JP2005229845A - Gene marker connected to gene locus participating on length of glumes and its utilization - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a gene marker existing in the genome DNA of a gramineous plant such as barley and connected to a gene locus participating on the length of glumes, and to provide a method for utilizing the gene marker. <P>SOLUTION: The detailed chain map of barley was made, and a QTL analysis was carried out. Thus, two groups of gene markers connected to gene loci participating on the lengths of glumes, respectively, and boarded on barley 5H chromosome, and a group of gene markers connected to a gene locus participating on the length of glumes and boarded on barley 7H chromosome were found. <P>COPYRIGHT: (C)2005,JPO&NCIPI

Description

  The present invention relates to a novel genetic marker and a method for using the same, and more particularly, to a genetic marker linked to a genetic locus involved in gall in a grass family such as barley and the use thereof.

  It is known that the length of the gull attached to the side of the floret of the gramineous plant differs depending on the species and variety. The longer the protection, the higher the humidity on the surface of the ears due to raindrops and dew, etc., leading to the propagation of pathogenic bacteria and the occurrence of germination. In addition, it is possible to discriminate between species and varieties by observing guardian chiefs, and mixing varieties of different varieties can be easily identified by breeding varieties having guardian lengths different from other varieties.

  Conventionally, for breeding crops, it is necessary to cross cultivated varieties or wild varieties with a target trait, actually cultivate many individuals, select individuals with the target trait, and genetically fix the target trait First of all, it required a vast field, a lot of human power, and considerable years. For example, in the case where the chief guardian was the target trait, it was necessary to identify the individuals to be selected by cultivating the selection target population and actually measuring the chief guard after each individual headed . Further, if the target trait is a trait that is easily affected by the cultivation environment factor, it is difficult to determine whether or not the target trait expressed by the selected individual is a gene phenotype.

  Therefore, in recent years, breeding methods by selection using genetic markers as indices have been used in order to shorten the breeding period, reduce labor and field area, and reliably select useful genes. In breeding with such a genetic marker, selection can be made at the seedling stage depending on the genotype of the marker, and the presence or absence of the target trait can be easily confirmed. Therefore, efficient breeding can be realized by using genetic markers. In order to achieve breeding using genetic markers, it is essential to develop genetic markers that are strongly linked to the target trait.

  By the way, many of the traits important in agriculture are many that show continuous mutations in hybrid progeny. Such traits are called quantitative traits because they are measured on a quantitative scale such as time and length. It is known that the armor guard is also one of quantitative traits. In general, quantitative traits are often determined by the action of multiple genes, rather than a single dominant gene-dominated trait. Many traits that are targeted for improvement in crop breeding, such as yield, quality, and taste, are often quantitative traits.

  A genetic position occupied by such a gene that governs quantitative traits on a chromosome is referred to as QTL (Quantitative Trait Loci). As a method of estimating QTL, QTL analysis using a genetic marker existing in the vicinity of QTL is used. With the advent of DNA markers in the late 1980s, detailed linkage map creation using DNA markers has greatly progressed, and QTL analysis has been performed on many organisms based on the maps.

  As described above, the development of genetic markers linked to the target trait is enabled by high-accuracy QTL analysis based on a detailed linkage map that can cover the entire chromosome, and by using the obtained genetic markers, it is efficient. It can be said that simple breeding can be realized.

Examples of techniques related to the genetic marker include, for example, barley, 1) a genetic marker linked to a gene that confers aluminum resistance to barley and a technique related to its use (see Patent Document 1), and 2) a nucleic acid derived from a barley chromosome. The present inventors have proposed a novel primer set (see Patent Document 2) for detecting a marker in the background of wheat, a technique relating to its use, and the like.
JP 2002-291474 A (published on October 8, 2002) JP 2003-111593 A (published on April 15, 2003)

  As described above, the gall of a gramineous plant increases the humidity of the surface of the ear due to raindrops, dew, etc., and this causes the germs to propagate and germination of the ear. In addition, since it can be used for distinguishing between species and varieties, the modification of the guard is one of the important breeding goals. However, since a guardian is a trait that is easily affected by cultivation environment factors and often involves multiple loci, the selection method for actually surveying the guardian is a gene (gene) It is difficult to confirm whether or not the seat has been selected. Therefore, it is very effective to use genetic markers for breeding plants with modified armor. If a genetic marker linked to a locus related to the long guard is developed and made available, it will be possible to achieve significant efficiency in breeding the long head modified plant.

  The present invention has been made in view of the above-mentioned problems, and its purpose is to provide a novel genetic marker linked to a locus involved in a gall in gramineous plants, particularly barley, and a typical use thereof. It is to provide.

  In order to solve the above problems, the present inventors designed a primer set based on the barley EST sequence possessed by the inventors, and determined whether or not a genetic marker (DNA Marker) was developed. Furthermore, using a doubled haploid (hereinafter abbreviated as “DH”) population produced from a cross F1 of brewing barley “Haruna Nijo” and wild barley “H602”, the linkage between the above genetic markers is detected. And the linkage map of the said DH system | strain was created, and the QTL analysis of the gene locus which concerns on a guardian chief was performed based on this linkage map. As a result, two loci associated with the guardian were detected on the 5H chromosome and one on the 7H chromosome. The present inventors further analyzed and found novel genetic markers linked to the loci involved in these guardians. That is, this invention is completed by the said novel knowledge, and includes the following inventions.

  That is, the genetic marker according to the present invention is a genetic marker that is present in the genomic DNA of a grass family and is linked to a locus related to the armor length, and is 0 to 11 from the locus related to the armor length. It is characterized by being located at a distance within the range of a centimorgan. Since the genetic marker is strongly linked to the locus related to the guardian, the probability that recombination occurs between the genetic marker and the locus related to the guardian is low. Therefore, by using the genetic marker, for example, it is possible to obtain a DNA fragment containing a gene locus involved in the guard armor, to produce (produce) or discriminate a guardian arm-modified grass family.

  Furthermore, the genetic marker according to the present invention is characterized in that the Gramineae plant is a wheat. Therefore, by using the above genetic markers, the acquisition of DNA fragments containing the locus related to the armor length in barley, wheat, etc., production (production), discrimination, etc. of the armor length modified wheat Is possible.

  Furthermore, the genetic marker according to the present invention is characterized in that the wheat is a barley. Therefore, by using the above genetic marker, it is possible to obtain a DNA fragment containing a gene locus involved in the armor length in barley, to produce (produce) or discriminate the armor length modified barley.

  Furthermore, the genetic marker according to the present invention is characterized in that the genomic DNA is a 5H chromosome. Therefore, by using the above genetic marker, it is possible to obtain a DNA fragment containing a locus related to the armor length existing on the 5H chromosome of barley, to produce (produce) or discriminate the armor length modified barley. It becomes possible.

  Furthermore, the genetic marker according to the present invention is amplified using a first primer set which is a combination of a primer having the base sequence shown in SEQ ID NO: 1 and a primer having the base sequence shown in SEQ ID NO: 2. It is a feature. When an amplification reaction such as PCR is carried out using the first primer set, the genetic marker can be easily amplified and detected, and the gill length-modified grass family can be easily identified.

  The genetic marker according to the present invention is amplified using a second primer set that is a combination of a primer having the base sequence shown in SEQ ID NO: 3 and a primer having the base sequence shown in SEQ ID NO: 4. It is a feature. When an amplification reaction such as PCR is carried out using the second primer set, the genetic marker can be easily amplified and detected, and the gill length-modified grass family can be easily identified.

  The genetic marker according to the present invention is amplified using a third primer set that is a combination of a primer having the base sequence shown in SEQ ID NO: 5 and a primer having the base sequence shown in SEQ ID NO: 6. It is a feature. When an amplification reaction such as PCR is carried out using the third primer set, the genetic marker can be easily amplified and detected, and the gill length-modified grass family can be easily identified.

  The genetic marker according to the present invention is amplified using a fourth primer set which is a combination of a primer having the base sequence shown in SEQ ID NO: 7 and a primer having the base sequence shown in SEQ ID NO: 8. It is a feature. When an amplification reaction such as PCR is performed using the fourth primer set, it is possible to easily amplify and detect the genetic marker, and it is possible to easily discriminate the gull length modified gramineous plant.

  The genetic marker according to the present invention is characterized in that the genomic DNA is a 7H chromosome. Therefore, by using the above genetic marker, it is possible to obtain a DNA fragment containing a locus related to the armor length existing on the 7H chromosome of barley, to produce (produce) or discriminate the armor length modified barley. It becomes possible.

  Furthermore, the genetic marker according to the present invention is amplified using a fifth primer set which is a combination of a primer having the base sequence shown in SEQ ID NO: 9 and a primer having the base sequence shown in SEQ ID NO: 10. It is a feature. When an amplification reaction such as PCR is performed using the fifth primer set, the genetic marker can be easily amplified and detected, and the gills-modified plant can be easily identified.

  The genetic marker according to the present invention is amplified using a sixth primer set that is a combination of a primer having the base sequence shown in SEQ ID NO: 11 and a primer having the base sequence shown in SEQ ID NO: 12. It is a feature. When an amplification reaction such as PCR is performed using the sixth primer set, it is possible to easily amplify and detect the genetic marker, and to easily discriminate the gull length modified gramineous plant.

  On the other hand, the method for isolating a DNA fragment according to the present invention is characterized by isolating a DNA fragment containing a gene locus involved in guardian length using the genetic marker according to the present invention. The genetic marker according to the present invention is strongly linked to a locus related to the guardian. If cloning is performed with the above genetic marker as a target, a DNA fragment containing the locus related to the guardian can be easily isolated. Can be separated.

  In addition, the method for producing a gull length modified gramineous plant according to the present invention includes a DNA fragment containing the gene locus involved in the gall length obtained by the method for isolating a DNA fragment according to the present invention, It is characterized by being introduced into the genomic DNA. The gramineous plant is preferably wheat, and more preferably barley. By this production method, it is possible to produce a gull length modified gramineous plant.

  Moreover, the gill length modified grass plant according to the present invention is obtained by the method for producing a gall length modified grass family according to the present invention. According to the girder length modified gramineous plant, it becomes possible to easily identify the variety.

  Moreover, the method for selecting a gill length modified gramineous plant according to the present invention is a method for selecting a gill length modified gynecological plant using the genetic marker according to the present invention as an index. Since the genetic marker according to the present invention is strongly linked to the locus related to the guardian, the probability that recombination occurs between the genetic marker and the locus related to the guardian is very low. Therefore, by detecting the genetic marker, it is possible to easily determine the genotype of the locus involved in the protective arm in the plant to be tested, and to easily find the individual to be selected.

  Since the genetic marker according to the present invention is linked to the locus related to the guardian chief, it is possible to breed a grass family plant with a modified chief guardian using the genetic marker as an index. Therefore, there is an effect that an efficient breeding of the gill length modified plant can be realized. More specifically, since the target individual can be selected at the seedling stage, it is not necessary to select the target individual after actually observing the protective length of the plant individual, and the breeding period can be shortened. In addition, since a plurality of gene loci can be selected at the same time, the target genotype can be surely obtained rather than selecting by observation. In addition, the labor force and the field area can be reduced.

  Moreover, if selective breeding is performed using the genetic marker according to the present invention as an index, the influence on the phenotype by the cultivation environment factor can be eliminated. Therefore, there is an effect that reliable selection of useful genes (locus) can be achieved.

  Furthermore, the planted gill plant that has been selectively bred using the above genetic marker as an index can suppress the germination of pathogenic bacteria and the occurrence of ear germination, and can easily identify species and varieties. There is an effect that can be eliminated.

  An embodiment of the present invention will be described as follows. Note that the present invention is not limited to this.

  The present invention relates to a genetic marker linked to a genetic locus involved in gills in grasses and an example of its use. Hereinafter, a genetic marker according to the present invention and an example of use of the present invention will be described.

(1) Genetic marker according to the present invention The genetic marker according to the present invention may be any genetic marker as long as it is present in the genomic DNA of a gramineous plant and is linked to a genetic locus involved in the armor. As the gramineous plant, wheat is preferable, and barley is particularly preferable. The grass family plant is not particularly limited as long as it is a plant such as barley, wheat, and rice. The wheat refers to, for example, barley, wheat, rye, triticale, oat and the like.

  The guard length means the length of the guard attached to the side of the floret and records the actual measured length. In the grass family, the longer the guard, the higher the humidity on the surface of the ears due to raindrops and dew, etc., which causes the germination of pathogenic bacteria and the occurrence of ear germination. It is also known that the length varies depending on the species and variety. Therefore, it is possible to impart resistance to obstacles by cultivating varieties with a short protective arm, and it is easy to mix different varieties by cultivating varieties having a protective arm length different from other varieties. Can be identified. Therefore, the modification of the chief guard is one of the important breeding goals.

  A guardian chief is a quantitative trait that is determined by multiple loci. With respect to quantitative traits, the position of the gene locus involved in the quantitative trait on the chromosome can be estimated by QTL analysis. Hereinafter, the genetic marker linked to the gene locus related to the guard chief developed in the barley by the present inventors will be described in detail. The genetic markers according to the present invention are not limited to these.

  The present inventors created a high-density linkage map using a doubled haploid (DH) population produced from a cross F1 of brewing barley “Haruna Nijo” and wild barley “H602”. That is, barley genomic DNA was amplified using a primer set designed based on the barley EST (expressed sequence tag) sequence possessed by the present inventors, and the length of the amplified fragment was determined between “Haruna Nijo” and “H602”. Those having polymorphisms and those having polymorphisms that differ in the digestion pattern of the amplified fragment length by restriction enzymes were identified, and a linkage map comprising about 500 loci including these DNA markers was constructed. Based on this linkage map and the data of the armor length for the 93 individuals of the DH population measured by the present inventors, QTL analysis of the gene locus involved in the armor length was performed. As a result, two loci associated with the guardian were detected on the 5H chromosome and one on the 7H chromosome. The genetic marker according to the present invention sandwiches a gene locus involved in one of the two guards located on the 5H chromosome, the two genetic markers located closest to each other, The two genetic markers located closest to each other, with the two genetic markers located closest to the other gene locus associated with the other armor guard, and the gene locus associated with the armor guard sitting on the 7H chromosome. It is a marker. The inventors have identified genetic markers linked to a locus associated with one of the guardian lengths detected on the 5H chromosome as “k00029” and “k02989”, and genetic markers linked to the locus associated with the other guardian length. Were designated as “k05217” and “k00839”, and genetic markers linked to the loci involved in the guard arm detected on the 7H chromosome were designated as “k00610” and “k02212”.

k00029 is
Amplified using barley genomic DNA as a template using a first primer set that is a combination of a primer having the base sequence shown in CATTTTGCTGAGGCAGTGAA (SEQ ID NO: 1) and a primer having the base sequence shown in GGTGCTTCGAGAAGAAGGTG (SEQ ID NO: 2) It is a DNA marker that sits at a distance of about 0 centmorgan (hereinafter referred to as cM) on the short arm side from the locus related to the armor length detected on the 5H chromosome. The primer sequence is designed based on one of the barley EST sequences independently developed by the inventors (EST clone name: baak12d06, SEQ ID NO: 23). FIG. 1 shows the nucleotide sequence of the EST. The underlined portion is the primer sequence (SEQ ID NO: 1) and the complementary sequence of the primer sequence (SEQ ID NO: 2). There is SNP (single nucleotide polymorphisms) between the Haruna Nijo amplification product and the H602 amplification product. FIG. 2 shows the base sequence of the portion containing the SNP in the base sequences of both amplification products. The top is the base sequence of H602 (SEQ ID NO: 13), and the bottom is Haruna Nijo's base sequence (SEQ ID NO: 14). The base surrounded by □ is SNP. The underlined portion indicates the recognition sequence (GCGC) of the restriction enzyme HhaI. As is apparent from FIG. 2, the Haruna Nijo amplification product has a recognition sequence (GCGC) of the restriction enzyme HhaI and is cleaved with HhaI. Since it is mutated (ACGC), it is not cleaved by the restriction enzyme HhaI. That is, the present genetic marker k0209 is a CAPS (cleaved amplified polymorphic sequence) marker, and the target individual sits on the 5H chromosome by amplification with the first primer set and restriction enzyme HhaI cleavage of the amplified product. It is possible to discriminate whether the alleles at the gene locus involved in have a Haruna Nijo type genotype or an H602 type genotype.

k02989 is
Amplified using barley genomic DNA as a template using a second primer set which is a combination of a primer having the base sequence shown by ATCCGTTGCAAGACAAGAC (SEQ ID NO: 3) and a primer having the base sequence shown by GTGCCTACCACGCTCATCAT (SEQ ID NO: 4) It is a genetic marker that sits at a distance of about 6.9 cM on the long arm side from the locus related to the armor length detected on the 5H chromosome. The primer sequence is designed based on one of the barley EST sequences uniquely developed by the inventors (EST clone name: bags33j12, SEQ ID NO: 24). FIG. 3 shows the nucleotide sequence of the EST. The underlined portion is the primer sequence (SEQ ID NO: 3) and the complementary sequence of the primer sequence (SEQ ID NO: 4). There is a SNP between the Haruna Nijo amplification product and the H602 amplification product. FIG. 4 shows the base sequence of the portion containing the above SNP in the base sequences of both amplification products. The top is the base sequence of H602 (SEQ ID NO: 15), and the bottom is Haruna Nijo base sequence (SEQ ID NO: 16). The base surrounded by □ is SNP. The underlined portion indicates the recognition sequence of restriction enzyme BanII (G [GA] GC [CT] C). As is apparent from FIG. 4, the amplification product of H602 has a restriction enzyme BanII recognition sequence (GAGCTC) and is thus cleaved by BanII. In the case of Haruna Nijo amplification product, C in the recognition sequence portion is changed to T. Since it is mutated (GAGTTC), it is not cleaved by the restriction enzyme BanII. That is, the present genetic marker k02989 is a CAPS marker, and the gene locus involved in the armor length that the subject individual sits on the 5H chromosome by amplification with the second primer set and the restriction enzyme BanII cleavage of the amplification product. It can be determined whether the allele has a Haruna Nijo type genotype or an H602 type genotype.

k05217 is
Amplified using barley genomic DNA as a template using a third primer set that is a combination of a primer having the base sequence shown by ATCGACCCGAGTCTGCATAG (SEQ ID NO: 5) and a primer having the base sequence shown by TCGACGGCAGCACTAGGAATA (SEQ ID NO: 6) This genetic marker is located at a distance of about 1.9 cM on the short arm side from the locus related to the armor length detected on the 5H chromosome. The primer sequence is designed based on one of the barley EST sequences independently developed by the inventors (EST clone name: basd2a02, SEQ ID NO: 25). FIG. 5 shows the nucleotide sequence of the EST. The underlined portion is the primer sequence (SEQ ID NO: 5) and the complementary sequence of the primer sequence (SEQ ID NO: 6). There is a SNP between the Haruna Nijo amplification product and the H602 amplification product. FIG. 6 shows the base sequence of the portion containing the above SNP in the base sequences of both amplification products. The top is the base sequence of H602 (SEQ ID NO: 17), and the bottom is Haruna Nijo base sequence (SEQ ID NO: 18). The base surrounded by □ is SNP. The underlined portion indicates the recognition sequence (GA [ACGT] TC) of the restriction enzyme HinfI. As is clear from FIG. 6, the amplification product of Haruna Nijo has the recognition sequence (GACTC) of the restriction enzyme HinfI, so that it is cleaved by BanII. Since it is mutated (CACTC), it is not cleaved by the restriction enzyme HinfI. That is, the present genetic marker k05217 is a CAPS marker, and is a gene locus involved in a guardian who sits on the 5H chromosome by the amplification by the third primer set and the restriction enzyme HinfI cleavage of the amplification product. It can be determined whether the allele has a Haruna Nijo type genotype or an H602 type genotype.

k00839 is
Barley genomic DNA was amplified using a fourth primer set which is a combination of a primer having a base sequence shown in TCATCGCACTTGCGAGTTTA (SEQ ID NO: 7) and a primer having a base sequence shown in GATCGGGAACATTCCCACTG (SEQ ID NO: 8) as a template. It is a genetic marker that sits at a distance of about 6.3 cM on the long arm side from the locus related to the armor length detected on the 5H chromosome. The primer sequence is designed based on one of the barley EST sequences uniquely developed by the inventors (EST clone name: baak4j01, SEQ ID NO: 26). FIG. 7 shows the nucleotide sequence of the EST. The underlined part is the primer sequence (SEQ ID NO: 7) and the complementary sequence of the primer sequence (SEQ ID NO: 8). There is a SNP between the Haruna Nijo amplification product and the H602 amplification product. FIG. 8 shows the base sequence of the portion containing the SNP in the base sequences of both amplification products. The top is the base sequence of H602 (SEQ ID NO: 19), and the bottom is Haruna Nijo base sequence (SEQ ID NO: 20). The base surrounded by □ is SNP. The underlined part shows the recognition sequence (CTGCAG) of the restriction enzyme PstI. As is apparent from FIG. 8, the amplification product of Haruna Nijo has the recognition sequence (CTGCAG) of the restriction enzyme PstI and is cleaved with PstI. However, the amplification product of H602 has C in the above recognition sequence portion as T. Since it is mutated (TTGCAG), it is not cleaved by the restriction enzyme PstI. That is, the present genetic marker k00839 is a CAPS marker, and is a gene locus related to the guardian who sits on the 5H chromosome by the amplification by the fourth primer set and the restriction enzyme PstI cleavage of the amplification product. It can be determined whether the allele has a Haruna Nijo type genotype or an H602 type genotype.

k00610 is
Barley genomic DNA was amplified using a fifth primer set, which is a combination of a primer having the base sequence shown in GTTCAATCGCACAACACAAA (SEQ ID NO: 9) and a primer having the base sequence shown in CGAAGAAAGGGCAGTCAAAG (SEQ ID NO: 10) as a template It is a genetic marker that sits at a distance of 1.5 to 7.5 cM on the short arm side from the locus related to the armor length detected on the 7H chromosome. The primer sequence is designed based on one of the barley EST sequences uniquely developed by the inventors (EST clone name: baak38p18, SEQ ID NO: 27). FIG. 9 shows the nucleotide sequence of the EST. The underlined portion is the primer sequence (SEQ ID NO: 9) and the complementary sequence of the primer sequence (SEQ ID NO: 10). There is a fragment length polymorphism between the Haruna Nijo amplification product and the H602 amplification product, the size of the fragment amplified using Haruna Nijo genomic DNA as a template is about 500 bp, and the fragment amplified using the H602 genomic DNA as a template The size of is different from about 480 bp. FIG. 10 shows an electrophoresis image of a fragment amplified by PCR using the fifth primer set. Both ends of FIGS. 10A and 10B are molecular weight markers. FIG. 10A shows, in order from the left end (excluding molecular weight markers), Haruna Nijo, H602, Haruna Nijo and H602 hybrid F1, and 1 to 45 amplified fragments of the DH population. FIG. 10 (b) shows 46 to 93 amplified fragments of the DH population in order from the left end (excluding molecular weight markers). As is clear from FIG. 10, by confirming the size of the amplification product, whether the target individual has a Haruna Nijo-type genotype for the allele of the locus involved in the guard arm sitting on the 7H chromosome. , H602 type genotype can be discriminated.

k02212 is
Barley genomic DNA was amplified using a sixth primer set which is a combination of a primer having the base sequence shown in TGCAGCAACCCATGTTTTA (SEQ ID NO: 11) and a primer having the base sequence shown in GCTTTCTGAAGGTCAATGGGG (SEQ ID NO: 12). This genetic marker is located at a distance of 3.5 to 9.5 cM on the long arm side from the locus related to the armor length detected on the 7H chromosome. The primer sequence is designed based on one of the barley EST sequences uniquely developed by the inventors (EST clone name: bags17i04, SEQ ID NO: 28). FIG. 11 shows the base sequence of the EST. The underlined part is the primer sequence (SEQ ID NO: 11) and the complementary sequence of the primer sequence (SEQ ID NO: 12). There is a SNP between the Haruna Nijo amplification product and the H602 amplification product. FIG. 12 shows the base sequence of the portion containing the SNP in the base sequences of both amplification products. The top is the base sequence of H602 (SEQ ID NO: 21), and the bottom is Haruna Nijo's base sequence (SEQ ID NO: 22). The base surrounded by □ is SNP. The underlined portion indicates the recognition sequence (GATC) of the restriction enzyme MboI. As is clear from FIG. 12, the Haruna Nijo amplification product has a restriction enzyme MboI recognition sequence (GATC) and is cleaved with MboI. However, the amplification product of H602 shows that the recognition sequence portion C is changed to G. Since it is mutated (GATG), it is not cleaved by the restriction enzyme MboI. That is, this genetic marker k02212 is a CAPS marker, and the gene locus involved in the armor length that the subject individual sits on the 5H chromosome by amplification with the sixth primer set and cleavage of the restriction product MboI of the amplification product. It can be determined whether the allele has a Haruna Nijo type genotype or an H602 type genotype.

  Here, 1 centmorgan (1 cM) is a unit representing the distance between two loci when crossover occurs at a frequency of 1% between the two loci.

  By the way, genomic DNA used as a template in amplification can be extracted from a plant body by a conventionally known method. Specifically, a general method for extracting genomic DNA from a plant body (see, for example, Murray, M.G. and W.F.Thompson (1980) Nucleic Acids Res. 8: 4321-4325.) Is a suitable example. The genomic DNA can be extracted using any tissue that constitutes a barley plant such as roots, stems, leaves, and reproductive organs. In some cases, it may be extracted from barley callus. The reproductive organs include flower organs (including male and female reproductive organs) and seeds. Extraction of genomic DNA is performed, for example, using the leaves of the barley seedling stage. This is because the tissue is relatively easy to grind, the mixing ratio of impurities such as polysaccharides is relatively small, and can be grown from seeds in a short period of time. Furthermore, it is possible to select individuals at the seedling stage, and the breeding period can be greatly shortened.

  A conventionally known DNA amplification method can be employed as a method for amplification using barley genomic DNA as a template and the combination of the above primers. In general, a PCR method (polymerase chain reaction method) or a modified method thereof is used. The reaction conditions when using the PCR method or its modification method are not particularly limited, and amplification can be performed under the same conditions as usual.

(2) Use of the present invention [Method for isolating a DNA fragment containing a gene locus involved in guardian chief]
As described above, the genetic markers (k0209, k02989) according to the present invention are linked to the gene locus involved in one of the guardians detected on the barley 5H chromosome, and the genetic markers (k05217, k00839) is linked to a locus related to the other guardian length detected on the barley 5H chromosome, and the genetic markers (k00610, k02212) according to the present invention were detected on the barley 7H chromosome. It is linked to the locus related to the guardian. Therefore, by using the genetic markers of k00029 and k02989, a DNA fragment containing a locus related to one of the guardian lengths detected on the barley 5H chromosome can be isolated, and the genetic markers of k05217 and k00839 are used. Thus, a DNA fragment containing the locus associated with the other guardian length detected on the barley 5H chromosome can be isolated and detected on the barley 7H chromosome using the genetic markers k00610 and k02212. It is possible to isolate a DNA fragment containing the gene locus involved in the guard arm.

  The isolation means that the target DNA fragment, that is, the DNA fragment containing the locus involved in the armor guardian is cloned, but in a broad sense by backcrossing from the cross F1 population, Isolation includes selection of an individual having a DNA fragment containing a locus involved in one of the parents, and introducing only the locus region into the target variety.

  The method for isolating a DNA fragment containing a gene locus involved in guard arm length using the genetic marker according to the present invention is not particularly limited, and examples thereof include the following method.

  In barley, two types of BAC libraries of genomic DNA have been created, including “Haruna Nijo”, which is being developed by the present inventors, and a plurality of BAC libraries are currently under development. Therefore, using such a BAC library, according to a conventionally known map-based cloning technique, a BAC containing the marker at the locus involved in the armor and the genetic marker of the present invention linked to the locus. By identifying a clone, creating a BAC contig from the clone and determining the base sequence, it is possible to finally reach the gene locus involved in the guard arm.

  In addition, as described above, one parent is backcrossed to the hybrid F1, thereby introducing a DNA fragment containing a gene locus involved in the guardian length of the other parent into the target variety (in a broad sense). can do.

  In addition, when isolating a DNA fragment containing a locus related to the armor length, including the above method, a genetic marker that sits as close as possible to the locus related to the desired armor length It is preferable to select and use. This is because the probability of recombination between the genetic locus involved in the desired protective arm and the genetic marker is lower, and the fragment containing the locus involved in the protective arm can be isolated more reliably. .

[Production method of protective arm length modified plant and protective arm length modified plant obtained by the production method]
By introducing into the genomic DNA of a grass family plant a DNA fragment containing a locus related to a guardian length obtained by the method for isolating a DNA fragment containing a locus related to a guardian length according to the present invention, It is possible to produce a gill modified plant. As the gramineous plant, wheat is preferable, and barley is particularly preferable. In addition, for example, it is possible to introduce a DNA fragment containing a locus related to the armor isolated from barley into a grass family other than barley, and limited to isolation and introduction only between the same genera Is not to be done.

  The method for introducing the DNA fragment is not particularly limited, and a known method can be appropriately selected and used. More specifically, it may be produced by introducing it into the genomic DNA of a grass family plant using, for example, Agrobacterium or particle gun, and thereby a modified cultivated chief varieties can be obtained. For example, the journal The Plant Journal (1997) 11 (6), 1369-1376 discloses a method for transforming barley using Agrobacterium tumefaciens by Sonia Tingay et al. Can produce barley.

  In addition, a DNA fragment containing a gene locus related to the armor length by crossing between a plant individual having a DNA fragment containing the gene locus involved in the target armor length and a plant individual into which the DNA fragment is to be introduced. Can also be introduced into plants. In this method, as long as crossing is possible, it is possible to introduce a DNA fragment containing a gene locus involved in the protective arm of plants of other species or genera.

  The protective armor modified plant according to the present invention is obtained by the production method according to the present invention. When a DNA fragment containing a gene locus having a phenotype that increases the length of the long armor is introduced, the modified long armor plant becomes a cultivar having a long armor length longer than that of the original variety. When a DNA fragment containing a genetic locus having a phenotype that shortens the length is introduced, the cultivar has a giraffe length shorter than that of the original variety.

[Selection method of gynecologists modified grass family plants]
The method for selecting a gull length modified gramineous plant according to the present invention may be any method as long as it is a method for selecting a gill length modified gynecaceous plant using the genetic marker according to the present invention as an index, and other steps, conditions, materials, etc. Is not particularly limited. For example, a conventionally known crop breeding method can be used.

  More specifically, for example, a method of extracting a plant genomic DNA produced by crossing or the like and selecting a plant using the genotype of the genetic marker according to the present invention as an index can be mentioned. Examples of means for detecting a genetic marker include, for example, a fragment length or a fragment restriction enzyme for a DNA fragment amplified using any of the first to sixth primer sets using genomic DNA extracted from a target plant as a template. The observation of digestion patterns can be mentioned.

  The present invention is not limited to the above-described embodiments, and various modifications can be made within the scope of the claims, and the embodiments can be obtained by appropriately combining technical means disclosed in different embodiments. The form is also included in the technical scope of the present invention.

[Used plant]
H1 haploid obtained by cultivating F1 pollen obtained from crossing brewing barley “Hardeum vulgare ssp. Vulgare variety Harunanijo” and wild barley “H602” (Hordeum vulgare ssp. Spontaneum H602) A population consisting of 93 doubled haploids that were grown and naturally doubled was used.

[Create a chain map]
About 120,000 barley EST sequences possessed by the present inventors were base-called again with phred, then trimmed with a quality score of 20, and vector masking was performed to obtain about 60,000 sequences at the 3 ′ end. Unigene consisting of contig 8,753 and singlet 6,686 was prepared from these sequences by phrap. About 11,000 primer sets for amplifying a 150-500 bp cDNA sequence centered on 400 bp were created by the primer creation software Primer3. Among these, about 5,100 primer sets, in order to detect the presence or absence of polymorphism of genomic fragments amplified between Haruna Nijo and H602, each genomic DNA was amplified by PCR and the presence or absence of a band was detected by agarose gel electrophoresis. The number of bands and the band size were investigated, and those that could serve as markers were selected. In addition, when there is no polymorphism in the band size, the nucleotide sequence difference is detected by direct sequencing of the amplified fragment, and markers that can be converted into CAPS (cleaved amplified polymorphic sequence) for 39 types of restriction enzymes are markers. Selected as.

  As described above, a linkage map composed of markers of a total of 499 loci was constructed for the DH population derived from the hybrid F1 of Haruna Nijo and H602. This linkage map has an average marker density of 3.0 cM / locus and a total length of 1,470 cM.

[Determination of genotype]
The genotype of each individual in the DH population was determined using the markers mapped to the linkage map of the DH population. That is, PCR was performed using a primer set designed based on the EST sequence using DNA isolated from fresh leaf tissue of each individual as a template. For the fragment length polymorphism marker, the genotype was determined by electrophoresis of PCR products. For the CAPS (cleaved amplified polymorphic sequence) marker, the PCR product was digested with a restriction enzyme and the genotype was determined by electrophoresis.

[Measurement of guard length]
For each individual in the DH population, the guard length was measured with a ruler and recorded. The distribution of guard length is shown in FIG. In FIG. 13, the white arrow indicates Haruna Nijo, the black arrow indicates the protection length of H602, the vertical axis indicates the number of individuals, and the horizontal axis indicates the protection length. As is clear from FIG. 13, the guard length of this DH group was distributed between 8 mm and 24 mm.

[QTL analysis]
The QTL analysis algorithm uses simple interval mapping (hereinafter abbreviated as “SIM”) and composite interval mapping (hereinafter abbreviated as “CIM”). MAPMAKER / QTL and QTL Cartographer were used. The threshold of the LOD score was set to 2, and when the LOD score exceeded 2, the presence of QTL was estimated at the position with the largest LOD in the two marker sections.

〔result〕
The results are shown in Table 1.

  As is clear from Table 1, two QTLs involved in the guard were detected by SIM. In addition, two QTLs related to the chief guard were detected by CIM. However, the QTLs detected on the 7H chromosome by SIM and CIM are both detected at positions sandwiched by the same genetic marker, and thus are considered to be the same QTL. Therefore, as a result of the QTL analysis for the locus involved in the guardian chief, two QTLs were detected on the 5H chromosome and one QTL was detected on the 7H chromosome. The QTL detected on the 5H chromosome by SIM sits on the position between genetic markers k02989 at the position of genetic markers k00029 to 0.0 cM, and the LOD score is 4.3. This QTL can explain 20.7% of the phenotypic variance. Also, the presence of this QTL shortens the 3.0 mm guard length. The QTL detected on the 5H chromosome by CIM sits on the position between genetic markers k00839 at the position of genetic markers k05217 to 1.9 cM, and the LOD score is 5.7. This QTL can explain 48.3% of the phenotypic variance. Also, the presence of this QTL shortens the 7.3 mm guard length. QTL detected on the 7H chromosome by SIM and CIM sits on a position sandwiched between genetic markers k00610 and k02212. As a result of SIM analysis, this QTL sits at the position of the genetic marker k00610 to 1.9 cM, and the LOD score is 15.4. This QTL can explain 59.3% of the phenotypic variance. Also, the presence of this QTL shortens the 5.4mm guard length. Further, in the analysis result by CIM, this QTL sits on the position of genetic marker k00610 to 6.8 cM, and the LOD score is 8.7. This QTL can explain 58.2% of the phenotypic variance. Also, the presence of this QTL shortens the 7.0 mm guard length.

  The genetic marker according to the present invention can be used for breeding of a gill length modified plant, isolation of a gene involved in gall length, and the like, and is expected to greatly contribute to the efficiency of breeding. Therefore, it can be widely used for agriculture in general and is also effective in the food industry using barley and the like as a raw material. It can also be used for basic research in the biological field, particularly plant genome research.

It is a figure which shows the position of the primer sequence designed based on the base sequence of the barley EST clone: baak12d06. It is a figure which shows the base sequence around SNP and SNP between H602 and Haruna Nijo in genetic marker k0209. It is a figure which shows the position of the primer sequence designed based on the base sequence of barley EST clone: bags33j12, and the said sequence. It is a figure which shows the base sequence around SNP and SNP between H602 and Haruna Nijo in genetic marker k02989. It is a figure which shows the position of the base sequence of the barley EST clone: basd2a02 and the primer sequence designed based on the said sequence. It is a figure which shows the base sequence around SNP and SNP between H602 and Haruna Nijo in genetic marker k05217. It is a figure which shows the position of the primer sequence designed based on the base sequence of barley EST clone: baak4j01 and the said sequence. It is a figure which shows the base sequence around SNP and SNP between H602 and Haruna Nijo in genetic marker k00839. It is a figure which shows the position of the primer sequence designed based on the base sequence of the barley EST clone: baak38p18. (A), (b) is an electrophoresis image showing a fragment length polymorphism between H602 and Haruna Nijo in the genetic marker k00610. (A) is an electrophoretic image of the amplified fragments of Haruna Nijo, H602, Haruna Nijo and H602 hybrid F1, and DH populations 1 to 45 from the left, and (b) from the left, DH populations 46 to 93. It is an electrophoresis image of an amplified fragment. It is a figure which shows the position of the primer sequence designed based on the base sequence of barley EST clone: bags17i04, and the said sequence. It is a figure which shows the base sequence around SNP and SNP between H602 and Haruna Nijo in genetic marker k02212. It is a graph which shows distribution of the guard length of each individual of DH group.

Claims (17)

A genetic marker that is present in the genomic DNA of a grass family and is linked to a genetic locus that is involved in the armor,
A genetic marker, wherein the genetic marker is located at a distance within a range of 0 to 11 centimorgans from the locus involved in the armor length.   The genetic marker according to claim 1, wherein the gramineous plant is wheat.   The genetic marker according to claim 2, wherein the wheat is barley.   The genetic marker according to claim 3, wherein the genomic DNA is a 5H chromosome.   5. The amplification according to claim 1, wherein the amplification is performed using a first primer set which is a combination of a primer having the base sequence shown in SEQ ID NO: 1 and a primer having the base sequence shown in SEQ ID NO: 2. The genetic marker according to any one of claims.   5. The amplification according to claim 1, wherein the amplification is performed using a second primer set which is a combination of a primer having the base sequence shown in SEQ ID NO: 3 and a primer having the base sequence shown in SEQ ID NO: 4. The genetic marker according to any one of claims.   5. The amplification according to claim 1, wherein amplification is performed using a third primer set which is a combination of a primer having the base sequence shown in SEQ ID NO: 5 and a primer having the base sequence shown in SEQ ID NO: 6. The genetic marker according to any one of claims.   5. The amplification according to claim 1, wherein the amplification is performed using a fourth primer set which is a combination of a primer having the base sequence shown in SEQ ID NO: 7 and a primer having the base sequence shown in SEQ ID NO: 8. The genetic marker according to any one of claims.   The genetic marker according to claim 3, wherein the genomic DNA is a 7H chromosome.   Amplification using a fifth primer set, which is a combination of a primer having the base sequence shown in SEQ ID NO: 9 and a primer having the base sequence shown in SEQ ID NO: 10, or The genetic marker according to 3 or 9.   Amplified using a sixth primer set, which is a combination of a primer having the base sequence shown in SEQ ID NO: 11 and a primer having the base sequence shown in SEQ ID NO: 12, or The genetic marker according to 3 or 9.   A method for isolating a DNA fragment, comprising isolating a DNA fragment containing a genetic locus involved in guardian length using the genetic marker according to any one of claims 1 to 11.   A DNA fragment containing a locus relating to the above-mentioned protective arm obtained by the isolation method according to claim 12 is introduced into the genomic DNA of the grass family plant. Production method.   14. The method for producing a gull length modified gramineous plant according to claim 13, wherein the gramineous plant is wheat.   15. The method for producing a gull length modified gramineous plant according to claim 14, wherein the wheat is a barley.   A gill length modified gramineous plant obtained by the method for producing a gill length modified gramineous plant according to any one of claims 13 to 15.   A method for selecting a giraffe-modified gynecaceous plant using the genetic marker according to any one of claims 1 to 11 as an index.

Images