMACHINE@kit).

The transcripts obtained were subjected to polyA tailing via E.coli Poly (A) polymerase Kit (NEB), system (20. Mu.l): 14. Mu.l of transcript, 10 XE.coli Poly (A) PolymeraseReact ion buffer. Mu.l, ATP (10 mM) 2. Mu.l, recombinant RNase Inhibitor (Takara) 1. Mu.l, E.coli Poly (A) Polymerase 1. Mu.l. Oven at 37℃for 45min. Finally, the purified product was recovered using RNeasy Mini Kit (QIAGEN). The method comprises the following specific steps: with ddH without RNAse ₂ The sample was adjusted to 100. Mu.l by O, 350. Mu.l RLT was added and mixed well, and 250. Mu.l ethanol was added and mixed well; the sample (700. Mu.l) was transferred to an RNeasy column placed in 2ml with collection tubes. Centrifuging at 8000g for 15s, and discarding residual liquid; mu.l of buffer RPE was added to the RNeasy column, 8000g was centrifuged for 15s, the residual solution was discarded, and 500. Mu.l of buffer RPE was added to the RNeasy column. 8000g was centrifuged for 2min and the residual solution was discarded and the RNeasy column was placed in a fresh 1.5ml centrifuge tube. Add 30. Mu.l of ddH without RNAse ₂ O.8000g was centrifuged for 1min and the eluted RNA was stored at-80 ℃.

Example 3

(1) Construction of vector into Met homology arm

Fragment 1 and fragment 2 were obtained by cloning using the primers and templates in Table 1, respectively. The reaction system (50. Mu.l) was: 2X Phanta Max Buffer. Mu.l, dNTP Mix (10 mM each) 1. Mu.l, primer1 (10. Mu.M) and primer2 (10. Mu.M) each 2. Mu.l, phanta Max Super-Fidelity DNA Polymerase (Norpran) 1. Mu.l, template 1. Mu.l (30-200 ng), ddH ₂ O was added to 50. Mu.l.

The PCR reaction conditions were: 3min (fragment 1) or 30s (fragment 2) at 95 ℃;95℃15s,65℃15s (fragment 1) or 60℃15s (fragment 2), 72℃3min,35 cycles; and at 72℃for 5min. The PCR product was purified and recovered using Takara gel recovery kit (Cat # 9762). Fragment 1 and fragment 2 were ligated using Gibson Assembly Kit (cat#e2611L, NEB) seamless cloning kit, reaction system (20 μl): 2X Gibson Assembly Master Mix 20 μl, fragment 1 (200 ng) +fragment 2 (100 ng), ddH ₂ O was added to 50. Mu.l. The reaction system was placed in a 50℃water bath for 15min, followed by conventional transformation and sequencing to obtain the vector with the homologous arm attached to Met, designated pBS-Met-arm.

TABLE 1 homology Arm vector construction required primer, template and product Length

Wherein the nucleotide sequence of fragment (number) 1:

CCTCTTCGCTATTACGCCAGACTCCACTTCCACGTCGGCCTCAACTTCGGGCAGTGATCTGGAGGAGGAGGAAATGGAGACGGAGGAACACCGTCTGGGTCGGCAGCAGGGAGAGGCGGACGATGACGAGGATCACCCGTACAACCGACGAACACCCAGCCCGCGGAGAATGGCCCATTTGGCGACCATTGATGACCGACTACGCATGGATCGGCGCTGCTTTACCGTCCGCTTGGCTAGGGCTTCCACGCGAGCGGAGGCCACGCGTCATTACGAGCGGGTTAAGATCGATGGCTGCTTTCGTCGCAGTGACTCCTCCTTAACCGGAGGTGCCGCTGCCAACTATCCGATTGTCTCCCAGCTGATACGACGCTCGAGAAACAACAATATGCTGGCTGCTGCTGCAGCAGTGGCAGCAGAAGCGGCGACGGTGCCGCCCCAGCACGATGCCATTGCCCAGGCGGCGCTGCACGGGATTAGCGGCAATGATATTGTCCTGGTGGCCATGGCCAGGGTGCTGCGAGAGGAACGGCCGCCTGAGGAGACGGAGGGTACAGTGGGCTTGACCATTTACAGACAGCCAGAACCCTATCAGTTGGAGTACCATACGAGGCATCTAATCGACGGCAGCATCATCGACTGTGATCAAAGGATTGGTCTGGTGGCGGGATATATGAAGGATGAGgtgggtatattaacatcatctctctgaactgcttacgacaactaatcgtgtactctccactcgaaacagGTGCGCAACCTTAGTCCCTTCTGTTTCATGCACCTGGACGACGTTCGCTGGGTGATTGTGGCCCTTCGACAAATGTACGATTGCAACAGTGACTACGGCGAGAGCTGCTACCGTCTGCTGTCCCGCAACGGGCGCTTCATTTACCTGCACACCAAGGGATTTCTGGAGGTCGACCGTGGCAGTAATAAGGTGCATTCCTTTCTGTGCGTCAACACGCTGCTCGATGAGGAGGCGGGCCGGCAAAAGGTGCAGGAGATGAAGGAGAAATTCTCGACAATCATCAAGGCGGAGATGCCCACGCAGAGCAGCAGTCCCGATTTGCCCGCCTCGCAGGCACCGCAGCAACTTGAGAGAATTGTCCTCTATCTAATAGAGAACCTACAGAAGAGTGTGGATTCAGCAGAGACGGTTGGCGGCCAGGGCATGGAAAGCCTAATGGACGATGGCTACAGTTCGCCAGCAAATACCTTAACTCTCGAGGAGTTAGCTCCCTCGCCCACGCCCGCCTTGGCCTTGGTGCCGCCGGCTCCCTCATCGGTCAAGAGCTCCATCTCCAAGTCGGTGAGTGTGGTCAATGTGACGGCGGCCAGAAAGTTTCAGCAGGAGCATCAGAAGCAGCGTGAACGTGACCGTGAGCAGCTTAAGGAGCGCACCAACTCCACGCAGGGCGTGATCCGGCAACTGAGCAGCTGCCTAAGCGAGGCGGAAACGGCATCCTGTATCCTATCACCAGCCAGTAGCTTGAGTGCCAGCGAAGCACCGGACACGCCCGATCCGCACAGCAACACATCACCGCCACCGTCGCTCCACACACGTCCCAGTGTCCTGCATCGAACCCTGACCAGCACGCTGCGATGACGGGCTGATGGAACCTGGTTTGCCTTCTAATTGGGTGTGTGGAAATGGACGTCATTGGTAGCTCACGTGCCCACAAACGAATTAGTATCGGTAATATAATCCTGGCCAATCGCAAAATGAAAACCCAAAATGTATCAGAAAAAAACGAGCATTATTCAAATAGTTTAAAAATTCAGCCAAAAAACTTAAAAACGAAAAAAAAGAGCGTGGGTTGAAAAACCTTTTGTTTTCATATTCACATTTCCAAGCTTTGAGCAATCAAACAATTTTAATTTTCAGTATACACATATGTATAATGAGTTGGCTTTACAAAAGCTATTAACAAATCAAGCAATTGTGTAATTTAATATGAGACTTTCCGTGATTTTCGCTTTCTACGTACTTTTCGACTTCAATTGATCTATAGGGTTTCCGTATTAAAAACGAAATTAACGTGGTTTCATTTGATGAAAATGCAATATGAGCTCGCATTTATTTTGATATTATGACAGTAATAATGATCTGATCACGATAATCGTTTTCTCAAAACATAAGCGATACATTTTGGGTACATTTGGCCATTACTGTTTCTGTGTGTGATTTCGGTATAAAATAGTAGTTTGATTACATGTTATATTGATGAATGGCGATCGGTGGGTGCTGCTAAATGCGTTCCATTATCAATAATTTTCGTTATGTAATTACGTTTAATTTGTAAATATGTATGAGTGCGAGCGTGAGTGAGTTTGTGATCGTGTCAGCATGGGTGTGAATGAACATTAGATCAGTGCTCGGATTTGGTTTTAGTTGAAATTTAAACCCCATTTCCCCGATTTCCCAGTTATCACCTTCCGCCCCAAAACACCAGTGTAAAAAGAGTACAAAAAAAAAAAGAAAAGAAAATAGAAAAACAAACAAACAATTATATATTTATTTCGCCCTAAGTCTAGAACGTGCTAAACACAACTCATTAATAGTTAAACAAACGGATGTTGCAATCGATGGAAATTAAACGCTCGCTTTTAGTTTTGCCGTCTCGCTCGAAGAAAGAAAGAGGACTACATATGTACAGTCAAACTAATCCAAGTCAAACTCTTCAGTCTCAGAATTGGAGACTTTATTAAAGGTTTTTTATTTTATGAAGAATAGCATATTATTTTTATATATATATATTTATGTATATATATTTATATCACAAATCTCCTTCGATATCCCTTTGTAATCTATAAAAACACTTCCAGGCGCAGCTTTATTTTTCAACAGTTTTAATTTTGGGAACTTTACAAAGCATATAAGCATACCCCAAATCCATATCCTTATAAACTTTGTAGTTATTACAAATGTGTTCAAAATTAAAAAAAAAGTTTGTCATCCAAAATCCAATCCGCTAAATACAATATAATCATTTTAATTGATCTATGTTACACTTCTATAATGTCTACTGGACAAAATATGATTAAGTTGAAATTTCAAAGTGTTTTTGAAGTTCGTACTAGCGAAGTTTGGCTGTAGTTCAATACTCACAGAAAGGGAGCGAGACATATTCCCATCTCGCTCCGACCTGTTATCAAAGCCTTTGCCATTGTCCTTGGCGTTGCGTTCTTGGCGTAATCATGGTCATAGC, as shown in SEQ ID No. 1;

nucleotide sequence of fragment (accession number) 2:

TGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTAGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGTCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAACGCGAATTTTAACAAAATATTAACGCTTACAATTTCCATTCGCCATTCAGGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAG, as shown in SEQ ID No. 2;

(2) Construction of donor plasmid vector

The specific procedure is the same as in (1), and fragment 3 and fragment 4 are obtained by cloning with the primers and templates shown in Table 2. Fragment 3 and fragment 4 were ligated using Gibson Assembly Kit (Cat#E2611L, NEB) seamless cloning kit to obtain the donor plasmid pBSK-5Arm-mcherry-3Arm vector for microinjection.

TABLE 2 construction of primers, templates and product Length required for donor vector construction

Nucleotide sequence of fragment (No.) 3:

catggacgagctgtacaagTAACGGGCTGATGGAACCTCGTTTGCCTTCTAATTGGGTGTGTGGAAATGGACGTCATTGGTAGCTCACGTGCCCACAAACGAATTAGTATCGGTAATATAATCCTGGCCAATCGCAAAATGAAAACCCAAAATGTATCAGAAAAAAACGAGCATTATTCAAATAGTTTAAAAATTCAGCCAAAAAACTTAAAAACGAAAAAAAAGAGCGTGGGTTGAAAAACCTTTTGTTTTCATATTCACATTTCCAAGCTTTGAGCAATCAAACAATTTTAATTTTCAGTATACACATATGTATAATGAGTTGGCTTTACAAAAGCTATTAACAAATCAAGCAATTGTGTAATTTAATATGAGACTTTCCGTGATTTTCGCTTTCTACGTACTTTTCGACTTCAATTGATCTATAGGGTTTCCGTATTAAAAACGAAATTAACGTGGTTTCATTTGATGAAAATGCAATATGAGCTCGCATTTATTTTGATATTATGACAGTAATAATGATCTGATCACGATAATCGTTTTCTCAAAACATAAGCGATACATTTTGGGTACATTTGGCCATTACTGTTTCTGTGTGTGATTTCGGTATAAAATAGTAGTTTGATTACATGTTATATTGATGAATGGCGATCGGTGGGTGCTGCTAAATGCGTTCCATTATCAATAATTTTCGTTATGTAATTACGTTTAATTTGTAAATATGTATGAGTGCGAGCGTGAGTGAGTTTGTGATCGTGTCAGCATGGGTGTGAATGAACATTAGATCAGTGCTCGGATTTGGTTTTAGTTGAAATTTAAACCCCATTTCCCCGATTTCCCAGTTATCACCTTCCGCCCCAAAACACCAGTGTAAAAAGAGTACAAAAAAAAAAAGAAAAGAAAATAGAAAAACAAACAAACAATTATATATTTATTTCGCCCTAAGTCTAGAACGTGCTAAACACAACTCATTAATAGTTAAACAAACGGATGTTGCAATCGATGGAAATTAAACGCTCGCTTTTAGTTTTGCCGTCTCGCTCGAAGAAAGAAAGAGGACTACATATGTACAGTCAAACTAATCCAAGTCAAACTCTTCAGTCTCAGAATTGGAGACTTTATTAAAGGTTTTTTATTTTATGAAGAATAGCATATTATTTTTATATATATATATTTATGTATATATATTTATATCACAAATCTCCTTCGATATCCCTTTGTAATCTATAAAAACACTTCCAGGCGCAGCTTTATTTTTCAACAGTTTTAATTTTGGGAACTTTACAAAGCATATAAGCATACCCCAAATCCATATCCTTATAAACTTTGTAGTTATTACAAATGTGTTCAAAATTAAAAAAAAAGTTTGTCATCCAAAATCCAATCCGCTAAATACAATATAATCATTTTAATTGATCTATGTTACACTTCTATAATGTCTACTGGACAAAATATGATTAAGTTGAAATTTCAAAGTGTTTTTGAAGTTCGTACTAGCGAAGTTTGGCTGTAGTTCAATACTCACAGAAAGGGAGCGAGACATATTCCCATCTCGCTCCGACCTGTTATCAAAGCCTTTGCCATTGTCCTTGGCGTTGCGTTCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTAGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGTCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAACGCGAATTTTAACAAAATATTAACGCTTACAATTTCCATTCGCCATTCAGGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGACTCCACTTCCACGTCGGCCTCAACTTCGGGCAGTGATCTGGAGGAGGAGGAAATGGAGACGGAGGAACACCGTCTGGGTCGGCAGCAGGGAGAGGCGGACGATGACGAGGATCACCCGTACAACCGACGAACACCCAGCCCGCGGAGAATGGCCCATTTGGCGACCATTGATGACCGACTACGCATGGATCGGCGCTGCTTTACCGTCCGCTTGGCTAGGGCTTCCACGCGAGCGGAGGCCACGCGTCATTACGAGCGGGTTAAGATCGATGGCTGCTTTCGTCGCAGTGACTCCTCCTTAACCGGAGGTGCCGCTGCCAACTATCCGATTGTCTCCCAGCTGATACGACGCTCGAGAAACAACAATATGCTGGCTGCTGCTGCAGCAGTGGCAGCAGAAGCGGCGACGGTGCCGCCCCAGCACGATGCCATTGCCCAGGCGGCGCTGCACGGGATTAGCGGCAATGATATTGTCCTGGTGGCCATGGCCAGGGTGCTGCGAGAGGAACGGCCGCCTGAGGAGACGGAGGGTACAGTGGGCTTGACCATTTACAGACAGCCAGAACCCTATCAGTTGGAGTACCATACGAGGCATCTAATCGACGGCAGCATCATCGACTGTGATCAAAGGATTGGTCTGGTGGCGGGATATATGAAGGATGAGgtgggtatattaacatcatctctctgaactgcttacgacaactaatcgtgtactctccactcgaaacagGTGCGCAACCTTAGTCCCTTCTGTTTCATGCACCTGGACGACGTTCGCTGGGTGATTGTGGCCCTTCGACAAATGTACGATTGCAACAGTGACTACGGCGAGAGCTGCTACCGTCTGCTGTCCCGCAACGGGCGCTTCATTTACCTGCACACCAAGGGATTTCTGGAGGTCGACCGTGGCAGTAATAAGGTGCATTCCTTTCTGTGCGTCAACACGCTGCTCGATGAGGAGGCGGGCCGGCAAAAGGTGCAGGAGATGAAGGAGAAATTCTCGACAATCATCAAGGCGGAGATGCCCACGCAGAGCAGCAGTCCCGATTTGCCCGCCTCGCAGGCACCGCAGCAACTTGAGAGAATTGTCCTCTATCTAATAGAGAACCTACAGAAGAGTGTGGATTCAGCAGAGACGGTTGGCGGCCAGGGCATGGAAAGCCTAATGGACGATGGCTACAGTTCGCCAGCAAATACCTTAACTCTCGAGGAGTTAGCTCCCTCGCCCACGCCCGCCTTGGCCTTGGTGCCGCCGGCTCCCTCATCGGTCAAGAGCTCCATCTCCAAGTCGGTGAGTGTGGTCAATGTGACGGCGGCCAGAAAGTTTCAGCAGGAGCATCAGAAGCAGCGTGAACGTGACCGTGAGCAGCTTAAGGAGCGCACCAACTCCACGCAGGGCGTGATCCGGCAACTGAGCAGCTGCCTAAGCGAGGCGGAAACGGCATCCTGTATCCTATCACCAGCCAGTAGCTTGAGTGCCAGCGAAGCACCGGACACGCCCGATCCGCACAGCAACACATCACCGCCACCGTCGCTCCACACACGTCCCAGTGTCCTGCATCGAACCCTGACCAGCACGCTGCGAggtggaggaggctctggtgg, as shown in SEQ ID No. 3;

the PCR forward and reverse primers are amplified in the opposite direction by taking TGA in the fragment 1 as a boundary and are divided into 2 parts which are respectively positioned at the head and the tail of the fragment number 3, and TAA changes a stop codon TAG in the fragment number 1 into TAA; the C at position 17 after TAA replaces G in the original sequence, preventing the donor plasmid vector from being recognized by gRNA and sheared.

Nucleotide sequence of fragment (No.) 4:

ggTggAGGAGGCTCTGGTGGAGGCGGTAGCGGAGGCGGAGGGTCGgtgagcaagggcgaggaggataacatggccatcatcaaggagttcatgcgcttcaaggtgcacatggagggctccgtgaacggccacgagttcgagatcgagggcgagggcgagggccgcccctacgagggcacccagaccgccaagctgaaggtgaccaagggtggccccctgcccttcgcctgggacatcctgtcccctcagttcatgtacggctccaaggcctacgtgaagcaccccgccgacatccccgactacttgaagctgtccttccccgagggcttcaagtgggagcgcgtgatgaacttcgaggacggcggcgtggtgaccgtgacccaggactcctccctgcaggacggcgagttcatctacaaggtgaagctgcgcggcaccaacttcccctccgacggccccgtaatgcagaagaagaccatgggctgggaggcctcctccgagcggatgtaccccgaggacggcgccctgaagggcgagatcaagcagaggctgaagctgaaggacggcggccactacgacgctgaggtcaagaccacctacaaggccaagaagcccgtgcagctgcccggcgcctacaacgtcaacatcaagttggacatcacctcccacaacgaggactacaccatcgtggaacagtacgaacgcgccgagggccgccactccaccggcggcatggacgagctgtacaag, as shown in SEQ ID No. 4;

wherein ggTggAGGAGGCTCTGGTGGAGGCGGTAGCGGAGGCGGAGGGTCG represents a linker sequence.

The primers and sequences used for the construction of the entire vector are shown in Table 3.

TABLE 3 primers and sequences for donor vector construction

pBSK-5Arm-mcherry-3Arm vector nucleotide sequence:

AGGCGGTAGCGGAGGCGGAGGGTCGgtgagcaagggcgaggaggataacatggccatcatcaaggagttcatgcgcttcaaggtgcacatggagggctccgtgaacggccacgagttcgagatcgagggcgagggcgagggccgcccctacgagggcacccagaccgccaagctgaaggtgaccaagggtggccccctgcccttcgcctgggacatcctgtcccctcagttcatgtacggctccaaggcctacgtgaagcaccccgccgacatccccgactacttgaagctgtccttccccgagggcttcaagtgggagcgcgtgatgaacttcgaggacggcggcgtggtgaccgtgacccaggactcctccctgcaggacggcgagttcatctacaaggtgaagctgcgcggcaccaacttcccctccgacggccccgtaatgcagaagaagaccatgggctgggaggcctcctccgagcggatgtaccccgaggacggcgccctgaagggcgagatcaagcagaggctgaagctgaaggacggcggccactacgacgctgaggtcaagaccacctacaaggccaagaagcccgtgcagctgcccggcgcctacaacgtcaacatcaagttggacatcacctcccacaacgaggactacaccatcgtggaacagtacgaacgcgccgagggccgccactccaccggcggcatggacgagctgtacaagTAACGGGCTGATGGAACCTCGTTTGCCTTCTAATTGGGTGTGTGGAAATGGACGTCATTGGTAGCTCACGTGCCCACAAACGAATTAGTATCGGTAATATAATCCTGGCCAATCGCAAAATGAAAACCCAAAATGTATCAGAAAAAAACGAGCATTATTCAAATAGTTTAAAAATTCAGCCAAAAAACTTAAAAACGAAAAAAAAGAGCGTGGGTTGAAAAACCTTTTGTTTTCATATTCACATTTCCAAGCTTTGAGCAATCAAACAATTTTAATTTTCAGTATACACATATGTATAATGAGTTGGCTTTACAAAAGCTATTAACAAATCAAGCAATTGTGTAATTTAATATGAGACTTTCCGTGATTTTCGCTTTCTACGTACTTTTCGACTTCAATTGATCTATAGGGTTTCCGTATTAAAAACGAAATTAACGTGGTTTCATTTGATGAAAATGCAATATGAGCTCGCATTTATTTTGATATTATGACAGTAATAATGATCTGATCACGATAATCGTTTTCTCAAAACATAAGCGATACATTTTGGGTACATTTGGCCATTACTGTTTCTGTGTGTGATTTCGGTATAAAATAGTAGTTTGATTACATGTTATATTGATGAATGGCGATCGGTGGGTGCTGCTAAATGCGTTCCATTATCAATAATTTTCGTTATGTAATTACGTTTAATTTGTAAATATGTATGAGTGCGAGCGTGAGTGAGTTTGTGATCGTGTCAGCATGGGTGTGAATGAACATTAGATCAGTGCTCGGATTTGGTTTTAGTTGAAATTTAAACCCCATTTCCCCGATTTCCCAGTTATCACCTTCCGCCCCAAAACACCAGTGTAAAAAGAGTACAAAAAAAAAAAGAAAAGAAAATAGAAAAACAAACAAACAATTATATATTTATTTCGCCCTAAGTCTAGAACGTGCTAAACACAACTCATTAATAGTTAAACAAACGGATGTTGCAATCGATGGAAATTAAACGCTCGCTTTTAGTTTTGCCGTCTCGCTCGAAGAAAGAAAGAGGACTACATATGTACAGTCAAACTAATCCAAGTCAAACTCTTCAGTCTCAGAATTGGAGACTTTATTAAAGGTTTTTTATTTTATGAAGAATAGCATATTATTTTTATATATATATATTTATGTATATATATTTATATCACAAATCTCCTTCGATATCCCTTTGTAATCTATAAAAACACTTCCAGGCGCAGCTTTATTTTTCAACAGTTTTAATTTTGGGAACTTTACAAAGCATATAAGCATACCCCAAATCCATATCCTTATAAACTTTGTAGTTATTACAAATGTGTTCAAAATTAAAAAAAAAGTTTGTCATCCAAAATCCAATCCGCTAAATACAATATAATCATTTTAATTGATCTATGTTACACTTCTATAATGTCTACTGGACAAAATATGATTAAGTTGAAATTTCAAAGTGTTTTTGAAGTTCGTACTAGCGAAGTTTGGCTGTAGTTCAATACTCACAGAAAGGGAGCGAGACATATTCCCATCTCGCTCCGACCTGTTATCAAAGCCTTTGCCATTGTCCTTGGCGTTGCGTTCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTAGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGTCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAACGCGAATTTTAACAAAATATTAACGCTTACAATTTCCATTCGCCATTCAGGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGACTCCACTTCCACGTCGGCCTCAACTTCGGGCAGTGATCTGGAGGAGGAGGAAATGGAGACGGAGGAACACCGTCTGGGTCGGCAGCAGGGAGAGGCGGACGATGACGAGGATCACCCGTACAACCGACGAACACCCAGCCCGCGGAGAATGGCCCATTTGGCGACCATTGATGACCGACTACGCATGGATCGGCGCTGCTTTACCGTCCGCTTGGCTAGGGCTTCCACGCGAGCGGAGGCCACGCGTCATTACGAGCGGGTTAAGATCGATGGCTGCTTTCGTCGCAGTGACTCCTCCTTAACCGGAGGTGCCGCTGCCAACTATCCGATTGTCTCCCAGCTGATACGACGCTCGAGAAACAACAATATGCTGGCTGCTGCTGCAGCAGTGGCAGCAGAAGCGGCGACGGTGCCGCCCCAGCACGATGCCATTGCCCAGGCGGCGCTGCACGGGATTAGCGGCAATGATATTGTCCTGGTGGCCATGGCCAGGGTGCTGCGAGAGGAACGGCCGCCTGAGGAGACGGAGGGTACAGTGGGCTTGACCATTTACAGACAGCCAGAACCCTATCAGTTGGAGTACCATACGAGGCATCTAATCGACGGCAGCATCATCGACTGTGATCAAAGGATTGGTCTGGTGGCGGGATATATGAAGGATGAGgtgggtatattaacatcatctctctgaactgcttacgacaactaatcgtgtactctccactcgaaacagGTGCGCAACCTTAGTCCCTTCTGTTTCATGCACCTGGACGACGTTCGCTGGGTGATTGTGGCCCTTCGACAAATGTACGATTGCAACAGTGACTACGGCGAGAGCTGCTACCGTCTGCTGTCCCGCAACGGGCGCTTCATTTACCTGCACACCAAGGGATTTCTGGAGGTCGACCGTGGCAGTAATAAGGTGCATTCCTTTCTGTGCGTCAACACGCTGCTCGATGAGGAGGCGGGCCGGCAAAAGGTGCAGGAGATGAAGGAGAAATTCTCGACAATCATCAAGGCGGAGATGCCCACGCAGAGCAGCAGTCCCGATTTGCCCGCCTCGCAGGCACCGCAGCAACTTGAGAGAATTGTCCTCTATCTAATAGAGAACCTACAGAAGAGTGTGGATTCAGCAGAGACGGTTGGCGGCCAGGGCATGGAAAGCCTAATGGACGATGGCTACAGTTCGCCAGCAAATACCTTAACTCTCGAGGAGTTAGCTCCCTCGCCCACGCCCGCCTTGGCCTTGGTGCCGCCGGCTCCCTCATCGGTCAAGAGCTCCATCTCCAAGTCGGTGAGTGTGGTCAATGTGACGGCGGCCAGAAAGTTTCAGCAGGAGCATCAGAAGCAGCGTGAACGTGACCGTGAGCAGCTTAAGGAGCGCACCAACTCCACGCAGGGCGTGATCCGGCAACTGAGCAGCTGCCTAAGCGAGGCGGAAACGGCATCCTGTATCCTATCACCAGCCAGTAGCTTGAGTGCCAGCGAAGCACCGGACACGCCCGATCCGCACAGCAACACATCACCGCCACCGTCGCTCCACACACGTCCCAGTGTCCTGCATCGAACCCTGACCAGCACGCTGCGAggtggaggaggctctggtgg, as shown in SEQ ID No. 5;

example 4

Drosophila embryo microinjection

15 μg of Cas9mRNA, 7.5 μg of sgRNA, and 15 μg of donor plasmid were mixed in 30 μg of DEPC water and injected simultaneously into the W1118 fertilized eggs, totaling 300 fertilized eggs. Microinjection was done by Fang Jing Bio Inc. (http:// www.fungene.tech). The specific flow is as follows: collecting adults injected with drosophila melanogaster by using insect collecting cages, placing 400 adults in each insect collecting cage, collecting embryos on agar coated with yeast, collecting fresh embryos within 60 minutes, and washing the embryos on a cover glass; the tail of the embryo is outwards and orderly arranged on a cover glass from top to bottom; observing with microscope (OLYMPUS CKX 3-SLP), adjusting the needle tip and embryo to the same focal plane, operating with injector (eppendorf FemtoJet i), puncturing embryo tail, and injecting sample into embryo; the injected embryos are inserted into food, placed in a 25 ℃ incubator, and cultured until adults.

Screening of Met-mcherry transgenic Drosophila and obtaining of stable line

The P0 obtained by injection is hybridized with the fruit fly of the balance to obtain F1 generation, and the genome extraction of the single fruit fly is carried out on the P0 generation and the F1 generation. The method comprises the following specific steps: selecting single Drosophila, placing in a 1.5ml EP tube, adding 110 μl plant DNA extract PA (GeneStar@plant Genomic DNA Extraction Kit), grinding with a grinder for 3min or more, and standing in a metal bath at 65deg.C for more than 30min; adding 100 μl of chloroform, mixing upside down, shaking for 10s, centrifuging at 14000rpm at room temperature for 10min; carefully sucking about 65 μl of supernatant, adding twice volume of absolute ethanol (pre-cooling at 4deg.C for at least 10 min), mixing, and standing at-20deg.C for 15min or more; centrifuging at 14000rpm at 4deg.C for 10min, sucking the supernatant, standing at normal temperature or oven until the precipitate is dry, dissolving in appropriate amount of PB, adding 50 μl of Drosophila female, and adding 15 μl of Drosophila male.

Using the extracted genome as a template and the table4 and Table 5, the homology arms and mcherry insert sequences were PCR identified, respectively, and the reaction system (50. Mu.l): 2X Phanta Max Buffer. Mu.l, dNTP Mix (10 mM each) 1. Mu.l, primer1 (10. Mu.M) and primer2 (10. Mu.M) each 2. Mu.l, phanta Max Super-Fidelity DNA Polymerase (Norpran) 1. Mu.l, template 1. Mu.l (400 ng), ddH ₂ O was added to 50. Mu.l.

PCR reaction conditions: 3min at 95 ℃;95℃30s,65℃30s,72℃2kb/min,20 cycles; 95℃30s,55℃30s,72℃2kb/min,15 cycles; and at 72℃for 5min. The gel diagram for identifying positive transgenic drosophila is shown in figure 2. Progeny of the identified positive F1 were crossed with the ballast to construct stable lines.

TABLE 4 PCR identification of primers required for Met-mcherry positive transgenic Drosophila

Fragment numbering	Primer1	Primer2	Theoretical length
				Pair1	Met-KI-mch-5F	mcherry-5R	1954bp
Pair2	Mcherry-3F	Met-KI-mch-3R	1791bp

TABLE 5 PCR identification primer sequences for Met-mcherry positive transgenic Drosophila

Primer name	Primer sequences
		Met-KI-mch-5F	5'-TGATCAGGATCTGTTAAGACAGC-3', as shown in SEQ ID No. 16;
mcherry-5R	5'-GGAGCCGTACATGAACTGAG-3', as shown in SEQ ID No. 17;
		Mcherry-3F	5'-ACGACGCTGAGGTCAAGAC-3', as shown in SEQ ID No. 18;
Met-KI-mch-3R	5'-TCATATATTCCCTCCGATACGCC-3', as shown in SEQ ID No. 19;

example 5

To examine whether the Met-mcherry knock-in drosophila can truly respond to Met expression, immunocytosis staining was performed using mcherry antibodies, and subcellular localization of Met-mcherry was examined. Drosophila fat body tissues are selected as representatives, and subcellular localization of Met-mcherry in a migration period (EW) with higher JH titer and a 96h period (96 h AEL) after spawning with lower JH titer is detected respectively. The migration period (EW) Met-mcherry was found to be localized primarily in the nucleus by staining; whereas Met-mcherry was distributed in the cytoplasm during 96h AEL period. In vitro culture of 96h AEL drosophila fat body, and 2h treatment with JH induced transfer of Met-mcherry from cytoplasm into nucleus (see FIG. 3). The above results are consistent with reported Met subcellular localization, which indicates that the Met-mcherry knock-in drosophila can truly reflect the tissue localization of Met.

The immunofluorescence staining steps are as follows: dissecting fat body of Drosophila, washing with physiological saline once; fixing 4% paraformaldehyde at room temperature for 1h; washing with PBS for 3 times, each time for 5min; permeabilizing 0.5% TritonX-100 for 1h at room temperature; washing with PBS for 3 times, each time for 5min; sealing 5% sheep serum for 1h at room temperature; 5% sheep serum was used at 1:100 dilution of mcherry antibody (proteontech), incubation overnight at 4 ℃; washing with PBS for 3 times, each time for 5min; with 5% sheep serum 1:200 dilution Alexa Fluor 488-labeled goat anti-rabbit IgG (H+L) secondary antibody, incubation for 2H at room temperature; incubation of 2. Mu.g/ml DAPI for 5min at room temperature; washing with PBS for 3 times, each time for 5min; after 50% glycerol was sealed, the film was observed under a fluorescence microscope.

In the present specification, each embodiment is described in a progressive manner, and each embodiment is mainly described in a different point from other embodiments, and identical and similar parts between the embodiments are all enough to refer to each other.

The previous description of the disclosed embodiments is provided to enable any person skilled in the art to make or use the present invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the generic principles defined herein may be applied to other embodiments without departing from the spirit or scope of the invention. Thus, the present invention is not intended to be limited to the embodiments shown herein but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Claims (3)

1. A method for accurately detecting the spatial-temporal expression of a drosophila juvenile hormone receptor, comprising the following steps:

(1) Designing gRNA aiming at a target gene Methoprene-tolerant (Met), carrying out PCR amplification and transcriptional synthesis;

(2) Cas9mRNA preparation;

(3) Constructing a homologous arm vector connected with Met;

(4) Constructing a donor plasmid vector;

(5) Transfecting Cas9mRNA, gRNA and donor plasmids into Drosophila, and screening and identifying Drosophila positive for Met-mcherry detection;

(6) Detecting subcellular localization of Met-mcherry using mcherry antibodies;

the gRNA of step (1) includes gRNA1, nucleotide sequence: GACCAGCACGCTGCGATGAC as shown in SEQ ID No.14 and the nucleotide sequence of gRNA 2: GATGACGGGCTGATGGAACC, as shown in SEQ ID No. 15;

the PCR system in step (1): 2 XM 5 Taq Hifi mix 30. Mu.l, 0.5 ng/. Mu.l plasmid scf-gRNA 6. Mu.l, 10. Mu.M gRNA universal reverse primer 3. Mu.l, 10. Mu.M gRNA1 or gRNA2 3. Mu.l, ddH ₂ O18 μl; the PCR reaction conditions were: 3min at 95 ℃;95 ℃ for 30s,55 ℃ for 30s,72 ℃ for 20s,35 cycles; 72 ℃ for 10min;

the step (2) comprises: linearizing Cas9 plasmid MLM3613 using in vitro restriction enzyme PmeI; the enzyme digestion system is as follows: rCutSmart Buffer 7.5. Mu.l, plasmid MLM3613 20. Mu.g, 10000units/ml PmeI 1. Mu.l, add ddH ₂ O was added to 75. Mu.l;

step (3) Drosophila W using primers Met-KI-5 and Met-KI-3 ¹¹¹⁸ Obtaining a fragment 1 by genome PCR; the primers pBSK-R and pBSK-F are used for taking the pBSK plasmid as a template, and the fragment 2 is obtained by PCR; the nucleotide sequence of the Met-KI-5 is shown as SEQ ID No. 6; the nucleotide sequence of Met-KI-3 is shown in SEQ ID No. 7; the nucleotide sequence of pBSK-R is shown as SEQ ID No. 12; the nucleotide sequence of pBSK-F is shown as SEQ ID No. 13; adopting seamless cloning to connect the fragment 1 and the fragment 2 to obtain a carrier connected into a Met homology arm, wherein the nucleotide sequence is shown as SEQ ID No. 3;

the PCR reaction system is as follows: 2X Phanta Max Buffer. Mu.l, 10mM each dNTP Mix 1. Mu.l, 10. Mu.M primer1 and 10. Mu.M primer2 each 2. Mu.l, phanta Max Super-Fidelity DNA Polymerase 1. Mu.l, 30-200 ng template 1. Mu.l, ddH ₂ O was added to 50. Mu.l; the PCR reaction conditions were: 3min segment 1 at 95℃or 30s segment 2;95℃15s,65℃15s fragment 1, or 60℃15s fragment 2, 72℃3min,35 cycles; 72 ℃ for 5min;

step (4) PCR (polymerase chain reaction) to obtain a fragment 3 by using primers Met-KI-mcherry-3F and Met-KI-mcherry-5R and taking a carrier connected with a homologous arm of Met as a template; the primers Mcherry-5 and Mcherry-3 are utilized, mcherry is used as a template, and PCR is carried out to obtain a fragment 4, and the nucleotide sequence of the Met-KI-Mcherry-3F is shown as SEQ ID No. 9; the nucleotide sequence of Met-KI-mcherry-5R is shown as SEQ ID No. 8; the nucleotide sequence of Mcherry-5 is shown as SEQ ID No. 10; the nucleotide sequence of Mcherry-3 is shown as SEQ ID No. 11; and (3) connecting the fragment 3 and the fragment 4 by adopting seamless cloning to obtain a donor plasmid vector, wherein the nucleotide sequence is shown as SEQ ID No. 5.

2. The method of claim 1, wherein the identifying: comprises identifying primers Met-KI-mch-5F and mcherry-5R, mcherry-3F and Met-KI-mch-3R; the nucleotide sequence of the Met-KI-mch-5F is shown as SEQ ID No. 16; the nucleotide sequence of mcherry-5R is shown as SEQ ID No. 17; the nucleotide sequence of Mcherry-3F is shown as SEQ ID No. 18; the nucleotide sequence of Met-KI-mch-3R is shown as SEQ ID No. 19.

3. Use of the method according to any one of claims 1-2 for constructing transgenic drosophila melanogaster.