JP4298538B2 - Genetic markers linked to loci involved in dormancy and their use - Google Patents

Description

  The present invention relates to a novel genetic marker and a method for using the same, and more particularly, to a genetic marker linked to a gene locus involved in dormancy in a grass family such as barley and the use thereof.

  Freshly harvested seeds are dormant and are known not to germinate immediately. This tendency is strong in wild-type barley, and cultivated varieties have some dormancy. If there is no dormancy, there will be a problem of ear germination where seeds will germinate due to rain before harvest. That is, dormancy is a trait that acts as a resistance factor to ear germination. However, if the dormancy is too deep, problems such as weeding without germination until the next year in the field, and no buds appearing when making brewed malt occur. Therefore, it has become an important breeding goal to modify it so as to have moderate dormancy.

  Conventionally, for breeding crops, it is necessary to cross cultivated varieties or wild varieties with a target trait, actually cultivate many individuals, select individuals with the target trait, and genetically fix the target trait First of all, it required a vast field, a lot of human power, and considerable years. For example, when dormancy is the target trait, after cultivating the selection target population and investigating whether it will germinate, or after investigating whether the dormancy is not too deep, select individuals to be selected Had to be identified. Further, if the target trait is a trait that is easily affected by the cultivation environment factor, it is difficult to determine whether or not the target trait expressed by the selected individual is a gene phenotype.

  Therefore, in recent years, breeding methods by selection using genetic markers as indices have been used in order to shorten the breeding period, reduce labor and field area, and reliably select useful genes. In breeding with such a genetic marker, selection can be made at the seedling stage depending on the genotype of the marker, and the presence or absence of the target trait can be easily confirmed. Therefore, efficient breeding can be realized by using genetic markers. In order to achieve breeding using genetic markers, it is essential to develop genetic markers that are strongly linked to the target trait.

  By the way, many of the traits important in agriculture are many that show continuous mutations in hybrid progeny. Such traits are called quantitative traits because they are measured on a quantitative scale such as time and length. It is known that the dormancy is one of quantitative traits. In general, quantitative traits are often determined by the action of multiple genes, rather than a single dominant gene-dominated trait. Many traits that are targeted for improvement in crop breeding, such as yield, quality, and taste, are often quantitative traits.

  A genetic position occupied by such a gene that governs quantitative traits on a chromosome is referred to as QTL (Quantitative Trait Loci). As a method of estimating QTL, QTL analysis using a genetic marker existing in the vicinity of QTL is used. With the advent of DNA markers in the late 1980s, detailed linkage map creation using DNA markers has greatly progressed, and QTL analysis has been performed on many organisms based on the maps.

  As described above, the development of genetic markers linked to the target trait is enabled by high-accuracy QTL analysis based on a detailed linkage map that can cover the entire chromosome, and by using the obtained genetic markers, it is efficient. It can be said that simple breeding can be realized.

Examples of techniques related to the genetic marker include, for example, barley, 1) a genetic marker linked to a gene that confers aluminum resistance to barley and a technique related to its use (see Patent Document 1), and 2) a nucleic acid derived from a barley chromosome. The present inventors have proposed a novel primer set (see Patent Document 2) for detecting a marker in the background of wheat, a technique relating to its use, and the like.
JP 2002-291474 A (published on October 8, 2002) JP 2003-111593 A (published on April 15, 2003)

  As described above, since dormancy of gramineous plants is a trait that acts as a resistance factor for ear germination, alteration of dormancy is one of important breeding goals. However, since dormancy often involves multiple loci, the selection method for actually investigating dormancy should confirm whether genes (locus) involved in dormancy are reliably selected. Is difficult. Thus, it is very effective to use genetic markers for breeding plants with altered dormancy. If genetic markers linked to loci involved in dormancy are developed and made available, it will be possible to achieve significant efficiency in breeding dormancy-modified plants.

  The present invention has been made in view of the above problems, and its object is to provide a novel genetic marker linked to a locus related to dormancy in grasses, particularly barley, and a typical use thereof. There is to do.

  In order to solve the above-mentioned problems, the present inventors designed a primer set based on the barley EST sequence possessed by the inventors, and determined whether or not a genetic marker (DNA) was determined by the presence or absence of a polymorphism of the barley genomic fragment amplified by the primer set. Marker) was developed. Furthermore, using a doubled haploid (hereinafter abbreviated as “DH”) population produced from a cross F1 of brewing barley “Haruna Nijo” and wild barley “H602”, the linkage between the above genetic markers is detected. Then, a linkage map of the DH strain was prepared, and a QTL analysis of a gene locus involved in dormancy was performed based on this linkage map. As a result, two loci involved in dormancy were detected on the 5H chromosome. The present inventors have further analyzed and found novel genetic markers linked to the loci involved in dormancy, respectively. That is, this invention is completed by the said novel knowledge, and includes the following inventions.

  That is, the genetic marker according to the present invention is a genetic marker that is present in the genomic DNA of a grass family and is linked to a gene locus involved in dormancy, and is 0 to 5 centmorgan from the gene locus involved in dormancy. It is characterized by being located at a distance within the range. Since the genetic marker is strongly linked to a locus related to dormancy, the probability of recombination occurring between the genetic marker and the locus relating to dormancy is low. Therefore, by using the genetic marker, for example, it is possible to obtain a DNA fragment containing a locus related to dormancy, to produce (produce) or discriminate dormancy-modified gramineous plants.

  Furthermore, the genetic marker according to the present invention is characterized in that the Gramineae plant is a wheat. Therefore, by using the above genetic markers, it is possible to obtain DNA fragments containing loci involved in dormancy in wheat, such as barley and wheat, and to produce (produce) and discriminate dormancy-modified wheat It becomes.

  Furthermore, the genetic marker according to the present invention is characterized in that the wheat is a barley. Therefore, by using the above genetic marker, it is possible to obtain a DNA fragment containing a locus involved in dormancy in barley, to produce (produce) or discriminate dormancy-modified barley.

  Furthermore, the genetic marker according to the present invention is characterized in that the genomic DNA is a 5H chromosome. Therefore, by using the above genetic marker, it is possible to obtain a DNA fragment containing a locus related to dormancy existing on the 5H chromosome of barley, and to produce (produce) and discriminate dormancy-modified barley. Become.

  Furthermore, the genetic marker according to the present invention is amplified using a first primer set which is a combination of a primer having the base sequence shown in SEQ ID NO: 1 and a primer having the base sequence shown in SEQ ID NO: 2. It is a feature. When an amplification reaction such as PCR is performed using the first primer set, the genetic marker can be easily amplified and detected, and the dormant modified gramineous plant can be easily identified.

  The genetic marker according to the present invention is amplified using a second primer set that is a combination of a primer having the base sequence shown in SEQ ID NO: 3 and a primer having the base sequence shown in SEQ ID NO: 4. It is a feature. When an amplification reaction such as PCR is performed using the second primer set, the genetic marker can be easily amplified and detected, and the dormant modified gramineous plant can be easily identified.

  The genetic marker according to the present invention is amplified using a third primer set that is a combination of a primer having the base sequence shown in SEQ ID NO: 5 and a primer having the base sequence shown in SEQ ID NO: 6. It is a feature. When an amplification reaction such as PCR is performed using the third primer set, the genetic marker can be easily amplified and detected, and the dormant modified gramineous plant can be easily identified.

  The genetic marker according to the present invention is amplified using a fourth primer set which is a combination of a primer having the base sequence shown in SEQ ID NO: 7 and a primer having the base sequence shown in SEQ ID NO: 8. It is a feature. When an amplification reaction such as PCR is performed using the fourth primer set, the genetic marker can be easily amplified and detected, and the dormant modified gramineous plant can be easily identified.

  On the other hand, the method for isolating a DNA fragment according to the present invention is characterized by isolating a DNA fragment containing a gene locus involved in dormancy using the genetic marker according to the present invention. The genetic marker according to the present invention is strongly linked to a gene locus involved in dormancy, and if cloning is performed with the above genetic marker as a target, a DNA fragment containing the gene locus involved in dormancy is easily isolated. It becomes possible.

  The dormancy-modified modified gramineous plant production method according to the present invention includes a DNA fragment containing the gene locus involved in the dormancy obtained by the DNA fragment isolation method according to the present invention described above. It is characterized by being introduced into DNA. The gramineous plant is preferably wheat, and more preferably barley. The production method makes it possible to produce a dormant modified grass plant. In addition, dormant modified grasses obtained by the production method are also included in the present invention.

  The method for selecting a dormant modified gramineous plant according to the present invention is a method for selecting a dormant modified gramineous plant using the genetic marker according to the present invention as an index. Since the genetic marker according to the present invention is strongly linked to a locus related to dormancy, the probability that recombination occurs between the genetic marker and the locus related to dormancy is very low. Therefore, by detecting the genetic marker, it is possible to easily determine the genotype of a locus involved in dormancy in the test target plant, and it is possible to easily find an individual to be selected.

  Since the genetic marker according to the present invention is linked to a locus related to dormancy, it is possible to breed a grass family plant with altered dormancy using the genetic marker as an index. Therefore, there is an effect that efficient breeding of the dormancy-modified plant can be realized. More specifically, since the target individual can be selected at the seedling stage, there is no need to select the target individual after actually investigating the dormancy of the plant individual, and the breeding period can be shortened. In addition, since a plurality of gene loci can be selected at the same time, the target genotype can be surely obtained rather than selecting by observation. In addition, the labor force and the field area can be reduced.

  Moreover, if selective breeding is performed using the genetic marker according to the present invention as an index, the influence on the phenotype by the cultivation environment factor can be eliminated. Therefore, there is an effect that reliable selection of useful genes (locus) can be achieved.

  Furthermore, the dormancy-modified plant selectively bred with the genetic marker as an index has an effect of having resistance to ear germination.

  An embodiment of the present invention will be described as follows. Note that the present invention is not limited to this.

  The present invention relates to genetic markers linked to loci involved in dormancy in gramineous plants and an example of their use. Hereinafter, a genetic marker according to the present invention and an example of use of the present invention will be described.

(1) Genetic marker according to the present invention The genetic marker according to the present invention may be any genetic marker that exists in the genomic DNA of gramineous plants and is linked to a gene locus involved in dormancy. As the gramineous plant, wheat is preferable, and barley is particularly preferable. The grass family plant is not particularly limited as long as it is a plant such as barley, wheat, and rice. The wheat refers to, for example, barley, wheat, rye, triticale, oat and the like.

  Dormancy means a trait representing the property that seeds after harvest do not germinate for a certain period of time. The dormancy can be investigated by, for example, investigating the germination rate of seeds after a certain period from harvesting. If there is no dormancy, the problem of sprouting will occur. Conversely, if the dormancy is too deep, weeding will not occur in the field until the next year, and weeds will not be produced when making malt for beer brewing. Arise. Accordingly, varieties having moderate dormancy are preferred as cultivars. Therefore, dormancy modification is one of the important breeding goals.

  Dormancy is a quantitative trait that is determined by multiple loci. With respect to quantitative traits, the position of the gene locus involved in the quantitative trait on the chromosome can be estimated by QTL analysis. Hereinafter, genetic markers linked to loci involved in dormancy developed by the present inventors in barley will be described in detail. The genetic markers according to the present invention are not limited to these.

  The present inventors created a high-density linkage map using a doubled haploid (DH) population produced from a cross F1 of brewing barley “Haruna Nijo” and wild barley “H602”. That is, barley genomic DNA was amplified using a primer set designed based on the barley EST (expressed sequence tag) sequence possessed by the present inventors, and the length of the amplified fragment was determined between “Haruna Nijo” and “H602”. Those having a polymorphism and those having a polymorphism with a different digestion pattern by a restriction enzyme having an amplified fragment length were identified, and a linkage map comprising about 500 loci including these DNA markers was constructed. Based on this linkage map and data on the dormancy of 93 individuals of the DH population measured by the present inventors, QTL analysis of loci involved in dormancy was performed. As a result, two loci involved in dormancy were detected on the 5H chromosome. The genetic marker according to the present invention sandwiches a gene locus involved in one dormancy among the two loci involved in dormancy that sit on the 5H chromosome, the two genetic markers located closest to each other, and the other It is the two genetic markers located closest to the gene locus involved in dormancy. The inventors have identified genetic markers linked to one of the loci involved in dormancy detected on the 5H chromosome as “k04618” and “k00204”, and genetic markers linked to the other locus related to dormancy as “ They were named “k00101” and “k06472”.

k04618 is
Amplified using barley genomic DNA as a template using a first primer set which is a combination of a primer having the base sequence shown by ATCAGGGCATATGACCCAAGG (SEQ ID NO: 1) and a primer having the base sequence shown by AGGGAAATGGGCACAAGAC (SEQ ID NO: 2) The DNA marker is located at a distance of 2 to 4.5 centmorgan (hereinafter referred to as cM) on the short arm side from the gene locus involved in dormancy detected on the 5H chromosome. The primer sequence is designed based on one of the barley EST sequences uniquely developed by the inventors (EST clone name: bah62n12, SEQ ID NO: 15). FIG. 1 shows the nucleotide sequence of the EST. The underlined portion is the primer sequence (SEQ ID NO: 1) and the complementary sequence of the primer sequence (SEQ ID NO: 2). There is a fragment length polymorphism between the Haruna Nijo amplification product and the H602 amplification product, the size of the fragment amplified using Haruna Nijo genomic DNA as a template is about 600 bp, and the fragment amplified using the H602 genomic DNA as a template The size of is different from about 550 bp. FIG. 2 shows an electrophoresis image of a fragment amplified by PCR using the first primer set. Both ends of FIGS. 2A and 2B are molecular weight markers. FIG. 2A shows, in order from the left end (excluding molecular weight markers), Haruna Nijo, H602, Haruna Nijo and H602 cross F1, and 1 to 45 amplified fragments of the DH population. FIG. 2 (b) shows 46 to 93 amplified fragments of the DH population in order from the left end (excluding molecular weight markers). As is clear from FIG. 2, by confirming the size of the amplification product, the allele of the locus involved in dormancy that sits on the 5H chromosome has a Haruna Nijo type genotype. It can be discriminated whether it has H602 type genotype.

k00204 is
Amplified using barley genomic DNA as a template using a second primer set which is a combination of a primer having the base sequence shown by AGCGATAAGTAACCGAGCCA (SEQ ID NO: 3) and a primer having the base sequence shown by GGAGGACGACAAGAACTTGGA (SEQ ID NO: 4) This genetic marker is located at a distance of 0 to 2.5 cM on the long arm side from the gene locus involved in dormancy detected on the 5H chromosome. The primer sequence is designed based on one of the barley EST sequences uniquely developed by the inventors (EST clone name: baak21h06, SEQ ID NO: 16). FIG. 3 shows the nucleotide sequence of the EST. The underlined portion is the primer sequence (SEQ ID NO: 3) and the complementary sequence of the primer sequence (SEQ ID NO: 4). There is SNP (single nucleotide polymorphisms) between the Haruna Nijo amplification product and the H602 amplification product. FIG. 4 shows the base sequence of the portion containing the above SNP in the base sequences of both amplification products. The top is the base sequence of H602 (SEQ ID NO: 9), and the bottom is Haruna Nijo's base sequence (SEQ ID NO: 10). The base surrounded by □ is SNP. The underlined portion indicates the recognition sequence (GCGC) of the restriction enzyme HhaI. As is clear from FIG. 4, the Haruna Nijo amplification product has a recognition sequence (GCGC) of the restriction enzyme HhaI and is cleaved with HhaI. However, the amplification product of H602 shows that C in the recognition sequence portion is changed to G. Since it is mutated (GCGG), it is not cleaved by the restriction enzyme HhaI. That is, the present genetic marker k00204 is a CAPS (cleaved amplified polymorphic sequence) marker, and is made dormant so that the subject individual sits on the 5H chromosome by amplification with the second primer set and restriction enzyme HhaI cleavage of the amplified product. It is possible to determine whether the alleles at the involved loci have a Haruna Nijo type genotype or an H602 type genotype.

k00101 is
Amplified using barley genomic DNA as a template using a third primer set which is a combination of a primer having the base sequence shown by GCGGTGCTTTGCCTCTTTCTA (SEQ ID NO: 5) and a primer having the base sequence shown by CTGCAGCTGTTTGCCAAGT (SEQ ID NO: 6) This genetic marker is located at a distance of about 3.9 cM on the short arm side from the gene locus involved in dormancy detected on the 5H chromosome. The primer sequence is designed based on one of the barley EST sequences uniquely developed by the inventors (EST clone name: baak15n22, SEQ ID NO: 17). FIG. 5 shows the nucleotide sequence of the EST. The underlined portion is the primer sequence (SEQ ID NO: 5) and the complementary sequence of the primer sequence (SEQ ID NO: 6). There is a SNP between the Haruna Nijo amplification product and the H602 amplification product. FIG. 6 shows the base sequence of the portion containing the above SNP in the base sequences of both amplification products. The top is the base sequence of H602 (SEQ ID NO: 11), and the bottom is Haruna Nijo base sequence (SEQ ID NO: 12). The base surrounded by □ is SNP. The underlined portion indicates the recognition sequence (GCGC) of the restriction enzyme HhaI. As is clear from FIG. 6, the Haruna Nijo amplification product has a recognition sequence (GCGC) of the restriction enzyme HhaI and is cleaved with HhaI. Since it is mutated (GCTC), it is not cleaved by the restriction enzyme HhaI. That is, the present genetic marker k00101 is a CAPS marker, and an allele of a gene locus involved in dormancy in which the subject individual sits on the 5H chromosome by amplification with the third primer set and cleavage of the amplification product with the restriction enzyme HhaI. It is possible to determine whether a gene has a Haruna Nijo type genotype or an H602 type genotype.

k06472 is
Amplified using barley genomic DNA as a template using a fourth primer set which is a combination of a primer having the base sequence shown in TTAACCGGGACAGAATGGAA (SEQ ID NO: 7) and a primer having the base sequence shown in GGCAATTTACGCCTCTGCTC (SEQ ID NO: 8) This genetic marker is located at a distance of about 0.8 cM on the long arm side from the gene locus involved in dormancy detected on the 5H chromosome. The primer sequence is designed based on one of the barley EST sequences uniquely developed by the inventors (EST clone name: BaAK28L22, SEQ ID NO: 18). FIG. 7 shows the nucleotide sequence of the EST. The underlined part is the primer sequence (SEQ ID NO: 7) and the complementary sequence of the primer sequence (SEQ ID NO: 8). There is a SNP between the Haruna Nijo amplification product and the H602 amplification product. FIG. 8 shows the base sequence of the portion containing the SNP in the base sequences of both amplification products. The top is the base sequence of H602 (SEQ ID NO: 13), and the bottom is Haruna Nijo's base sequence (SEQ ID NO: 14). The base surrounded by □ is SNP. The underlined portion indicates the recognition sequence (GTAC) of the restriction enzyme AfaI. As is apparent from FIG. 8, the amplification product of H602 has a recognition sequence (GTAC) of the restriction enzyme AfaI, so that it is cleaved by AfaI. Since it is mutated (GTAG), it is not cleaved by the restriction enzyme AfaI. That is, the present genetic marker k06472 is a CAPS marker, and an allele of a locus involved in dormancy in which the target individual sits on the 5H chromosome by amplification with the fourth primer set and cleavage of the amplification product with the restriction enzyme AfaI. It is possible to determine whether a gene has a Haruna Nijo type genotype or an H602 type genotype.

  Here, 1 centmorgan (1 cM) is a unit representing the distance between two loci when crossover occurs at a frequency of 1% between the two loci.

  By the way, genomic DNA used as a template in amplification can be extracted from a plant body by a conventionally known method. Specifically, a general method for extracting genomic DNA from a plant body (see, for example, Murray, M.G. and W.F.Thompson (1980) Nucleic Acids Res. 8: 4321-4325.) Is a suitable example. The genomic DNA can be extracted using any tissue that constitutes a barley plant such as roots, stems, leaves, and reproductive organs. In some cases, it may be extracted from barley callus. The reproductive organs include flower organs (including male and female reproductive organs) and seeds. Extraction of genomic DNA is performed, for example, using the leaves of the barley seedling stage. This is because the tissue is relatively easy to grind, the mixing ratio of impurities such as polysaccharides is relatively small, and can be grown from seeds in a short period of time. Furthermore, it is possible to select individuals at the seedling stage, and the breeding period can be greatly shortened.

  A conventionally known DNA amplification method can be employed as a method for amplification using barley genomic DNA as a template and the combination of the above primers. In general, a PCR method (polymerase chain reaction method) or a modified method thereof is used. Reaction conditions when using the PCR method or its modification method are not particularly limited, and amplification can be performed under the same conditions as usual.

(2) Use of the present invention [Method for isolating a DNA fragment containing a gene locus involved in dormancy]
As described above, the genetic markers (k04618, k00204) according to the present invention are linked to one of the two loci involved in dormancy detected on the barley 5H chromosome. Such genetic markers (k00101, k06472) are linked to the other gene locus. Therefore, by using the genetic markers k04618 and k00204, a DNA fragment containing one of the loci involved in dormancy detected on the barley 5H chromosome can be isolated, and k00101, By using the genetic marker of k06472, a DNA fragment containing the other locus can be isolated.

  The isolation means that the target DNA fragment, that is, a DNA fragment containing a locus involved in dormancy is cloned, but in a broad sense, the parental group is obtained by backcrossing from the hybrid F1 population. Isolation includes selection of an individual having a DNA fragment containing a gene locus involved in dormancy, and introducing only the locus region into the target variety.

  The method for isolating a DNA fragment containing a gene locus involved in dormancy using the genetic marker according to the present invention is not particularly limited, and examples thereof include the following method.

  In barley, two types of BAC libraries of genomic DNA have been created, including “Haruna Nijo”, which is being developed by the present inventors, and a plurality of BAC libraries are currently under development. Therefore, using such a BAC library, according to a conventionally known map-based cloning technique, a BAC clone containing the marker at a locus involved in dormancy and the genetic marker of the present invention linked to the locus The gene locus involved in dormancy can finally be reached by creating a BAC contig and determining the base sequence therefrom.

  Also, as described above, one parent is backcrossed to the cross F1 to introduce a DNA fragment containing a gene locus involved in the dormancy of the other parent into the target variety for isolation (in a broad sense). be able to.

  When isolating a DNA fragment containing a locus related to dormancy, including the above method, select a genetic marker that sits as close as possible to the target locus related to dormancy And preferably used. This is because the probability of recombination between the gene locus involved in the target dormancy and the genetic marker is lower, and the fragment containing the gene locus involved in dormancy can be more reliably isolated.

[Method for producing dormancy-modified plant and dormancy-modified plant obtained by the production method]
By introducing a DNA fragment containing a gene locus involved in dormancy obtained by the method for isolating a DNA fragment containing a gene locus involved in dormancy according to the present invention into a genomic DNA of a grass family plant, the dormancy is obtained. It is possible to produce modified grasses. As the gramineous plant, wheat is preferable, and barley is particularly preferable. In addition, for example, a DNA fragment containing a locus related to dormancy isolated from barley can be introduced into a grass family other than barley, and is limited to isolation and introduction only between the same genera. It is not something.

  The method for introducing the DNA fragment is not particularly limited, and a known method can be appropriately selected and used. More specifically, for example, it may be produced by introducing it into the genomic DNA of a gramineous plant using Agrobacterium or particle gun, and thereby a dormant modified variety can be obtained. For example, the journal The Plant Journal (1997) 11 (6), 1369-1376 discloses a method for transforming barley using Agrobacterium tumefaciens by Sonia Tingay et al. Can produce barley.

  Further, by crossing a plant individual having a DNA fragment containing a gene locus involved in the desired dormancy with a plant individual into which the DNA fragment is to be introduced, a DNA fragment containing a gene locus involved in dormancy is obtained. It can also be introduced into plants. In this method, as long as crossing is possible, it is possible to introduce a DNA fragment containing a gene locus involved in dormancy possessed by plants of other species or genera.

  The dormancy-modified plant according to the present invention is obtained by the production method according to the present invention. The dormancy-modified plant, when a DNA fragment containing a gene locus having a phenotype that deepens dormancy is introduced, becomes a variety having a dormancy deeper than the dormancy of the original variety, and a phenotype that shallows dormancy When a DNA fragment containing a gene locus having a phenotype is introduced, the cultivar has a dormancy that is shallower than that of the original cultivar. For example, if a DNA fragment containing a gene locus having a phenotype that deepens dormancy is introduced into a variety having little dormancy, a variety that does not cause ear germination can be obtained. In addition, if a DNA fragment containing a gene locus having a phenotype that makes the dormancy shallower is introduced into a deeply dormant variety, malt for beer brewing can be made in a short period of time after harvesting. High varieties can be obtained.

[Method for selecting dormant modified grasses]
The method for selecting a dormant modified gramineous plant according to the present invention may be a method for selecting a dormant modified gramineous plant using the genetic marker according to the present invention as an index, and other processes, conditions, materials, etc. It is not limited. For example, a conventionally known crop breeding method can be used.

  More specifically, for example, a method of extracting a plant genomic DNA produced by crossing or the like and selecting a plant using the genotype of the genetic marker according to the present invention as an index can be mentioned. Examples of means for detecting a genetic marker include, for example, a fragment length or a fragment restriction enzyme for a DNA fragment amplified using any one of the first to fourth primer sets using genomic DNA extracted from a target plant as a template. The observation of digestion patterns can be mentioned.

  The present invention is not limited to the above-described embodiments, and various modifications can be made within the scope of the claims, and the embodiments can be obtained by appropriately combining technical means disclosed in different embodiments. The form is also included in the technical scope of the present invention.

[Used plant]
Culture of F1 pollen obtained from crossing brewing barley “Hardeum vulgare ssp. Vulgare variety Harunanijo” and wild barley “H602” (Hordeum vulgare ssp. Spontaneum H602) into haploids A population consisting of 93 doubled haploids that were grown and naturally doubled was used.

[Create a chain map]
About 120,000 barley EST sequences possessed by the present inventors were base-called again with phred, then trimmed with a quality score of 20, and vector masking was performed to obtain about 60,000 sequences at the 3 ′ end. Unigene consisting of contig 8,753 and singlet 6,686 was prepared from these sequences by phrap. About 11,000 primer sets for amplifying a 150-500 bp cDNA sequence centered on 400 bp were created by the primer creation software Primer3. Among these, about 5,100 primer sets, in order to detect the presence or absence of polymorphism of genomic fragments amplified between Haruna Nijo and H602, each genomic DNA was amplified by PCR and the presence or absence of a band was detected by agarose gel electrophoresis. The number of bands and the band size were investigated, and those that could serve as markers were selected. In addition, when there is no polymorphism in the band size, the nucleotide sequence difference is detected by direct sequencing of the amplified fragment, and markers that can be converted into CAPS (cleaved amplified polymorphic sequence) for 39 types of restriction enzymes are markers. Selected as.

  As described above, a linkage map composed of markers of a total of 499 loci was constructed for the DH population derived from the hybrid F1 of Haruna Nijo and H602. This linkage map has an average marker density of 3.0 cM / locus and a total length of 1,470 cM.

[Determination of genotype]
The genotype of each individual in the DH population was determined using the markers mapped to the linkage map of the DH population. That is, PCR was performed using a primer set designed based on the EST sequence using DNA isolated from fresh leaf tissue of each individual as a template. For the fragment length polymorphism marker, the genotype was determined by electrophoresis of PCR products. For the CAPS (cleaved amplified polymorphic sequence) marker, the PCR product was digested with a restriction enzyme and the genotype was determined by electrophoresis.

[Study on dormancy]
For seeds obtained from each individual of the DH population, after awakening dormancy at 25 ° C. for 5 weeks or 10 weeks, the seeds were germinated, the number of germinated grains after 4 days was investigated, and the ratio was determined for each DH individual. The germination rate (%) was used as the dormancy. The distribution of the germination rate of each DH individual after 5 weeks of the awakening period is shown in FIG. 9 (a), and the distribution of the germination rate of each DH individual after 10 weeks of the awakening period is shown in FIG. 9 (b). In FIG. 5, the white arrow indicates Haruna Nijo, the black arrow indicates the germination rate of H602, the vertical axis indicates the number of individuals, and the horizontal axis indicates the germination rate (%). As is clear from FIG. 9, Haruna Nijo showed a germination rate of almost 100% by awakening for 5 weeks or 10 weeks, and H602 showed a germination rate of 0 in all cases. On the other hand, each individual in the DH population was continuously distributed between 0 and 100%.

[QTL analysis]
The QTL analysis algorithm uses simple interval mapping (hereinafter abbreviated as “SIM”) and composite interval mapping (hereinafter abbreviated as “CIM”). MAPMAKER / QTL and QTL Cartographer were used. The threshold of the LOD score was set to 2, and when the LOD score exceeded 2, the presence of QTL was estimated at the position with the largest LOD in the two marker sections.

〔result〕
The results are shown in Table 1. As is clear from Table 1, one QTL involved in dormancy was detected by SIM from the data after 5 weeks of wakefulness. This QTL is present on the 5H chromosome, sits at a position between genetic markers k00206 and 2.6 cM and is sandwiched between genetic markers k00204, and has an LOD score of 19.8. This QTL can explain 71.0% of the phenotypic variance. In addition, 68.1% of seeds germinate in the presence of this QTL by awakening treatment for 5 weeks. Furthermore, one QTL involved in dormancy was detected by SIM from data after 10 weeks of awakening period. In addition, one QTL involved in dormancy was detected by CIM. The QTL detected by SIM is present on the 5H chromosome, sits at a position between genetic markers k04618 to 3.9 cM and is sandwiched between genetic markers k00204, and has an LOD score of 24.6. This QTL can explain 74.7% of the phenotypic variance. Moreover, 70.4% of seeds germinate in the presence of this QTL by awakening treatment for 10 weeks. QTL detected by CIM is also present on the 5H chromosome, sits at a position between genetic markers k00101 to 3.9 cM and is sandwiched between genetic markers k06472, and has an LOD score of 4.2. This QTL can explain 34.8% of the phenotypic variance. In addition, 56.9% of seeds germinate by the awakening treatment for 10 weeks in the presence of QTL.

  The genetic marker according to the present invention can be used for breeding of dormancy-modified plants, isolation of genes involved in dormancy, and the like, and is expected to greatly contribute to the efficiency of breeding. Therefore, it can be widely used for agriculture in general, and is also effective in the food industry using barley and the like as a raw material. It can also be used for basic research in the biological field, particularly plant genome research.

It is a figure which shows the position of the primer sequence designed based on the base sequence of barley EST clone: bah62n12 and the said sequence. (A), (b) is an electrophoretic image showing the fragment length polymorphism between H602 and Haruna Nijo in the genetic marker k04618. (A) is an electrophoretic image of the amplified fragments of Haruna Nijo, H602, Haruna Nijo and H602 hybrid F1, and DH populations 1 to 45 from the left, and (b) from the left, DH populations 46 to 93. It is an electrophoresis image of an amplified fragment. It is a figure which shows the position of the primer sequence designed based on the base sequence of barley EST clone: baak21h06 and the said sequence. It is a figure which shows the base sequence around SNP and SNP between H602 and Haruna Nijo in genetic marker k00204. It is a figure which shows the position of the primer sequence designed based on the base sequence of the barley EST clone: baak15n22. It is a figure which shows the base sequence around SNP and SNP between H602 and Haruna Nijo in genetic marker k00101. It is a figure which shows the position of the base sequence of barley EST clone: BaAK28L22 and the primer sequence designed based on the said sequence. It is a figure which shows the base sequence around SNP and SNP between H602 and Haruna Nijo in the genetic marker k06472. FIG. 9 (A) is a graph showing the distribution of dormancy of each individual in the DH population after 5 weeks of wakefulness, and FIG. 9 (B) shows the distribution of dormancy of each individual in the DH population after 10 weeks of wakefulness. It is a graph.

Claims (6)

A genetic marker that is present in the genomic DNA of wheat and linked to a locus involved in dormancy,
Located at a distance in the range of 0 to 5 centimorgans from the locus responsible for dormancy ,
Genetic markers wherein Rukoto amplified using a primer having the nucleotide sequence shown in SEQ ID NO: 1, the first primer set is a combination of a primer having a nucleotide sequence shown in SEQ ID NO: 2. The genetic marker of claim 1;
A genetic marker that is present in the genomic DNA of wheat and linked to a locus involved in dormancy,
Located at a distance in the range of 0 to 5 centimorgans from the locus responsible for dormancy,
A genetic marker comprising a primer having a base sequence shown in SEQ ID NO: 3 and a genetic marker amplified using a second primer set which is a combination of a primer having a base sequence shown in SEQ ID NO: 4 marker. A genetic marker that is present in the genomic DNA of wheat and linked to a locus involved in dormancy,
Located at a distance in the range of 0 to 5 centimorgans from the locus responsible for dormancy,
Genetic markers and primers having the nucleotide sequence shown in SEQ ID NO: 5, wherein Rukoto amplified with third primer set is a combination of a primer having a nucleotide sequence shown in SEQ ID NO: 6. The genetic marker of claim 3;
A genetic marker that is present in the genomic DNA of wheat and linked to a locus involved in dormancy,
Located at a distance in the range of 0 to 5 centimorgans from the locus responsible for dormancy,
A genetic marker comprising a primer having a base sequence shown in SEQ ID NO: 7 and a genetic marker amplified using a fourth primer set which is a combination of a primer having a base sequence shown in SEQ ID NO: 8; marker. Genetic marker according to any one of claims 1 to 4 above wheat is characterized barley der Rukoto. The genetic marker according to claim 5 , wherein the genomic DNA is a 5H chromosome .

Images