JP2005229854A - Gene marker connected to gene locus controlling efflorescent or cleistogamic property and its utilization - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a gene marker existing in the genome DNA of a gramineous plant such as barley and connected to a gene locus controlling an efflorescent or cleistogamic property, and to provide a method for utilizing the gene marker. <P>SOLUTION: The detailed chain map of barley was made, and a chain analysis was carried out. Thus, a group of gene markers connected to a gene locus controlling an efflorescent or cleistogamic property and boarded on barley 2H chromosome were found. <P>COPYRIGHT: (C)2005,JPO&NCIPI

Description

  The present invention relates to a novel genetic marker and a method for using the same, and more particularly to a genetic marker linked to a locus that controls open / close flowering properties in a grass family such as barley and the use thereof.

  The genes that control the opening and closing of the grasses are phenotypes that cause the buds to jump out of the spikes when flowering due to their alleles (phenotypes) (Flower closing property). For example, it is known that flowering barley is susceptible to infection with red mold fungus floating in the air. Therefore, it is preferable that the cultivated barley is flower-closing.

  Conventionally, for breeding crops, it is necessary to cross cultivated varieties or wild varieties with a target trait, actually cultivate many individuals, select individuals with the target trait, and genetically fix the target trait First of all, it required a vast field, a lot of human power, and considerable years. For example, when opening and closing flowers are the target trait, the individuals to be selected are identified by cultivating the selection target population and investigating whether each individual is flowering or closing at the time of flowering. I had to.

  Therefore, in recent years, breeding methods by selection using genetic markers as an index have been used to shorten the breeding period, reduce the labor force and the field area. In breeding with such a genetic marker, the presence or absence of a target character can be easily estimated based on the genotype of the marker, so that selection at the seedling stage is possible. Therefore, efficient breeding can be realized by using genetic markers. In order to achieve breeding using genetic markers, it is essential to develop genetic markers that are strongly linked to the target trait.

  By the way, the open / close floral property is a trait controlled by a single main gene. Linkage analysis is known as a method for estimating the locus of such a single active gene. Linkage analysis is a method of analyzing the position (locus) of a plurality of loci using genetic rules. If one of a plurality of loci is a gene locus that controls the target trait and the other is a genetic marker locus, It is possible to identify the gene locus that controls the target character from the data of the genetic marker locus.

  As genetic markers, DNA markers appeared in the late 1980s, and detailed linkage map creation using DNA markers has greatly advanced. As a result, linkage analysis has been performed on many organisms based on such high-density linkage maps.

  As described above, the development of genetic markers linked to the target trait is enabled by high-precision linkage analysis based on a detailed linkage map that can cover the entire chromosome. It can be said that simple breeding can be realized.

Examples of techniques related to the genetic marker include, for example, barley, 1) a genetic marker linked to a gene that confers aluminum resistance to barley and a technique related to its use (see Patent Document 1), and 2) a nucleic acid derived from a barley chromosome. The present inventors have proposed a novel primer set (see Patent Document 2) for detecting a marker in the background of wheat, a technique relating to its use, and the like.
JP 2002-291474 A (published on October 8, 2002) JP 2003-111593 A (published on April 15, 2003)

  As described above, in crops such as gramineous plants, in particular barley, wheat, rice, etc., having a flowering phenotype has an advantage that it is less susceptible to red mold disease. However, it was not possible to determine whether the flowering property was closed or not without observing the flowering state of the target plant individual. Therefore, it is very effective to use genetic markers for breeding plants with modified flowering properties. If a genetic marker linked to a locus that controls open / close flowering properties has been developed and made available, it will be possible to achieve significant efficiency in breeding the open / close flowering modified plant.

  The present invention has been made in view of the above problems, and its object is to provide a novel genetic marker linked to a locus that controls open / close flowering properties in gramineous plants, particularly barley, and a typical use thereof. It is to provide.

  In order to solve the above problems, the present inventors designed a primer set based on the barley EST sequence possessed by the inventors, and determined whether or not a genetic marker (DNA Marker) was developed. Furthermore, using a doubled haploid (hereinafter abbreviated as “DH”) population produced from a cross F1 of brewing barley “Haruna Nijo” and wild barley “H602”, the linkage between the above genetic markers is detected. Then, a linkage map of the DH line was prepared, and linkage analysis of the gene loci controlling the open / close flower property was performed based on the linkage map. As a result, a gene locus that controls open / close floweriness was detected on the 2H chromosome. The present inventors further analyzed and found a novel genetic marker linked to a gene locus involved in opening and closing flowering. That is, this invention is completed by the said novel knowledge, and includes the following inventions.

  That is, the genetic marker according to the present invention is a genetic marker that is present in the genomic DNA of a grass family and is linked to a locus that controls the flowering ability, and is 0 to 13 from the locus that controls the flowering ability. It is characterized by being located at a distance within the range of a centimorgan. Since the genetic marker is strongly linked to a locus that controls open / close flowering properties, there is a low probability that recombination will occur between the genetic marker and the locus that controls open / close flowering properties. Therefore, by using the genetic marker, for example, it is possible to obtain a DNA fragment containing a gene locus that controls open / close flowering property, and to produce (produce) / discriminate open / closed flowering property grasses.

  Furthermore, the genetic marker according to the present invention is characterized in that the Gramineae plant is a wheat. Therefore, by using the above genetic markers, obtaining DNA fragments containing loci that control the flowering ability of barley, wheat and other wheat, and producing (producing) and discriminating flowering modified wheat Is possible.

  Furthermore, the genetic marker according to the present invention is characterized in that the wheat is a barley. Therefore, by using the above genetic marker, it is possible to obtain a DNA fragment containing a locus that controls the flowering property of barley in barley, to produce (produce) or discriminate the barley-modified barley.

  Furthermore, the genetic marker according to the present invention is characterized in that the genomic DNA is a 2H chromosome. Therefore, by using the above genetic marker, it is possible to obtain a DNA fragment containing a gene locus that controls the flowering property that exists on the 2H chromosome of barley, and to produce (produce) and discriminate the flowering property modified barley. It becomes possible.

  Furthermore, the genetic marker according to the present invention is amplified using a first primer set which is a combination of a primer having the base sequence shown in SEQ ID NO: 1 and a primer having the base sequence shown in SEQ ID NO: 2. It is a feature. When an amplification reaction such as PCR is performed using the first primer set, the genetic marker can be easily amplified and detected, and the open / close flowering modified grass family can be easily identified.

  The genetic marker according to the present invention is amplified using a second primer set that is a combination of a primer having the base sequence shown in SEQ ID NO: 3 and a primer having the base sequence shown in SEQ ID NO: 4. It is a feature. When an amplification reaction such as PCR is performed using the second primer set, the genetic marker can be easily amplified and detected, and the open / close flowering modified grass family can be easily identified.

  The method for isolating a DNA fragment according to the present invention is characterized by isolating a DNA fragment containing a locus that controls open / close flowering properties using the genetic marker according to the present invention. The genetic marker according to the present invention is strongly linked to a locus that controls open / close flowering properties. If cloning is performed with the above genetic marker as a target, a DNA fragment containing the gene locus that controls opening / closing flowering properties can be easily isolated. Can be separated.

  The method for producing an open / close flowering modified gramineous plant according to the present invention includes a DNA fragment containing the gene locus that controls the open / close flowering property obtained by the above-described DNA fragment isolation method according to the present invention. It is characterized by being introduced into the genomic DNA. The gramineous plant is preferably wheat, and more preferably barley. By this production method, it becomes possible to produce an open / close flowering modified grass family plant. In addition, an open / close flowering modified grass family plant obtained by the production method is also included in the present invention.

  The method for selecting an open / close flowering modified gramineous plant according to the present invention is a method for selecting an open / close flowering modified gramineous plant using the genetic marker according to the present invention as an index. Since the genetic marker according to the present invention is strongly linked to the locus controlling the flower opening / closing property, the probability that recombination occurs between the genetic marker and the gene locus controlling the flower opening / closing property is very low. Therefore, by detecting the genetic marker, it is possible to easily determine the genotype of the locus that controls the open / close flower property in the test target plant, and it is possible to easily find an individual to be selected.

  Since the genetic marker according to the present invention is linked to a gene locus that controls open / close flowering properties, it is possible to breed rice plants with modified open / close flowering properties using the genetic marker as an index. Therefore, there is an effect that efficient breeding of the open / close flowering modified plant can be realized. More specifically, since the target individual can be selected at the seedling stage, it is not necessary to select the target individual after actually observing the flowering or closing properties of the plant individual, and the breeding period can be shortened. . In addition, the labor force and the field area can be reduced.

  Furthermore, flowering plants that are selectively bred using the genetic marker as an indicator have the effect of being less susceptible to red mold disease.

  An embodiment of the present invention will be described as follows. Note that the present invention is not limited to this.

  The present invention relates to a genetic marker linked to a locus that controls open / close flowering in grasses and an example of its use. Hereinafter, a genetic marker according to the present invention and an example of use of the present invention will be described.

(1) Genetic marker according to the present invention The genetic marker according to the present invention may be any genetic marker that is present in the genomic DNA of a grass family and is linked to a gene locus that controls open / close floral properties. As the gramineous plant, wheat is preferable, and barley is particularly preferable. The grass family plant is not particularly limited as long as it is a plant such as barley, wheat, and rice. The wheat refers to, for example, barley, wheat, rye, triticale, oat and the like.

  The open / close flower property can be judged by visually examining whether or not the buds jump out of the buds at the time of flowering. In other words, it can be determined as flowering if the buds jump out of the cocoon at the time of flowering, and can be determined as flower closing properties if the cocoon does not jump out of the cocoon at the time of flowering. For example, flowering barley is known to be susceptible to infection with red mold fungus floating in the air.

  Opening and closing floweriness is a trait governed by a single dominant gene and is inherited according to Mendel's law. There are two alleles of the gene locus that controls the opening and closing flowering properties: a gene that expresses flowering property and a gene that expresses flowering property, and the flowering property is dominant. As described above, it is preferable that the cultivar is flower-closing. For example, when trying to select useful traits from flowering wild varieties by cross breeding for flowering varieties, the target trait is on the chromosome on which the gene that controls opening and closing flowering properties sits. If so, it is possible that not only the desired trait but also a gene that controls open / close flowering properties will be introduced simultaneously. In such a case, efficient selection is possible by using a genetic marker linked to a gene locus that controls open / close flowering properties according to the present invention. Hereinafter, the genetic markers linked to the gene locus that controls the open / close flowering property developed by the present inventors in barley will be described in detail. The genetic markers according to the present invention are not limited to these.

  The present inventors created a high-density linkage map using a doubled haploid (DH) population produced from a cross F1 of brewing barley “Haruna Nijo” and wild barley “H602”. That is, barley genomic DNA was amplified using a primer set designed based on the barley EST (expressed sequence tag) sequence possessed by the present inventors, and the length of the amplified fragment was determined between “Haruna Nijo” and “H602”. Those having polymorphisms and those having polymorphisms that differ in the digestion pattern of the amplified fragment length by restriction enzymes were identified, and a linkage map comprising about 500 loci including these DNA markers was constructed. Based on this linkage map and the data on the phenotype of the open / close flower property of 93 individuals of the DH population observed by the present inventors, linkage analysis of the gene locus that controls the open / close flower property was performed. As a result, a gene locus that controls open / close floweriness was detected on the 2H chromosome. The genetic markers according to the present invention are the two genetic markers located closest to each other, with the gene locus that controls the open / close flower property sitting on the 2H chromosome. The inventors have named these genetic markers “k03899” and “k03044”.

k03899 is
Amplified using barley genomic DNA as a template using a first primer set which is a combination of a primer having the base sequence shown in TCCAACACCCATCCACTACGA (SEQ ID NO: 1) and a primer having the base sequence shown in ATGACCCGTCTCATACAAGA (SEQ ID NO: 2) It is a DNA marker that sits at a distance of about 4.9 cm Morgan (hereinafter referred to as cM) on the short arm side from the gene locus that controls the open / close flowering property detected on the 2H chromosome. The primer sequence is designed based on one of the barley EST sequences uniquely developed by the inventors (EST clone name: bah28p12, SEQ ID NO: 5). FIG. 1 shows the nucleotide sequence of the EST. The underlined portion is the primer sequence (SEQ ID NO: 1) and the complementary sequence of the primer sequence (SEQ ID NO: 2). There is SNP (single nucleotide polymorphisms) between the Haruna Nijo amplification product and the H602 amplification product. FIG. 2 shows the base sequence of the portion containing the SNP in the base sequences of both amplification products. The top is the base sequence of H602 (SEQ ID NO: 6), and the bottom is Haruna Nijo base sequence (SEQ ID NO: 7). The base surrounded by □ is SNP. The underlined portion indicates the recognition sequence (GTAC) of the restriction enzyme AfaI. As is clear from FIG. 2, the amplification product of H602 has a recognition sequence (GTAC) of the restriction enzyme AfaI, so that it is cleaved by AfaI. Since it is mutated (GTAA), it is not cleaved by the restriction enzyme AfaI. That is, this genetic marker k03899 is a CAPS (cleaved amplified polymorphic sequence) marker, and exhibits the opening and closing flower property that the subject individual sits on the 2H chromosome by amplification with the first primer set and cleavage of the amplification product AfaI. It can be discriminated whether the alleles at the dominant loci have a Haruna Nijo type genotype or an H602 type genotype.

k03044 is
Amplified using barley genomic DNA as a template using a second primer set which is a combination of a primer having the base sequence shown in GATGGGAGCACACCAGCTAT (SEQ ID NO: 3) and a primer having the base sequence shown in TGCATTTCGCAGTGAGGATG (SEQ ID NO: 4) This genetic marker is located at a distance of about 7.1 cM on the long arm side from the locus that controls the open / close flowering property detected on the 2H chromosome. The primer sequence is designed based on one of the barley EST sequences uniquely developed by the inventors (EST clone name: bags35a12, SEQ ID NO: 8). FIG. 3 shows the nucleotide sequence of the EST. The underlined portion is the primer sequence (SEQ ID NO: 3) and the complementary sequence of the primer sequence (SEQ ID NO: 4). There is a SNP between the Haruna Nijo amplification product and the H602 amplification product. FIG. 4 shows the base sequence of the portion containing the above SNP in the base sequences of both amplification products. The top is the base sequence of H602 (SEQ ID NO: 9), and the bottom is Haruna Nijo base sequence (SEQ ID NO: 10). The base surrounded by □ is SNP. The underlined portion indicates the recognition sequence (CCGG) of the restriction enzyme HapII. As is clear from FIG. 4, the Haruna Nijo amplification product has the recognition sequence (CCGG) of the restriction enzyme HapII, so that it is cleaved by HapII. Since it is mutated (CCAG), it is not cleaved by the restriction enzyme HapII. That is, the present genetic marker k03044 is a CAPS marker, and is an allele of a locus that controls the open / close flowering property of the subject individual on the 2H chromosome by amplification with the second primer set and restriction enzyme HapII cleavage of the amplification product. It can be determined whether a gene has a Haruna Nijo type genotype or an H602 type genotype.

  Here, 1 centmorgan (1 cM) is a unit representing the distance between two loci when crossover occurs at a frequency of 1% between the two loci.

  By the way, genomic DNA used as a template in amplification can be extracted from a plant body by a conventionally known method. Specifically, a general method for extracting genomic DNA from a plant body (see, for example, Murray, M.G. and W.F.Thompson (1980) Nucleic Acids Res. 8: 4321-4325.) Is a suitable example. The genomic DNA can be extracted using any tissue that constitutes a barley plant such as roots, stems, leaves, and reproductive organs. In some cases, it may be extracted from barley callus. The reproductive organs include flower organs (including male and female reproductive organs) and seeds. Extraction of genomic DNA is performed, for example, using the leaves of the barley seedling stage. This is because the tissue is relatively easy to grind, the mixing ratio of impurities such as polysaccharides is relatively small, and can be grown from seeds in a short period of time. Furthermore, it is possible to select individuals at the seedling stage, and the breeding period can be greatly shortened.

  A conventionally known DNA amplification method can be employed as a method for amplification using barley genomic DNA as a template and the combination of the above primers. In general, a PCR method (polymerase chain reaction method) or a modified method thereof is used. The reaction conditions when using the PCR method or its modification method are not particularly limited, and amplification can be performed under the same conditions as usual.

(2) Use of the present invention [Method for isolating a DNA fragment containing a gene locus that controls opening and closing flower properties]
As described above, the genetic markers (k03899, k03044) according to the present invention are linked to a locus controlling the open / close flower property detected on the barley 2H chromosome. Therefore, by using the genetic markers k03899 and k03044, it is possible to isolate a DNA fragment containing a locus that controls the open / close flowering property detected on the barley 2H chromosome.

  The isolation means that the target DNA fragment, that is, the DNA fragment containing the locus that controls the open / close flowering property is cloned, but in a broad sense by backcrossing from the cross F1 population, Isolation includes selection of individuals having a DNA fragment containing a locus that controls the open / close flowering property of one of the parents, and introducing only the locus region into the target variety.

  The method for isolating a DNA fragment containing a gene locus that controls open / close flowering properties using the genetic marker according to the present invention is not particularly limited, and examples thereof include the following methods.

  In barley, two types of BAC libraries of genomic DNA have been created, including “Haruna Nijo”, which is being developed by the present inventors, and a plurality of BAC libraries are currently under development. Therefore, using such a BAC library, according to a conventionally known map-based cloning technique, a BAC comprising the marker at a locus that controls open / close flowering and the genetic marker of the present invention linked to the locus By identifying the clone, creating a BAC contig from it and determining the base sequence, it is possible to finally reach the gene locus involved in opening and closing flowering.

  In addition, as described above, one parent is backcrossed to the hybrid F1 to introduce a DNA fragment containing a gene locus that controls the flowering property of the other parent into the target variety (in a broad sense). can do.

  In addition, when isolating a DNA fragment containing a gene locus that governs flowering ability, including the above method, a genetic marker that sits as close as possible to the gene locus that governs the target flowering ability It is preferable to select and use. This is because the probability of recombination between the gene locus that controls the desired flower opening and closing and the genetic marker is lower, and the fragment containing the locus that controls the flower opening and closing can be isolated more reliably. .

[Method for producing open / close flower property modified plant, and open / close flower property modified plant obtained by the production method]
By introducing into the genomic DNA of the grass family plant a DNA fragment containing a gene locus that controls open / close flower property obtained by the method for isolating a DNA fragment containing a gene locus that controls open / close flower property according to the present invention, It is possible to produce an open / close flowering modified grass family plant. As the gramineous plant, wheat is preferable, and barley is particularly preferable. In addition, for example, it is also possible to introduce a DNA fragment containing a locus that controls open / close flowering properties isolated from barley into grasses other than barley, and is limited to isolation and introduction only between the same genera It is not done.

  The method for introducing the DNA fragment is not particularly limited, and a known method can be appropriately selected and used. More specifically, for example, it may be produced by introducing it into the genomic DNA of a gramineous plant using, for example, Agrobacterium or particle gun, whereby an open / close flowering modified variety is obtained. For example, the journal The Plant Journal (1997) 11 (6), 1369-1376 discloses a method for transforming barley using Agrobacterium tumefaciens by Sonia Tingay et al. Can produce barley.

  In addition, a DNA fragment containing a gene locus that controls the flower-opening / closing property by crossing between a plant individual having a DNA fragment containing the locus that controls the target flower-opening / flowering property and a plant individual into which the DNA fragment is to be introduced Can also be introduced into plants. In this method, as long as crossing is possible, it is possible to introduce a DNA fragment containing a locus that controls the open / close flower property of plants of other species or genera.

  The open / close flowering modified plant according to the present invention is obtained by the production method according to the present invention. The open / close flowering modified plant is a flowering plant when a DNA fragment containing an allele representing a flowering phenotype is introduced into the flowering plant. On the other hand, when a DNA fragment containing an allele representing a flowering phenotype is introduced into a flowering plant, an opening and closing flowering plant is obtained. Since flowering varieties are susceptible to infection with red mold fungus floating in the air, it is preferable to be flower-closing in breeding excellent varieties. Therefore, by introducing a DNA fragment containing an allele representing a flowering phenotype into a flowering plant, it becomes possible to obtain a plant resistant to red mold.

[Selection Method for Opening and Closing Flowering Modified Gramineae Plants]
The method for selecting an open / close flowering modified gramineous plant according to the present invention may be any method as long as it is a method for selecting an open / close flowering modified gramineous plant using the genetic marker according to the present invention as an index, and other steps, conditions, materials, etc. Is not particularly limited. For example, a conventionally known crop breeding method can be used.

  More specifically, for example, a method of extracting a plant genomic DNA produced by crossing or the like and selecting a plant using the genotype of the genetic marker according to the present invention as an index can be mentioned. As a means for detecting a genetic marker, for example, for a DNA fragment amplified using genomic DNA extracted from a target plant as a template and using either the first or second primer set, a fragment length or a fragment restriction enzyme The observation of digestion patterns can be mentioned.

  The present invention is not limited to the above-described embodiments, and various modifications can be made within the scope of the claims, and the embodiments can be obtained by appropriately combining technical means disclosed in different embodiments. The form is also included in the technical scope of the present invention.

[Used plant]
H1 haploid obtained by cultivating F1 pollen obtained from crossing brewing barley "Hardeum vulgare ssp. Vulgare variety Harunanijo" and wild barley "H602" (Hordeum vulgare ssp. Spontaneum H602) A population (DH population) consisting of 93 doubled haploid 93 individuals that had been bred and naturally doubled was used.

[Create a chain map]
About 120,000 barley EST sequences possessed by the present inventors were base-called again with phred, then trimmed with a quality score of 20, and vector masking was performed to obtain about 60,000 sequences at the 3 ′ end. Unigene consisting of contig 8,753 and singlet 6,686 was prepared from these sequences by phrap. About 11,000 primer sets for amplifying a 150-500 bp cDNA sequence centered on 400 bp were created by the primer creation software Primer3. Among these, about 5,100 primer sets, in order to detect the presence or absence of polymorphism of genomic fragments amplified between Haruna Nijo and H602, each genomic DNA was amplified by PCR and the presence or absence of a band was detected by agarose gel electrophoresis. The number of bands and the band size were investigated, and those that could serve as markers were selected. In addition, when there is no polymorphism in the band size, the nucleotide sequence difference is detected by direct sequencing of the amplified fragment, and markers that can be converted into CAPS (cleaved amplified polymorphic sequence) for 39 types of restriction enzymes are markers. Selected as.

  As described above, a linkage map composed of markers of a total of 499 loci was constructed for the DH population derived from the hybrid F1 of Haruna Nijo and H602. This linkage map has an average marker density of 3.0 cM / locus and a total length of 1,470 cM.

[Determination of genotype]
The genotype of each individual in the DH population was determined using the markers mapped to the linkage map of the DH population. That is, PCR was performed using a primer set designed based on the EST sequence using DNA isolated from fresh leaf tissue of each individual as a template. For the fragment length polymorphism marker, the genotype was determined by electrophoresis of PCR products. For the CAPS (cleaved amplified polymorphic sequence) marker, the PCR product was digested with a restriction enzyme and the genotype was determined by electrophoresis.

[Observation of opening and closing flowers]
Each individual in the DH population was investigated and recorded as flowering or closing at the time of flowering.

[Chain analysis]
Linkage analysis examines the frequency of recombination between the open / close flower phenotype and the genotype of the marker on the linkage map, identifies the marker with the least recombination frequency, and locates the locus that controls open / close flowering Estimated.

〔result〕
The results are shown in Table 1. As is clear from Table 1, the locus that controls open / close floweriness was detected on the 2H chromosome at a position between genetic markers k03899 and k03044. It was estimated that the locus controlling the open / close floral nature sits at a position of 4.9 cM on the long arm side from genetic marker k03899 and 7.1 cM on the short arm side from genetic marker k03044.

  The genetic marker according to the present invention can be used for breeding of an open / close flower property modified plant, isolation of a gene that controls the open / close flower property, etc., and is expected to greatly contribute to the efficiency of breeding. Therefore, it can be widely used for agriculture in general and is also effective in the food industry using barley and the like as a raw material. It can also be used for basic research in the biological field, particularly plant genome research.

It is a figure which shows the position of the primer sequence designed based on the base sequence of barley EST clone: bah28p12, and the said sequence. It is a figure which shows the base sequence around SNP and SNP between H602 and Haruna Nijo in genetic marker k03899. It is a figure which shows the position of the base sequence of barley EST clone: bags35a12, and the primer sequence designed based on the said sequence | arrangement. It is a figure which shows the base sequence around SNP and SNP between H602 and Haruna Nijo in genetic marker k03044.

Claims (12)

A genetic marker that is present in the genomic DNA of a grass family and is linked to a locus that controls open and close flowering properties,
A genetic marker, wherein the genetic marker is located at a distance within a range of 0 to 13 centimorgans from the gene locus that controls the opening and closing flower properties.   The genetic marker according to claim 1, wherein the gramineous plant is wheat.   The genetic marker according to claim 2, wherein the wheat is barley.   The genetic marker according to claim 3, wherein the genomic DNA is 2H chromosome.   5. The amplification according to claim 1, wherein the amplification is performed using a first primer set which is a combination of a primer having the base sequence shown in SEQ ID NO: 1 and a primer having the base sequence shown in SEQ ID NO: 2. The genetic marker according to any one of claims.   5. The amplification according to claim 1, wherein the amplification is performed using a second primer set which is a combination of a primer having the base sequence shown in SEQ ID NO: 3 and a primer having the base sequence shown in SEQ ID NO: 4. The genetic marker according to any one of claims.   A method for isolating a DNA fragment, comprising isolating a DNA fragment comprising a locus that controls open / close flowering properties using the genetic marker according to any one of claims 1 to 6.   A DNA fragment containing the gene locus controlling the open / close flower property obtained by the isolation method according to claim 7 is introduced into the genomic DNA of the grass family plant. Production method.   The method for producing an open / close flowering modified grass plant according to claim 8, wherein the grass plant is a wheat.   The method for producing an open / close-flowering modified gramineous plant according to claim 9, wherein the wheat is a barley.   An open / close flowering modified gramineous plant obtained by the production method of an open / close flowering modified gramineous plant according to any one of claims 8 to 10.   A method for selecting an open / close flowering modified grass plant using the genetic marker according to claim 1 as an index.

Images