CN116083627A - Molecular marker linked with green traits of hypocotyl of capsicum, mutant gene, parting primer and application thereof - Google Patents

Molecular marker linked with green traits of hypocotyl of capsicum, mutant gene, parting primer and application thereof Download PDF

Info

Publication number
CN116083627A
CN116083627A CN202211665569.0A CN202211665569A CN116083627A CN 116083627 A CN116083627 A CN 116083627A CN 202211665569 A CN202211665569 A CN 202211665569A CN 116083627 A CN116083627 A CN 116083627A
Authority
CN
China
Prior art keywords
capsicum
hypocotyl
primer
molecular marker
green
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202211665569.0A
Other languages
Chinese (zh)
Inventor
刘峰
戴雄泽
马艳青
王中一
熊程
索欢
邹学校
王瑾
潘路招
陈莹
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Hunan Agricultural University
Original Assignee
Hunan Agricultural University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Hunan Agricultural University filed Critical Hunan Agricultural University
Priority to CN202211665569.0A priority Critical patent/CN116083627A/en
Publication of CN116083627A publication Critical patent/CN116083627A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0006—Oxidoreductases (1.) acting on CH-OH groups as donors (1.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6858—Allele-specific amplification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y101/00—Oxidoreductases acting on the CH-OH group of donors (1.1)
    • C12Y101/01—Oxidoreductases acting on the CH-OH group of donors (1.1) with NAD+ or NADP+ as acceptor (1.1.1)
    • C12Y101/01219—Dihydrokaempferol 4-reductase (1.1.1.219), i.e. dihydroflavonol-4-reductase
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/13—Plant traits
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Analytical Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Immunology (AREA)
  • Mycology (AREA)
  • Botany (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Medicinal Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention provides a molecular marker linked with green traits of hypocotyls of capsicum, mutant genes, parting primers and application thereof, and F is constructed by using wild type and mutant capsicum materials 2 Population, obtaining a chromosome region closely linked with a gene for controlling hypocotyl color of pepper seedlings by using a BSA population positioning method, developing a molecular marker in a candidate interval, designing 1 KASP molecular marker according to single base mutation, and using the marker to detect F 2 The single plant in the population is subjected to genotype identification, and the coincidence rate reaches 100%. The inventionThe DFR gene mutant of the capsicum in the open not only is beneficial to the identification and auxiliary breeding of morphological markers in the seedling stage of the capsicum, but also provides a basis for map cloning and molecular mechanism of the anthocyanin synthesis genes of the capsicum, and has wide popularization value.

Description

Molecular marker linked with green traits of hypocotyl of capsicum, mutant gene, parting primer and application thereof
Technical Field
The invention belongs to the technical field of pepper breeding molecular biology, and particularly relates to a molecular marker linked with green traits of hypocotyls of peppers, mutant genes, parting primers and application thereof.
Background
Heterosis refers to F 1 The generation hybrid is superior to the parent in growth, development, yield or environmental adaptability. In the last century, heterosis utilization improves the yield of most crops worldwide, and plays a vital role in the aspects of grain safety and the like. The Capsicum (Capsicum annuum L.) belongs to a common cross-pollinated crop, has strong hybrid vigor, and can greatly improve the yield, the resistance and the quality of the Capsicum by applying hybrid vigor to seed production. F (F) 1 The hybrid seeds of the generation can greatly improve the yield and agronomic characters of the capsicum. The yield and quality of the capsicum can be greatly improved through heterosis breeding, and the hybrid seeds are popularized and planted in a large area in the market.
The morphological marker in seedling stage plays an important role in heterosis utilization, and compared with molecular markers based on genotyping and morphological marker operation in later development stage, the morphological marker has the advantages of rapidness, convenience and economy. These markers can be detected at an early stage of crop development and they are more economically convenient than molecular markers for genotyping or morphological markers at a later stage of development. The morphological markers in seedling stage have been widely used in indirect selection of ideal traits in crops such as cotton and rape. Leaf color marker genes GRY79 and YSA can be effectively used for identifying and rejecting false hybrid seeds in hybrid rice production. GRY79 is involved in chloroplast development, whereas YSA is a member of the pentapeptide repeat (PPR) gene family, which is essential for chloroplast development in early seedling leaves. CmGL encodes an HD-ZIP type IV transcription factor that functions in the formation of melon multicellular epidermal hair. Mutations in CmGL lead to a hairless phenotype in the aerial organs, which makes it easy to distinguish inbred seeds from hybrid seeds at an early stage.
In addition, the color of the hypocotyl of the young stem is an important morphological marker in the seedling stage, for example, 3.4kb deletion of the SlGSTAA gene causes the accumulation of anthocyanin in the hypocotyl of the tomato to be blocked, and the SlGSTAA is closely linked with the sterile gene ms-10, so that sterile plants are screened by identifying the color of the young stem of the tomato in the production application. Tomato AH (Hoffman's flower stress) mutants have no anthocyanin pigment in many tissues including hypocotyls, and their pathogenic gene AH encodes a bHLH transcription factor that regulates anthocyanin biosynthesis. Hypocotyl color was identified F 1 Useful markers for hybrid seeds. However, most pepper varieties have purple hypocotyls due to anthocyanin accumulation, while few pepper varieties have green hypocotyls. Therefore, the development of the molecular marker linked with the green trait of the hypocotyl of the capsicum and the cloning of related genes are of great significance to the research of the molecular mechanism of the early screening of the target trait of the capsicum and the formation of the hypocotyl anthocyanin.
Disclosure of Invention
Aiming at overcoming the defects in the prior art and aiming at the phenomenon of hypocotyl color change in the seedling stage of the capsicum, the invention provides a molecular marker, a mutant gene, a parting primer and application thereof which are linked with the green character of the hypocotyl of the capsicum, provides a novel seedling stage morphological marker for the capsicum, is beneficial to directional breeding of high-quality capsicum varieties, reduces cost, is fast in production practice and has important application value in the purity detection of capsicum hybrid seeds.
In order to solve the technical problems, the technical scheme provided by the invention is as follows:
in a first aspect, the invention provides a molecular marker linked to green traits of hypocotyls of capsicum, wherein the molecular marker is a nucleotide sequence on a capsicum genome, the molecular marker comprises a base sequence located in a 161.2-162.8Mbp interval of chromosome 2, and G-to-A mutation occurs at 161361466 position on chromosome 2.
As an alternative embodiment, the invention provides a molecular marker in which the mutation of G to A is present in the second exon region of the DFR (Dihydrolavanol 4-reduction) gene.
In an alternative embodiment, the molecular marker provided by the invention is obtained by screening the phenotypically stable hypocotyl green mutant material after EMS mutagenesis.
As a general technical idea, the second aspect of the present invention provides a capsicum DFR mutant gene comprising the following base mutations on a base sequence of a DFR gene sequence of chromosome 2 of a capsicum genome, namely: a mutation of the G to A occurs at the base at position 120 in the second exon in the DFR gene.
As a general technical idea, the third aspect of the present invention provides a KASP typing primer for identifying, screening or applying the above molecular marker or the above CaDFR mutant gene of capsicum, the primer sequence of the KASP typing primer is:
forward primer 4X: GGGTAGCCACATGGAATACTCC (SEQ ID No. 1);
forward primer 4Y: GGGTAGCCACATGGAATACTCC (SEQ ID No. 2);
reverse primer 4C: AGCTGATACAAACTTAACGCTGTG (SEQ ID No. 3).
As an alternative embodiment, in the KASP-typed primer provided by the invention, two forward primers are respectively connected with different fluorescent linker sequences, and one of the fluorescent linker sequences is selected from FAM, HEX, FITC, RED, TET, JOE, R.
As an alternative embodiment, the KASP typing primer provided by the invention comprises the following forward primer with a fluorescent linker sequence:
forward primer Hypocotyl-4X:
GAAGGTGACCAAGTTCATGCTGGGTAGCCACATGGAATACTCC(SEQ ID No.4)；
forward primer Hypocotyl-4Y:
GAAGGTCGGAGTCAACGGATTGGGTAGCCACATGGAATACTCT(SEQ ID No.5)。
the fluorescent linker sequences selected in this application were chosen as FAM and HEX, with the forward primer Hypocotyl-4X attached to FAW and the forward primer Hypocotyl-4Y attached to HEX.
As a general technical concept, the fourth aspect of the present invention provides application of the above molecular marker or the CaDFR mutant gene or the typing primer for the auxiliary screening, identification and breeding of pepper varieties with green color of hypocotyl of pepper seedlings.
The breeding in the invention means that the genetic hybridization means is utilized to carry out hybridization breeding on the material of the DFR gene mutant controlling the color change of the hypocotyl or the protein coded by the DFR mutant gene and plants with other important characters, and the hypocotyl color of the filial generation is screened, so that the other character of the filial generation is rapidly screened for directional breeding.
As an alternative embodiment, the invention provides an application in which the detection is carried out using a PCR reaction.
In an alternative embodiment, the invention provides an application wherein the PCR detection comprises the steps of:
(1) Taking genomic DNA of a sample to be detected as a template, and amplifying by using a molecular marked amplification primer to obtain an amplification product;
(2) And detecting and analyzing the amplified product.
As an optional implementation mode, in the application provided by the invention, when fluorescence detection is carried out on an amplified product after PCR is finished, a fluorescence signal (FAM) corresponding to a primer Hypocotyl-4X is detected, and a detection site is C, C genotype is determined, and the Hypocotyl of the capsicum is determined to be a purple phenotype single plant; when a fluorescent signal (HEX) corresponding to the primer Hypocotyl-4Y is detected, the detection site is T, the T genotype is determined as a Hypocotyl green phenotype single plant; if two fluorescent signals are detected simultaneously, the detection site is the T-C genotype, and the hypocotyl purple phenotype single plant is judged.
As an alternative embodiment, in the application provided by the present invention, a Touchdown PCR is used for detection, and the Touchdown PCR amplification procedure is as follows: 94 ℃ for 15min;95 ℃ for 20s; 60s at 65-56 ℃ for 10 cycles, and the annealing extension temperature of each cycle is reduced by 0.8 ℃;94 ℃ for 20s;57 ℃ 60s,30 cycles.
Compared with the prior art, the invention has the beneficial effects that:
(1) The invention utilizes a BSA positioning method to position a new gene for controlling the color of hypocotyl in the seedling stage of the capsicum, and develops a KASP molecular marker related to the gene for controlling the color of hypocotyl in the seedling stage of the capsicum according to the mutation site of the gene. The molecular marker can be directly used for identifying morphological markers and corresponding genotypes in the seedling stage of the capsicum, and further depends on the molecular marker for auxiliary breeding, so that the problems of long conventional breeding period, easiness in environmental influence and the like can be effectively solved. The molecular marker can be used for rapidly screening satisfactory plants in early stage, effectively reducing the planting scale, reducing the workload of later stage identification and improving the selection efficiency and accuracy.
(2) The discovered capsicum DFR gene mutant is helpful for shortening the directional breeding period, adopts hybridization, backcrossing and other technologies to rapidly introduce the molecular markers for controlling the hypocotyl color of capsicum seedling stage and other excellent trait genes into plants, and provides important morphological markers for rapid breeding of high-quality new varieties. The green hypocotyl is used as a convenient seedling morphological marker, is favorable for directional breeding of high-quality capsicum varieties, reduces cost and has important application value in capsicum hybrid seed purity detection, dominant breeding practice and research.
Drawings
FIG. 1 is a phenotype map of a wild type 'Zhangshaugang' plant and a mutant 'Caya' plant in example 1, wherein FIG. A, B, C is a phenotype map of seedlings, stems and anthers of a wild type 'Zhangshaugang', respectively, and FIG. D, E, F is a phenotype map of seedlings, stems and anthers of a mutant 'Caya';
FIG. 2 is a graph showing the result of the chromosome region for fine localization of the color gene of hypocotyl in seedling stage of capsicum control in example 2, wherein PS/PA represents purple hypocotyl, purple anther of plant, and GS/YA represents green hypocotyl, yellow anther;
FIG. 3 is F constructed in example 2 between wild type ('Zhangshaugang') and mutant (Caya) 2 Partial result graphs of genotyping in the population;
FIG. 4 is a phenotype of CaDFR pepper silence plants in example 3, where `Zhangshaugang` is wild-type and pTRV2-CaDFR is the silence plant;
FIG. 5 shows the qRT-PCR expression results of CaDFR pepper silenced plants in example 3, where `Zhangshaugang` is wild type and pTRV2-CaDFR is silenced plant;
FIG. 6 is a graph showing anthocyanin content measurement of wild type 'Zhangshaugang' and pTRV2-CaDFR silent plants in example 3, wherein 'Zhangshaugang' is wild type and pTRV2-CaDFR is silent plant.
Detailed Description
The present invention will be described more fully hereinafter with reference to the accompanying drawings, in which preferred embodiments are shown, for the purpose of illustrating the invention, but the scope of the invention is not limited to the specific embodiments shown.
Unless defined otherwise, all technical and scientific terms used hereinafter have the same meaning as commonly understood by one of ordinary skill in the art. The terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the scope of the present invention.
Unless otherwise specifically indicated, the various raw materials, reagents, instruments, equipment and the like used in the present invention are commercially available or may be prepared by existing methods.
Example 1
And (5) group construction and candidate interval determination.
1. Construction of populations
The mutant material Caya with stable phenotype is further obtained by carrying out EMS mutagenesis on the wild pepper Zhangshaggy'. Wild type 'zhangshaugang' exhibited purple seedling hypocotyls, pale purple adult plant stems and leaves, purple anthers (fig. 1a, b, c). The mutant `Caya` appears green in seedling hypocotyls, green in adult plant stems and leaves, and yellow in anthers (FIGS. 1D, E, F).
Hybridization of wild type 'zhangshagg' with mutant 'Caya' to obtain F 1 Instead of F 1 Obtaining F by substitution selfing 2 Generation of segregating populations. Of them, 30 strains F 1 All showed wild type phenotype characteristics, indicating that the mutant traits are controlled by a recessive single gene.
2. Isolated population phenotype identification
For strain 676F 2 And carrying out multiple trait statistics on the segregating population, wherein investigation results show that anthers of all green hypocotyl plants are yellow, and anthers of all purple hypocotyl plants are purple, which indicates that the two traits are controlled by one gene. F (F) 2 In the population, 522 plants of purple hypocotyl purple anther capsicum and 154 plants of green hypocotyl yellow anther capsicum are provided, and the separation ratio is close to 3:1 (Xc) 2 ＝1.76<X 2 0.05,1 =3.84), the green hypocotyl yellow anther phenotype was determined to be controlled by a pair of recessive nuclear genes, following mendelian's law of genetics, and the results are shown in table 1.
Table 1: investigation and statistics of offspring characters of mutant Caya genetic group
Figure BDA0004014598700000051
Note that: x is X 2 >3.84(1)，P<0.05, the difference is obvious; x is X 2 <3.84(1)，P>0.05, the difference was not significant.
3. Candidate gene primary localization for regulating and controlling green hypocotyl yellow anther phenotype
At F 2 Respectively selecting 25 purple hypocotyl purple anther single plants and 25 green hypocotyl yellow anther single plants in a population, punching and sampling each single plant leaf, respectively constructing a fertility DNA mixed pool and a sterile DNA mixed pool after equal amount mixing, taking 'Caya' plant leaves as parent mixed pools, and extracting total DNA of 3 mixed pools by using a CTAB method (cetyl trimethyl ammonium bromide method). 3 were mixed using TruSeq DNA LT Sample Prep Kit (Illumina corporation)Pool DNA is used for constructing a pool, genome sequencing is carried out through a IlluminaNovaseq PE150 platform, acquired data is subjected to strict quality control, reads are compared to a capsicum reference genome through bwa software, and SNP loci of the whole genome are searched through SAMtools software. Analysis found that the sequencing depths of the wild-type pool and the mutant pool were 18.48× and 20.99×, respectively, each covering more than 99% of the whole genome. Screening alkali matrix value is more than or equal to 30, mapping mass value is more than or equal to 30, base depth is more than or equal to 2 and less than or equal to 80 in two F2 mixing pools, and meanwhile, more than or equal to 2 and less than or equal to 40 in two parents, so as to finally obtain 734273 difference SNP. And calculating the maximum allele frequency (SNP-index) and the corresponding delta SNP-index value of the recessive pool, and mapping by taking 2Mb as a window and 200kb as a step length. Since SNPs associated with a trait of interest are inherited in linkage with SNPs surrounding them on the chromosome, the candidate interval Δsnp-index is 0.5 or more, or is close to 1, whereas Δsnpindex is randomly distributed up and down 0.5 in a genomic region where no trait is associated. The distribution of delta SNP-index values was observed, and it was found that there was a distinct peak region on the whole genome, the delta SNP-index value of this region was above 0.5 and close to 1, lying between 156.5 and 168.3Mbp on chromosome 2, i.e., the region where the gene regulating the yellow anther of the green hypocotyl of the pepper seedling was located.
Molecular marker development and CaDFR gene fine localization
1、F 2 Preparation of generation separation population whole genome DNA sample
Extraction of 676 Strain F Using CTAB 2 The procedure of DNA of the individual plants is as follows: adding 1 steel ball and a few fresh tender leaves into a 2ml centrifuge tube, putting into liquid nitrogen, freezing thoroughly, pouring out the steel balls rapidly after finishing grinding by a machine, adding 65 ℃ preheated CTAB (800 ul), shaking and mixing uniformly, and putting into a 65 ℃ water bath for 30min; taking out the sample, adding 500u1DNA extract, shaking vigorously to mix thoroughly, centrifuging at 12000rpm for 10min, carefully sucking 500ul supernatant to a new 1.5ml centrifuge tube, adding 500u1 precooled isopropanol mixture, slowly mixing uniformly, and standing at-20deg.C for 2 hr; taking out the sample from the previous step, centrifuging at 12000rpm for 10 minutes at 4 ℃, discarding the supernatant, precipitating DNA at the bottom of the centrifuge tube, and inversely airing the water on the tube wall; with 100ul ddH 2 O (RNase with final concentration of 1%) dissolves DNA, and the DNA is taken out after being placed at 37 ℃ for about 60 min.
2. KSAP molecular marker development
Selecting excellent mutation sites obtained in the step 3 of the example 1, designing KASP primers near the mutation sites, amplifying by using DNA of wild pepper 'Zhangshagg' and mutant 'Caya' as templates, and finally screening 9 available molecular markers by analyzing different fluorescent signals carried by parents, wherein the primers are shown in the table 2.
Table 2: KASP labeled primer information
Figure BDA0004014598700000061
/>
Figure BDA0004014598700000071
The molecular marker application is specifically as follows:
(1) The molecular marker primer comprises two forward primers and one reverse primer, wherein the two forward primers are respectively connected with different fluorescent linker sequences, and the sequences are as follows:
FAM(GAAGGTGACCAAGTTCATGC，SEQ ID No.6)；
and HEX (GAAGGTCGGAGTCAACGGAT, SEQ ID No. 7).
(2) Using the above primers, touchDown PCR was used, and the reaction system was as shown in Table 3 below:
table 3: PCR reaction system
Figure BDA0004014598700000072
Figure BDA0004014598700000081
The amplification procedure was: 94 ℃ for 15min;95 ℃ for 20s; 60s at 65-56 ℃ for 10 cycles, and the annealing extension temperature of each cycle is reduced by 0.8 ℃;94 ℃ for 20s;57 ℃ 60s,30 cycles.
When the amplified product is subjected to fluorescence detection, if the sample PCR product only detects a fluorescence signal (FAM) corresponding to a primer Hypocotyl-X, the detection site is C:C genotype, and the Hypocotyl of the capsicum is judged to be a purple phenotype single plant; if the sample PCR product only detects a fluorescence signal (HEX) corresponding to a primer Hypocotyl-Y, the detection site is T, the T genotype is determined to be a Hypocotyl green phenotype single plant; if two fluorescent signals are detected simultaneously, the detection site is the T-C genotype, and the hypocotyl purple phenotype single plant is judged.
The molecular marker (mutation of G to A at position 161361466 on chromosome 2 of capsicum genome) was designated as Hypocotyl-4. F constructed for 'Zhangshagg' and 'Caya' using Hypocotyl-4 marker 2 Leaves of 676 individuals are selected from the population for genotyping verification, and 3 fluorescent signals appear, wherein the fluorescent signal of C is 208 individuals, the fluorescent signal of C is T is 314 individuals, and the fluorescent signal of T is 154 individuals. The phenotype investigation data are combined to find that the genotype is highly consistent with the color phenotype of the plant hypocotyl, and the coincidence rate reaches 100%. F (F) 2 The color type and genotype of the hypocotyl of some individuals in the population are shown in Table 4 below. The results fully show that the Hypocotyl-4 marker has universality and accuracy and can be applied to identification and screening of pepper plant seedling stage.
Table 4: f (F) 2 Hypocotyl color type and genotype of part of individual plants in population
Figure BDA0004014598700000082
/>
Figure BDA0004014598700000091
/>
Figure BDA0004014598700000101
/>
Figure BDA0004014598700000111
3. Fine localization of regulated green axis genes
Based on the result of 2, pair F 2 And (3) carrying out genotyping on the single plants of the population, determining the genotype of the exchange single plants, the phenotype of the combined plants and the genotype of the exchange single plants, and finally locking the target gene in the 161.2-162.8Mbp region of chromosome 2, wherein the result is shown in figure 2. The region was found to contain 11 non-synonymous mutant genes by comparison to the reference genome, of which only Ca2g13996 was involved in anthocyanin synthesis, further supposing that the gene was the strongest candidate gene.
4. Cloning and structural analysis of regulated green hypocotyl gene
PCR amplification is carried out on Ca2G13996 in wild type 'Zhangshagg' and mutant material 'Caya' by taking cDNA as a template, sanger sequencing is carried out on the obtained PCR product, and the sequencing result shows that a SNP mutation exists in the Ca2G13996 gene at a second exon, G is replaced by A, so that the coded amino acid is changed from arginine to lysine, and the mutation site is consistent with the analysis result of BSA-Seq. The gene Ca2g13996 contains 1149bp, contains 6 exons, encodes a speed limiting enzyme, dihydrofenavorol-4-reductase (DFR), which is critical in the anthocyanin synthesis pathway, and is therefore designated CaDFR.
Example 2
Application of molecular marker identification in breeding
The identification result shows that the material with green Hypocotyl at the pepper seedling stage can be bred by molecular marker identification and screening and retaining the material with the C fluorescent signal corresponding to the primer Hypocotyl-4Y. The Hypocotyl of the pepper in the seedling stage can be bred into purple homozygous materials by retaining the materials for detecting the A fluorescent signals corresponding to the primer Hypocotyl-4X. The hybrid material with purple hypocotyl at the seedling stage of the capsicum can be bred by retaining the material with the B fluorescence signal (comprising the fluorescence signals corresponding to the two primers) detected, and the result is shown in FIG. 3, which is F constructed by wild ('Zhangshaugang') and mutant (Caya) 2 Performing groups in a populationPartial results from typing, wherein a represents: the PCR product is a fluorescence signal corresponding to a forward primer Hypocotyl-4X, and is a homozygous single plant with purple Hypocotyl; and B represents: the PCR product has two fluorescence signals of primer Hypocotyl-2X and Hypocotyl-2Y, which are heterozygous single plants with purple Hypocotyl; and C represents: the CR product is a fluorescence signal corresponding to a forward primer Hypocotyl-2Y, and is a green homozygous single plant of the Hypocotyl. The workload of later screening and identification can be reduced through the screening of the early molecular markers, and the breeding process is accelerated.
Hybridizing the green hypocotyl chilli mutant plant with the chilli R2A nuclear male sterile line to obtain heterozygous F 1 Instead of F 1 Obtaining F by plant selfing 2 Generation of segregating populations. Because the green hypocotyl character is linked with the nuclear male sterility character, the nuclear sterility single plant can be screened out according to the color of the hypocotyl in the group seedling stage, and the accuracy rate is more than 85 percent. Therefore, the green hypocotyl character and the nuclear sterility character molecular markers are utilized to create the capsicum green hypocotyl nuclear sterile line through means of backcross transformation and the like, and the problem that 50% of fertile plants need to be pulled out from a field in the current capsicum nuclear sterile line seed production can be solved.
Example 3
Application of CaDFR gene in regulation and control of anthocyanin synthesis in capsicum
1. Construction of CaDFR Gene silencing vector
In order to identify the function of the CaDFR gene in regulating and controlling the synthesis of the capsocyanine, a target fragment of the CaDFR gene is cloned into a pTRV2 gene silencing vector to construct the silencing vector of the CaDFR gene. The constructed CaDFR gene silencing vector was transformed into competent Agrobacterium GV3101 (available from Shanghai Weidi BioCo., ltd.; cat# AC 1001) and silenced Capsicum Zhangshaugang' as follows:
and (3) carrier enzyme cutting: the pTRV2 vector was digested with SmaI restriction enzyme. The cleavage system is shown in Table 5, the cleavage reaction conditions are 25 ℃, the cleavage is performed for 3 hours, and the cleavage is performed for 20 minutes at 65 ℃.
Table 5: enzyme cutting system
Component (A) Volume of
Carrier body 1μg
Enzymes 1μl
Buffer 5μl
ddH 2 O To 50 μl
Total 50μl
(2) Vector ligation and transformation of E.coli: the digested vector was fused with CaDFR gene fragment using recombinase Exnase II (available from Nanjinozan Biotechnology Co., ltd., cat# C112-01) to construct an overexpression vector and transformed E.coli competent DH 5. Alpha. The connection system is shown in Table 6.
Table 6: carrier connection system
Component (A) Volume of
Cut carrier 2μl
Gel recovery fragments 3μl
5×CEIIBuffer 3μl
ExnaseⅡ 2μl
Total 10μl
(3) And (3) bacterial liquid PCR identification: after bacterial plaque was grown, the monoclonal cells were picked up and cultured in LB liquid medium containing kanamycin for 6-8 hours (180-200 rpm), and PCR was performed.
2. Recombinant vector transformation of Agrobacterium GV3101
(1) Plasmid extraction: sequencing the bacterial solution of the target band confirmed by PCR verification in the step 1, comparing with a vector primer design sequence, confirming no error, and extracting the plasmid to obtain a silencing vector (pTRV 2-CaDFR) containing the CaDFR gene. The specific steps were performed according to the Beijing full gold Biotechnology Co., ltd. Plasmid miniprep kit (cat. EM 111-01) description.
(2) Agrobacterium competent transformation: and (3) melting the agrobacterium competent GV3101 stored in a refrigerator at the temperature of minus 80 ℃ on ice, and converting the recombinant vector extracted in the step (1) into the agrobacterium competent GV3101, wherein the specific steps are carried out according to the description of the conversion of the agrobacterium competent of the Optimago. After bacterial plaque grows on the culture medium, selecting a monoclonal in 1ml of LB resistant culture medium, culturing for 12-16h (180-200 rpm) at 28 ℃ in a shaking way, performing bacterial liquid PCR verification, and preserving positive bacterial liquid with 60% glycerol for later use.
3. Agrobacterium injection of capsicum to obtain silent plant
(1) Bacterial liquid activation and induction culture medium preparation
The glycerol bacteria stored in the above (2) were activated in 1mL to LB resistant medium, and the activated bacteria were diluted 1:20 to LB induction medium (Kan50μg.mL-1, rif50μg.mL-1, 10mM MES, 20. Mu.MAS), and were shake-cultured at 28℃and 220rpm for 12-16 hours.
(2) Preparation of infection buffer
Centrifuging the cultured bacterial solution at 5000rpm for 10min to collect bacterial solution, discarding supernatant, adding appropriate amount of infection buffer (10 mM MES, 10mM MgCl) 2 Ph=5.6, and AS at a final concentration of 200 μm) was added to the suspension, and od600=1.0. Placing the prepared infection buffer solution at 28 ℃ for standing for about 4 hours, mixing pTRV1 and agrobacterium 1:1 containing pTRV2 vector, infecting pepper cotyledons by using a 2.5ml syringe, performing dark culture for 1 day after infection, and then performing normal seedling management.
4. Phenotypic observation of capsicum-silenced plants
And (3) performing phenotypic observation and photographing on the capsicum-silenced plants obtained in the step (3) after 3-4 weeks of greenhouse planting. As shown in fig. 4, compared to the uninjected 'zhangshaugang' plants, it was found that: hypocotyls, stems, internodes and anthers of pTRV2-CaDFR silenced plants were light in color.
5. qRT-PCR detection of CaDFR expression levels in silencing plants
(1) Extracting RNA of the silent plant and reversely transcribing the RNA into cDNA: the specific procedure for RNA extraction was performed as described in the Nanjinouzan Biotechnology Co., ltd. cDNA synthesis was performed according to the Takara reverse transcription kit instructions.
(2) qRT-PCR: the reaction system is shown in Table 7, and the reaction procedure is shown in Table 8.
qRT-PCR primers were as follows:
CaDFR-qPCR-F:GGAAGATTCATTTGCTCGTCTC(SEQ ID No.8)；
CaDFR-qPCR-R:CTATGGGCAAGTCCTTATCGAT(SEQ ID No.9)。
table 7: qRT-PCR reaction system
Component (A) Volume of
SYBRPremixExTaq 10μL
Forward primer 0.4μL
Reverse primer 0.4μL
cDNA template (dilution 10 times) 1μL
ddH 2 O To 20 mu L
Total 20μL
Table 8: qRT-PCR reaction procedure
Figure BDA0004014598700000141
The qRT-PCR identification result of CaDFR gene in the silent plant is shown in figure 5, and the relative expression amount of CaDFR gene in the silent plant is obviously reduced compared with that in the control plant.
6. Anthocyanin content determination of silent plants
Hypocotyls and anthers of pTRV2-CaDFR silent plants and control plants were collected at the seedling stage, and anthocyanin content measurement was performed on each tissue using an anthocyanin content measurement kit (cat# ZC-S0634) from Shanghai, biotechnology Co., ltd. The results are shown in figure 6, where the anthocyanin content in the hypocotyl and anther of the silenced plants was significantly reduced compared to the control plants.
The foregoing is a further detailed description of the invention in connection with the preferred embodiments, and it is not intended that the invention be limited to the specific embodiments described. It will be apparent to those skilled in the art that several simple deductions or substitutions may be made without departing from the spirit of the invention, and these should be considered to be within the scope of the invention.

Claims (10)

1. A molecular marker linked with green traits of hypocotyls of capsicum, which is characterized in that the molecular marker is a nucleotide sequence on a capsicum genome, comprises a base sequence located in a 161.2-162.8Mbp interval of chromosome 2, and is a mutation of G to A at a 161361466 position on chromosome 2.
2. The molecular marker linked to the green trait of the hypocotyl of capsicum according to claim 1, wherein the mutation of G to a in the molecular marker is present in the second exon region of the DFR gene.
3. The molecular marker linked to the green trait of capsicum hypocotyl according to claim 1, wherein the molecular marker is obtained by EMS mutagenesis of selected phenotypically stable green mutant materials of hypocotyl.
4. A capsicum CaDFR mutant gene, which is characterized in that the capsicum DFR mutant gene takes a DFR gene sequence of a genome No.2 chromosome of capsicum as a basic sequence, and comprises the following base mutations on the basic sequence: the mutation from G to A occurs at the base at position 120 in the second exon in the DFR gene.
5. A KASP typing primer for identifying, screening or applying the molecular marker of any one of claims 1 to 3 or the CaDFR mutant gene of claim 4, wherein the primer sequence of the KASP typing primer is:
forward primer 4X: GGGTAGCCACATGGAATACTCC;
forward primer 4Y: GGGTAGCCACATGGAATACTCC;
reverse primer 4C: AGCTGATACAAACTTAACGCTGTG.
6. The typing primer according to claim 5, wherein two forward primers are each ligated to a different fluorescent linker sequence, the fluorescent linker sequence selecting one of FAM, HEX, FITC, RED, TET, JOE, R.
7. The typing primer of claim 5, wherein the forward primer having a fluorescent linker sequence is as follows:
forward primer Hypocotyl-4X:
GAAGGTGACCAAGTTCATGCTGGGTAGCCACATGGAATACTCC；
forward primer Hypocotyl-4Y:
GAAGGTCGGAGTCAACGGATTGGGTAGCCACATGGAATACTCT。
8. use of a molecular marker according to any one of claims 1 to 3 or a capsicum CaDFR mutant gene according to claim 4 or a typing primer according to any one of claims 5 to 7 for the assisted screening, identification and breeding of pepper varieties with green color of hypocotyl of pepper seedlings.
9. The use according to claim 8, wherein the identification or screening is performed by PCR detection, and when the fluorescent signal corresponding to the primer Hypocotyl-4X is detected after the PCR is finished, the detection site is C: C genotype, and the Hypocotyl of the capsicum is judged to be a purple phenotype single plant; when a fluorescent signal corresponding to the primer Hypocotyl-4Y is detected, the detection site is T, the T genotype is determined as a Hypocotyl green phenotype single plant; if two fluorescent signals are detected simultaneously, the detection site is the T-C genotype, and the hypocotyl purple phenotype single plant is judged.
10. The use according to claim 8, wherein the detection is performed using a touchdown pcr, the touchdown pcr amplification procedure being: 94 ℃ for 15min;95 ℃ for 20s; 60s at 65-56 ℃ for 10 cycles, and the annealing extension temperature of each cycle is reduced by 0.8 ℃;94 ℃ for 20s;57 ℃ 60s,30 cycles.
CN202211665569.0A 2022-12-23 2022-12-23 Molecular marker linked with green traits of hypocotyl of capsicum, mutant gene, parting primer and application thereof Pending CN116083627A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202211665569.0A CN116083627A (en) 2022-12-23 2022-12-23 Molecular marker linked with green traits of hypocotyl of capsicum, mutant gene, parting primer and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202211665569.0A CN116083627A (en) 2022-12-23 2022-12-23 Molecular marker linked with green traits of hypocotyl of capsicum, mutant gene, parting primer and application thereof

Publications (1)

Publication Number Publication Date
CN116083627A true CN116083627A (en) 2023-05-09

Family

ID=86212944

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202211665569.0A Pending CN116083627A (en) 2022-12-23 2022-12-23 Molecular marker linked with green traits of hypocotyl of capsicum, mutant gene, parting primer and application thereof

Country Status (1)

Country Link
CN (1) CN116083627A (en)

Citations (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1329670A (en) * 1998-09-28 2002-01-02 耶鲁大学 Plants and plants cells encoding wild type COP1 gene and coil domain thereof
JP2011155860A (en) * 2010-01-29 2011-08-18 Miyazaki Prefecture Method for selecting individual of plant of genus capsicum having resistance to bacterial wilt disease, using dna marker
WO2014204815A1 (en) * 2013-06-21 2014-12-24 Seminis Vegetable Seeds, Inc. Selection of mature fruit color in pepper plants
KR20160069382A (en) * 2014-12-08 2016-06-16 순천대학교 산학협력단 Method for determining yellow color of vegetable fruit
WO2016125933A1 (en) * 2015-02-05 2016-08-11 순천대학교 산학협력단 Method for determining fruit color of fruit vegetables
CN108754013A (en) * 2018-06-24 2018-11-06 华中农业大学 A kind of and capsicum cytoplasmic male sterility restoring gene close linkage molecular labeling and its preparation method and application
CN109207622A (en) * 2018-10-24 2019-01-15 湖南省蔬菜研究所 A kind of molecular labeling and application with the stagnant green gene linkage of capsicum
CN109628635A (en) * 2019-02-21 2019-04-16 中国农业大学 A kind of exploitation and application of regulation capsicum Chinese olive purple gene label
CN110305978A (en) * 2018-03-27 2019-10-08 华中农业大学 SNP site and its versatility molecular labeling, acquisition methods and application of a kind of and pepper fruit towards tight association
KR102096226B1 (en) * 2019-01-23 2020-04-02 경북대학교 산학협력단 Molecular marker for selecting Peach-colored pepper and uses thereof
CN111394508A (en) * 2020-05-25 2020-07-10 湖南省蔬菜研究所 Molecular marker linked with capsicum frutescens gene and application thereof
CN111500761A (en) * 2020-05-23 2020-08-07 湖南省蔬菜研究所 Molecular marker linked with pepper leaf color yellowing gene and application thereof
WO2020254655A1 (en) * 2019-06-21 2020-12-24 Vilmorin & Cie Improvement of quality and permanence of green color of peppers at maturity and over-maturity
CN114350840A (en) * 2022-01-11 2022-04-15 湖北省农业科学院经济作物研究所 SNP (single nucleotide polymorphism) and specific CAPS (CAPS) primers closely related to purple stripes of Chinese olive of capsicum and application of primers

Patent Citations (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1329670A (en) * 1998-09-28 2002-01-02 耶鲁大学 Plants and plants cells encoding wild type COP1 gene and coil domain thereof
JP2011155860A (en) * 2010-01-29 2011-08-18 Miyazaki Prefecture Method for selecting individual of plant of genus capsicum having resistance to bacterial wilt disease, using dna marker
WO2014204815A1 (en) * 2013-06-21 2014-12-24 Seminis Vegetable Seeds, Inc. Selection of mature fruit color in pepper plants
KR20160069382A (en) * 2014-12-08 2016-06-16 순천대학교 산학협력단 Method for determining yellow color of vegetable fruit
WO2016125933A1 (en) * 2015-02-05 2016-08-11 순천대학교 산학협력단 Method for determining fruit color of fruit vegetables
CN110305978A (en) * 2018-03-27 2019-10-08 华中农业大学 SNP site and its versatility molecular labeling, acquisition methods and application of a kind of and pepper fruit towards tight association
CN108754013A (en) * 2018-06-24 2018-11-06 华中农业大学 A kind of and capsicum cytoplasmic male sterility restoring gene close linkage molecular labeling and its preparation method and application
CN109207622A (en) * 2018-10-24 2019-01-15 湖南省蔬菜研究所 A kind of molecular labeling and application with the stagnant green gene linkage of capsicum
KR102096226B1 (en) * 2019-01-23 2020-04-02 경북대학교 산학협력단 Molecular marker for selecting Peach-colored pepper and uses thereof
CN109628635A (en) * 2019-02-21 2019-04-16 中国农业大学 A kind of exploitation and application of regulation capsicum Chinese olive purple gene label
WO2020254655A1 (en) * 2019-06-21 2020-12-24 Vilmorin & Cie Improvement of quality and permanence of green color of peppers at maturity and over-maturity
CN111500761A (en) * 2020-05-23 2020-08-07 湖南省蔬菜研究所 Molecular marker linked with pepper leaf color yellowing gene and application thereof
CN111394508A (en) * 2020-05-25 2020-07-10 湖南省蔬菜研究所 Molecular marker linked with capsicum frutescens gene and application thereof
CN114350840A (en) * 2022-01-11 2022-04-15 湖北省农业科学院经济作物研究所 SNP (single nucleotide polymorphism) and specific CAPS (CAPS) primers closely related to purple stripes of Chinese olive of capsicum and application of primers

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
BOYAN TANG等: "Anthocyanin Accumulation and Transcriptional Regulation of Anthocyanin Biosynthesis in Purple Pepper", JOURNAL OF AGRICULTURAL AND FOOD CHEMISTRY, vol. 68, 31 December 2020 (2020-12-31), pages 12152 - 12163 *
CHEN R等: "Induced mutation in ELONGATED HYPOCOTYL5 abolishes anthocyanin accumulation in the hypocotyl of pepper", THEORETICAL AND APPLIED GENETICS, vol. 135, 31 August 2022 (2022-08-31), pages 3455 - 3468, XP037933072, DOI: 10.1007/s00122-022-04192-y *
JIN WANG等: "Fine mapping and identification of CaTTG1, a candidate gene that regulates the hypocotyl anthocyanin accumulation in Capsicum annuum L.", HORTICULTURAL PLANT JOURNAL, 22 November 2023 (2023-11-22), pages 1 - 23 *
ZHISHUO ZHANG等: "The bHLH1-DTX35/DFR module regulates pollen fertility by promoting flavonoid biosynthesis in Capsicum annuum L.", HORTICULTURE RESEARCH, vol. 9, 3 August 2022 (2022-08-03), pages 172 *
余文中;刘崇政;杨红;赖卫;詹永发;姜虹;: "观赏辣椒种质材料主要园艺性状差异性分析", 湖南农业科学, no. 19, 31 December 2010 (2010-12-31), pages 7 - 9 *
刘峰;谢玲玲;弭宝彬;欧阳娴;茆振川;邹学校;谢丙炎;: "辣椒转录组SNP挖掘及多态性分析", 园艺学报, no. 02, 28 February 2014 (2014-02-28), pages 343 - 348 *

Similar Documents

Publication Publication Date Title
CN108239647B (en) Gene and molecular marker for controlling rape plant type and application
WO2017092110A1 (en) Sesamum indicum inflorescence definite gene sidt1 and snp marker thereof
CN105695478B (en) Gene for regulating plant type and yield of plant and application thereof
CN114134247B (en) Molecular marker closely linked with millet plant height character, primer sequence and application thereof
CN111961746B (en) SNP molecular marker related to blight and disease resistance of cotton on land and application thereof
CN114427007A (en) KASP molecular marker related to bitter gourd whole female and application thereof
CN109609687B (en) KASP marker primer combination for detecting watermelon fusarium wilt resistance and application thereof
CN112195268B (en) Molecular marker, primer, application and variety breeding method closely linked with origin green peach aphid resistance character of cultivar
CN109111511B (en) Cultivation method of super-long rice
RU2717017C2 (en) Molecular markers for blackleg resistance gene rlm2 in brassica napus and methods of use thereof
WO2024077984A1 (en) Maize dwarfing-related molecular marker having semi-dominance and use thereof
EP1466973A1 (en) Characteristic base sequences occurring in plant genes and method of utilizing the same
CN115232823B (en) Cabbage mustard mushroom leaf development related gene and application thereof
CN113278723B (en) Composition for analyzing genetic diversity of Chinese cabbage genome segment or genetic diversity introduced in synthetic mustard and application
CN113564161B (en) Molecular marker closely linked with bacterial wilt resistance of cultivated peanut and application thereof
CN116083627A (en) Molecular marker linked with green traits of hypocotyl of capsicum, mutant gene, parting primer and application thereof
CN113943732A (en) SNP (Single nucleotide polymorphism) marker related to heat resistance of cucumber in adult stage, primer group, kit and application
JP3999254B2 (en) Genetic markers linked to loci involved in resistance to barley stripe dwarf disease and their utilization
CN114369674B (en) SNP marker linked with Indian pumpkin short vine gene CmDw-1, primer, kit and application thereof
JP2005229854A (en) Gene marker connected to gene locus controlling efflorescent or cleistogamic property and its utilization
CN114686613A (en) Molecular marker of hybrid rice high-yield and high-quality gene GW3p6 and application thereof
CN114763579A (en) Molecular marker related to melon fruit shape and method and application thereof
CN117737081A (en) Application of wheat spike related gene TaSP1 in breeding
JP2005229849A (en) Gene marker connected to gene locus participating on diapause and its utilization
CN117887885A (en) Soybean oil content-related major single nucleotide polymorphism site and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination