JP2005229844A - Gene marker connected to gene locus participating on number of spicule steps and its utilization - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a gene marker existing in the genome DNA of a gramineous plant such as barley and connected to a gene locus participating on the number of spicule steps, and to provide a method for utilizing the gene marker. <P>SOLUTION: The detailed chain map of barley was made, and a QTL analysis was carried out. Thus, two gene markers connected to a gene locus participating on the number of spicule steps and boarded on barley 1H chromosome, two gene markers connected to a gene locus participating on the number of spicule steps and boarded on barley 2H chromosome, two gene markers connected to a gene locus participating on the number of spicule steps and boarded on barley 3H chromosome were found, two gene markers connected to a gene locus participating on the number of spicule steps and boarded on barley 4H chromosome were found, and two gene markers connected to a gene locus participating on the number of spicule steps and boarded on barley 5H chromosome were found. <P>COPYRIGHT: (C)2005,JPO&NCIPI

Description

  The present invention relates to a novel genetic marker and a method for using the same, and more particularly to a genetic marker linked to a locus related to the number of spikelets in a grass family such as barley and the use thereof.

The number of spikelets in the grass family is the number of grains on the spike. Since the yield of Nijo barley can be expressed by the number of spikes per m ² × number of spikelets × 1 grain weight, “number of spikelets” is a guideline for estimating the yield. Therefore, when having the same number of spikes and one grain weight, it can be said that the yield is higher as the number of spikelets is larger. Therefore, it can be said that a large number of spikelets is a preferable trait in cultivars.

  Conventionally, for breeding crops, it is necessary to cross cultivated varieties or wild varieties with a target trait, actually cultivate many individuals, select individuals with the target trait, and genetically fix the target trait First of all, it required a vast field, a lot of human power, and considerable years. For example, when targeting traits with a large number of spikelets, the individuals to be selected must be identified by cultivating the population to be selected and actually measuring the spikelet number after each individual heads. There wasn't. Further, if the target trait is a trait that is easily affected by the cultivation environment factor, it is difficult to determine whether or not the target trait expressed by the selected individual is a gene phenotype.

  Therefore, in recent years, breeding methods by selection using genetic markers as indices have been used in order to shorten the breeding period, reduce labor and field area, and reliably select useful genes. In breeding with such a genetic marker, selection can be made at the seedling stage depending on the genotype of the marker, and the presence or absence of the target trait can be easily confirmed. Therefore, efficient breeding can be realized by using genetic markers. In order to achieve breeding using genetic markers, it is essential to develop genetic markers that are strongly linked to the target trait.

  By the way, many of the traits important in agriculture are many that show continuous mutations in hybrid progeny. Such traits are called quantitative traits because they are measured on a quantitative scale such as time and length. It is known that the number of spikelets is one of quantitative traits. In general, quantitative traits are often determined by the action of multiple genes, rather than a single dominant gene-dominated trait. Many traits that are targeted for improvement in crop breeding, such as yield, quality, and taste, are often quantitative traits.

  A genetic position occupied by such a gene that governs quantitative traits on a chromosome is referred to as QTL (Quantitative Trait Loci). As a method of estimating QTL, QTL analysis using a genetic marker existing in the vicinity of QTL is used. With the advent of DNA markers in the late 1980s, detailed linkage map creation using DNA markers has greatly progressed, and QTL analysis has been performed on many organisms based on the maps.

  As described above, the development of genetic markers linked to the target trait is enabled by high-accuracy QTL analysis based on a detailed linkage map that can cover the entire chromosome, and by using the obtained genetic markers, it is efficient. It can be said that simple breeding can be realized.

Examples of techniques related to the genetic marker include, for example, barley, 1) a genetic marker linked to a gene that confers aluminum resistance to barley and a technique related to its use (see Patent Document 1), and 2) a nucleic acid derived from a barley chromosome. The present inventors have proposed a novel primer set (see Patent Document 2) for detecting a marker in the background of wheat, a technique relating to its use, and the like.
JP 2002-291474 A (published on October 8, 2002) JP 2003-111593 A (published on April 15, 2003)

  As mentioned above, since the number of spikelets of the grass family is involved in the yield of the grass family, the modification of the spikelet stage is one of important breeding goals. However, the number of spikelets is a trait that is easily influenced by cultivation environment factors, and there are many cases where multiple loci are involved. Therefore, in the selection method that actually investigates the spikelet number, the gene (gene) It is difficult to confirm whether or not the seat has been selected. Therefore, it is very effective to use genetic markers for breeding plants with modified spikelet stages. If genetic markers linked to the loci involved in the spikelet stage number are developed and made available, it will be possible to achieve significant efficiency in breeding the spikelet stage modified plant.

  The present invention has been made in view of the above problems, and its object is to provide a novel genetic marker linked to a locus related to the number of spikelets in a grass family, particularly barley, and a typical use thereof. It is to provide.

  In order to solve the above problems, the present inventors designed a primer set based on the barley EST sequence possessed by the inventors, and determined whether or not a genetic marker (DNA Marker) was developed. Furthermore, using a doubled haploid (hereinafter abbreviated as “DH”) population produced from a cross F1 of brewing barley “Haruna Nijo” and wild barley “H602”, the linkage between the above genetic markers is detected. Then, a linkage map of the DH strain was prepared, and QTL analysis of the gene locus involved in the number of spikelets was performed based on this linkage map. As a result, loci involved in the number of spikelets were detected one by one on the 1H chromosome, 2H chromosome, 3H chromosome, 4H chromosome, and 5H chromosome. The present inventors have further analyzed and found novel genetic markers linked to the loci involved in the number of spikelets. Accordingly, the present invention has been completed based on the above-described novel findings and includes the following inventions.

  That is, the genetic marker according to the present invention is a genetic marker that is present in the genomic DNA of a grass family and is linked to a locus related to the number of spikelets, and is 0 to 8 from the locus related to the number of spikelets. It is characterized by being located at a distance within the range of a centimorgan. Since the above genetic marker is strongly linked to the locus associated with the number of spikelets, the probability of recombination occurring between the genetic marker and the locus associated with the number of spikelets is low. Therefore, by using the genetic marker, for example, it is possible to obtain a DNA fragment containing a locus related to the number of spikelets, to produce (produce) or discriminate a spikelet-modified plant.

  Furthermore, the genetic marker according to the present invention is characterized in that the Gramineae plant is a wheat. Therefore, by using the above genetic markers, obtaining DNA fragments containing loci involved in the number of spikelets in wheat, such as barley and wheat, and producing (producing) and discriminating spikelets with modified spikelets Is possible.

  Furthermore, the genetic marker according to the present invention is characterized in that the wheat is a barley. Therefore, by using the above genetic marker, it is possible to obtain a DNA fragment containing a locus related to the number of spikelets in barley, to produce (produce) and discriminate the spikelet-modified barley.

  Furthermore, the genetic marker according to the present invention is characterized in that the genomic DNA is a 1H chromosome. Therefore, by using the above genetic marker, it is possible to obtain a DNA fragment containing a locus related to the number of spikelets present on the 1H chromosome of barley, to produce (produce) and discriminate the spikelet-modified barley. It becomes possible.

  Furthermore, the genetic marker according to the present invention is amplified using a first primer set which is a combination of a primer having the base sequence shown in SEQ ID NO: 1 and a primer having the base sequence shown in SEQ ID NO: 2. It is a feature. When an amplification reaction such as PCR is performed using the first primer set, the genetic marker can be easily amplified and detected, and the spikelet stage number-modified grass family can be easily identified.

  The genetic marker according to the present invention is amplified using a second primer set that is a combination of a primer having the base sequence shown in SEQ ID NO: 3 and a primer having the base sequence shown in SEQ ID NO: 4. It is a feature. When an amplification reaction such as PCR is performed using the second primer set, the genetic marker can be easily amplified and detected, and the spikelet stage number-modified grass family can be easily identified.

  The genetic marker according to the present invention is characterized in that the genomic DNA is a 2H chromosome. Therefore, by using the above genetic marker, it is possible to obtain a DNA fragment containing a locus related to the number of spikelets present on the 2H chromosome of barley, to produce (produce) and discriminate the spikelet-modified barley. It becomes possible.

  The genetic marker according to the present invention is amplified using a third primer set that is a combination of a primer having the base sequence shown in SEQ ID NO: 5 and a primer having the base sequence shown in SEQ ID NO: 6. It is a feature. When an amplification reaction such as PCR is performed using the third primer set, the genetic marker can be easily amplified and detected, and the spikelet stage number-modified grass family can be easily identified.

  The genetic marker according to the present invention is amplified using a fourth primer set which is a combination of a primer having the base sequence shown in SEQ ID NO: 7 and a primer having the base sequence shown in SEQ ID NO: 8. It is a feature. When an amplification reaction such as PCR is performed using the fourth primer set, the genetic marker can be easily amplified and detected, and the spikelet stage number-modified grass family can be easily identified.

  The genetic marker according to the present invention is characterized in that the genomic DNA is a 3H chromosome. Therefore, by using the above genetic marker, it is possible to obtain a DNA fragment containing a locus related to the number of spikelets present on the 3H chromosome of barley, to produce (produce) and discriminate the spikelet-modified barley. It becomes possible.

  Furthermore, the genetic marker according to the present invention is amplified using a fifth primer set which is a combination of a primer having the base sequence shown in SEQ ID NO: 9 and a primer having the base sequence shown in SEQ ID NO: 10. It is a feature. When an amplification reaction such as PCR is performed using the fifth primer set, the genetic marker can be easily amplified and detected, and the spikelet stage number-modified grass family can be easily identified.

  The genetic marker according to the present invention is amplified using a sixth primer set that is a combination of a primer having the base sequence shown in SEQ ID NO: 11 and a primer having the base sequence shown in SEQ ID NO: 12. It is a feature. When an amplification reaction such as PCR is performed using the sixth primer set, the genetic marker can be easily amplified and detected, and the spikelet stage-modified grass family can be easily identified.

  The genetic marker according to the present invention is characterized in that the genomic DNA is a 4H chromosome. Therefore, by using the above genetic marker, it is possible to obtain a DNA fragment containing a locus related to the number of spikelets present on the 4H chromosome of barley, to produce (produce) and discriminate the spikelet-modified barley. It becomes possible.

  Furthermore, the genetic marker according to the present invention is amplified using a seventh primer set which is a combination of a primer having the base sequence shown in SEQ ID NO: 13 and a primer having the base sequence shown in SEQ ID NO: 14. It is a feature. When an amplification reaction such as PCR is performed using the seventh primer set, the genetic marker can be easily amplified and detected, and the spikelet stage number-modified rice plant can be easily identified.

  The genetic marker according to the present invention is amplified using a sixth primer set that is a combination of a primer having the base sequence shown in SEQ ID NO: 15 and a primer having the base sequence shown in SEQ ID NO: 16. It is a feature. When an amplification reaction such as PCR is performed using the eighth primer set, the genetic marker can be easily amplified and detected, and the spikelet stage number-modified grass family can be easily identified.

  The genetic marker according to the present invention is characterized in that the genomic DNA is a 5H chromosome. Therefore, by using the above genetic marker, it is possible to obtain a DNA fragment containing a locus related to the number of spikelets present on the 5H chromosome of barley, to produce (produce) and discriminate the spikelet-modified barley. It becomes possible.

  Furthermore, the genetic marker according to the present invention is amplified using a ninth primer set that is a combination of a primer having the base sequence shown in SEQ ID NO: 17 and a primer having the base sequence shown in SEQ ID NO: 18. It is a feature. When an amplification reaction such as PCR is performed using the ninth primer set, the genetic marker can be easily amplified and detected, and the spikelet stage-modified grass family can be easily identified.

  The genetic marker according to the present invention is amplified using a tenth primer set that is a combination of a primer having the base sequence shown in SEQ ID NO: 19 and a primer having the base sequence shown in SEQ ID NO: 20. It is a feature. When an amplification reaction such as PCR is performed using the tenth primer set, the genetic marker can be easily amplified and detected, and the spikelet stage-modified grass family can be easily identified.

  On the other hand, the method for isolating a DNA fragment according to the present invention is characterized by isolating a DNA fragment containing a gene locus involved in the number of spikelets using the genetic marker according to the present invention. The genetic marker according to the present invention is strongly linked to a locus related to the number of spikelets. Cloning with the above genetic marker as a target makes it easy to singly contain a DNA fragment containing the locus related to the number of spikelets. Can be separated.

  In addition, the method for producing a spikelet stage-modified gramineous plant according to the present invention includes a DNA fragment containing the locus associated with the spikelet stage number obtained by the above-described DNA fragment isolation method according to the present invention. It is characterized by being introduced into the genomic DNA. The gramineous plant is preferably wheat, and more preferably barley. According to the production method, it is possible to produce a spikelet number-modified grass.

  The spikelet stage number modified gramineous plant according to the present invention is characterized by being obtained by the method for producing the spikelet stage number modified grass family according to the present invention. In particular, a modified gramineous plant having an increased number of spikelets can increase the yield of the crop.

  The method for selecting a spikelet stage number-modified grass family according to the present invention is a method for selecting a spikelet stage number-modified grass plant using the genetic marker according to the present invention as an index. Since the genetic marker according to the present invention is strongly linked to the locus related to the number of spikelets, the probability that recombination occurs between the genetic marker and the locus related to the number of spikelets is very low. Therefore, by detecting the genetic marker, the genotype of the locus involved in the number of spikelets in the test target plant can be easily distinguished, and the individual to be selected can be easily found.

  Since the genetic marker according to the present invention is linked to a locus related to the number of spikelets, it is possible to breed a grass plant with the spikelet number modified using the genetic marker as an index. Therefore, there is an effect that efficient breeding of the spikelet stage number modified plant can be realized. More specifically, since the target individual can be selected at the seedling stage, there is no need to select the target individual after actually observing the number of spikelets of the plant individual, and the breeding period can be shortened. In addition, since a plurality of gene loci can be selected at the same time, the target genotype can be surely obtained rather than selecting by observation. In addition, the labor force and the field area can be reduced.

  Moreover, if selective breeding is performed using the genetic marker according to the present invention as an index, the influence on the phenotype by the cultivation environment factor can be eliminated. Therefore, there is an effect that reliable selection of useful genes (locus) can be achieved.

  In addition, a spikelet stage modified plant that has been selectively bred using the genetic marker as an indicator, particularly a modified plant with an increased spikelet stage number, can increase the yield of the crop. Furthermore, the identification of species and varieties is facilitated using the number of spikelets as an index, and there is an effect that mixing of different types or different varieties can be eliminated.

  An embodiment of the present invention will be described as follows. Note that the present invention is not limited to this.

  The present invention relates to a genetic marker linked to a locus related to the number of spikelets in a gramineous plant and an example of its use. Hereinafter, genetic markers according to the present invention, usefulness of the present invention, and examples of use of the present invention will be described.

(1) Genetic marker according to the present invention The genetic marker according to the present invention may be any genetic marker as long as it is present in the genomic DNA of a grass family and is linked to a locus related to the number of spikelets. As the gramineous plant, wheat is preferable, and barley is particularly preferable. The grass family plant is not particularly limited as long as it is a plant such as barley, wheat, and rice. The wheat refers to, for example, barley, wheat, rye, triticale, oat and the like.

“The number of spikelets” is the number of spikelets in the gramineous plant. Since the yield of Nijo barley can be expressed by the number of spikes per m ² × number of spikelets × 1 grain weight, “number of spikelets” is a guideline for estimating the yield. Therefore, when having the same number of spikes and one grain weight, it can be said that the yield is higher as the number of spikelets is larger. Therefore, it can be said that a large number of spikelets is a preferable trait in cultivars. Therefore, when breeding varieties having excellent traits, it is necessary to select those having as many spikelets as possible.

  Moreover, it is known that the number of spikelets in grasses varies depending on the species and variety. Therefore, if a variety having a different spikelet number from other varieties is grown, contamination of different varieties can be easily identified. Therefore, it can be said that the modification of the number of spikelets is one of the important breeding goals.

  The number of spikelets is a quantitative trait that is determined by multiple loci. With respect to quantitative traits, the position of the gene locus involved in the quantitative trait on the chromosome can be estimated by QTL analysis. Hereinafter, genetic markers linked to loci involved in the number of spikelets developed by the present inventors in barley will be described in detail. The genetic markers according to the present invention are not limited to these.

  The present inventors created a high-density linkage map using a doubled haploid (DH) population produced from a cross F1 of brewing barley “Haruna Nijo” and wild barley “H602”. That is, barley genomic DNA was amplified using a primer set designed based on the barley EST (expressed sequence tag) sequence possessed by the present inventors, and the length of the amplified fragment was determined between “Haruna Nijo” and “H602”. Those having polymorphisms and those having polymorphisms that differ in the digestion pattern of the amplified fragment length by restriction enzymes were identified, and a linkage map comprising about 500 loci including these DNA markers was constructed. Based on this linkage map and data on the number of spikelets for the 93 individuals of the DH population measured by the present inventors, QTL analysis of loci involved in the number of spikelets was performed. As a result, loci involved in the number of spikelets were detected one by one on the 1H chromosome, 2H chromosome, 3H chromosome, 4H chromosome, and 5H chromosome. The genetic marker according to the present invention is related to the two genetic markers located closest to each other and the number of spikelets to be seated on the 2H chromosome across the locus associated with the number of spikelets to be seated on the 1H chromosome. Two genetic markers located closest to each other across the gene locus and two genetic markers related to the number of spikelets located on the 3H chromosome, and two genetic markers located closest to each other and located on the 4H chromosome Two genetic markers located closest to each other with two genetic markers located closest to the number of spikelet steps on the 5H chromosome and two genetic markers located closest to each other located on the 5H chromosome. It is a marker. The inventors linked genetic markers linked to loci associated with the number of spikelets detected on the 1H chromosome to “k03582” and “k00591”, loci associated with the number of spikelets detected on the 2H chromosome. The genetic markers linked to the loci involved in the number of spikelets detected on the “k07732” and “k07430” and 3H chromosomes are the genetic markers “k06937” and “k02538” and the spikelets detected on the 4H chromosome. Genetic markers linked to loci involved in the number of stages are named “k03289” and “k01301”, and genetic markers linked to loci related to the number of spikelets detected on the 5H chromosome are designated “k02321” and “k00835”. did.

k03582 is
Amplified using barley genomic DNA as a template using a first primer set which is a combination of a primer having the base sequence shown by CGTCGCAGGACTGTTACGAA (SEQ ID NO: 1) and a primer having the base sequence shown by AGGAAGCGACATGAGAATG (SEQ ID NO: 2) A DNA marker that sits at a position of about 0 centmorgan (hereinafter referred to as cM) on the short arm side from the locus related to the number of spikelets detected on the 1H chromosome. The primer sequence is designed based on one of the barley EST sequences uniquely developed by the inventors (EST clone name: bah13o05, SEQ ID NO: 21). FIG. 1 shows the entire nucleotide sequence of the EST. The underlined portion is the primer sequence (SEQ ID NO: 1) and the complementary sequence of the primer sequence (SEQ ID NO: 2).

  There is SNP (single nucleotide polymorphisms) between the Haruna Nijo amplification product and the H602 amplification product. FIG. 2 shows the base sequence of the portion containing the SNP in the base sequences of both amplification products. The top is the base sequence of H602 (SEQ ID NO: 22), and the bottom is Haruna Nijo base sequence (SEQ ID NO: 23). A base surrounded by a square (square) is a SNP. The underlined portion indicates the recognition sequence (CTCGAG) of the restriction enzyme XhoI. As can be seen from FIG. 2, the Haruna Nijo amplification product has a restriction enzyme XhoI recognition sequence (CTCGAG) and is cleaved with XhoI. Since it is mutated (CTTGAG), it is not cleaved by the restriction enzyme XhoI. That is, the present genetic marker k03582 is a CAPS (cleaved amplified polymorphic sequence) marker, and the number of spikelets on which the subject individual sits on the 1H chromosome by amplification with the first primer set and restriction enzyme XhoI cleavage of the amplified product. It is possible to discriminate whether the alleles at the gene locus involved in have a Haruna Nijo type genotype or an H602 type genotype.

  Here, the cultivar “Haruna 2” has a trait with a small number of spikelets (hereinafter referred to as “small spikelet number type” as appropriate), and the wild cultivar “H602” has a trait with a large number of spikelets. (Hereinafter referred to as “multiple spike stage type” as appropriate). Therefore, if the amplification product obtained using the first primer set is cleaved by the restriction enzyme XhoI, the plant to be tested can be identified as the Haruna Nijo type, that is, the small spikelet type, and conversely cleaved by the restriction enzyme. If not, it can be determined that the type is H602, that is, the type of multiple spikelets.

  Confirmation of the presence or absence of cleavage by the restriction enzyme is not particularly limited, but, for example, the number of DNA fragment bands observed at that time after electrophoresis of the restriction enzyme XhoI digested and the undigested one. Can be determined to be cleaved with the XhoI if it is increased compared to that of undigested, and it can be determined that it is not cleaved with the XhoI if there is no change. The same may be done for the detection and discrimination of other genetic markers using other primer sets described below.

K00591 is
Barley genomic DNA was amplified using a second primer set which is a combination of a primer having the base sequence shown by CGAGAAGAAAACGGAGACGAC (SEQ ID NO: 3) and a primer having the base sequence shown by GATCATCAACGAGACGGTGA (SEQ ID NO: 4) as a template. This genetic marker is located at a position about 0 cM away from the gene locus related to the number of spikelets detected on the 1H chromosome on the long arm side. The primer sequence is designed based on one of the barley EST sequences independently developed by the inventors (EST clone name: baak36b12, SEQ ID NO: 24). FIG. 3 shows the entire base sequence of the EST. The underlined portion is the primer sequence (SEQ ID NO: 3) and the complementary sequence of the primer sequence (SEQ ID NO: 4).

  There is a SNP between the Haruna Nijo amplification product and the H602 amplification product. FIG. 4 shows the base sequence of the portion containing the above SNP in the base sequences of both amplification products. The top is the base sequence of H602 (SEQ ID NO: 25), and the bottom is the base sequence of Haruna Nijo (SEQ ID NO: 26). The base surrounded by □ is SNP. The underlined part shows the recognition sequence (CC [G or C] GG) of the restriction enzyme BcnI. As is apparent from FIG. 4, the amplification product of H602 has a restriction enzyme BcnI recognition sequence (CCGGGG), so that it is cleaved by BcnI. Since it is mutated (CCCGGA), it is not cleaved by the restriction enzyme BcnI. That is, this genetic marker k00591 is a cleaved amplified polymorphic sequence (CAPS) marker, and the number of spikelets on which the target individual sits on the 1H chromosome by amplification with the second primer set and cleavage of the amplified product BcnI. It is possible to discriminate whether the alleles at the gene locus involved in have a Haruna Nijo type genotype or an H602 type genotype.

K07732 is
Amplified using barley genomic DNA as a template using a third primer set that is a combination of a primer having the base sequence shown in CTTGCAAAGAATGGCCTAGC (SEQ ID NO: 5) and a primer having the base sequence shown in GAAAAACATGCCCAGGAAGGAC (SEQ ID NO: 6) This genetic marker is located at a position about 3.5 cM on the short arm side from the locus associated with the number of spikelets detected on the 2H chromosome. The primer sequence is designed based on one of the barley EST sequences independently developed by the inventors (EST clone name: BaGS20M01, SEQ ID NO: 27). FIG. 5 shows the entire nucleotide sequence of the EST. The underlined portion is the primer sequence (SEQ ID NO: 5) and the complementary sequence of the primer sequence (SEQ ID NO: 6).

There is a SNP between the Haruna Nijo amplification product and the H602 amplification product. FIG. 6 shows the base sequence of the portion containing the above SNP in the base sequences of both amplification products. The top is the base sequence of H602 (SEQ ID NO: 28), and the bottom is Haruna Nijo base sequence (SEQ ID NO: 29). A base surrounded by a square (square) is a SNP. The underlined part shows the recognition sequence (GATATC) of the restriction enzyme EcoRV. As is clear from FIG. 6, since the amplification product of Haruna Nijo has the recognition sequence (GATATC) of the restriction enzyme EcoRV, it is cleaved by EcoRV. Since it is mutated (GATATG), it is not cleaved by the restriction enzyme EcoRV.
That is, this genetic marker k07732 is a CAPS (cleaved amplified polymorphic sequence) marker, and the number of spikelets on which the subject individual sits on the 2H chromosome by amplification with the third primer set and restriction enzyme EcoRV cleavage of the amplified product. It is possible to discriminate whether the alleles at the gene locus involved in have a Haruna Nijo type genotype or an H602 type genotype.

K07430 is
Barley genomic DNA was amplified using a fourth primer set, which is a combination of a primer having the base sequence shown in TGGCTGCTATGCTACGTTTG (SEQ ID NO: 7) and a primer having the base sequence shown in AATTTTGAGGAGCTGTTGGA (SEQ ID NO: 8). This genetic marker is located at a position about 0 cM on the long arm side from the gene locus related to the number of spikelets detected on the 2H chromosome. The primer sequence is designed based on one of the barley EST sequences uniquely developed by the inventors (EST clone name: baet18F0911, SEQ ID NO: 30). FIG. 7 shows the entire nucleotide sequence of the EST. The underlined part is the primer sequence (SEQ ID NO: 7) and the complementary sequence of the primer sequence (SEQ ID NO: 8).

There is a SNP between the Haruna Nijo amplification product and the H602 amplification product. FIG. 8 shows the base sequence of the portion containing the SNP in the base sequences of both amplification products. The top is the base sequence of H602 (SEQ ID NO: 31), and the bottom is Haruna Nijo base sequence (SEQ ID NO: 32). A base surrounded by a square (square) is a SNP. The underlined part indicates the restriction enzyme HaeIII recognition sequence (GGCC). As is clear from FIG. 8, the Haruna Nijo amplification product has a restriction enzyme HaeIII recognition sequence (GGCC) and is cleaved by HaeIII. Since it is mutated (GACC), it is not cleaved by the restriction enzyme HaeIII.
That is, the present genetic marker k07430 is a CAPS (cleaved amplified polymorphic sequence) marker, and the number of spikelets on which the subject individual sits on the 2H chromosome by amplification with the fourth primer set and restriction enzyme HaeIII cleavage of the amplified product. It is possible to discriminate whether the alleles at the gene locus involved in have a Haruna Nijo type genotype or an H602 type genotype.

K06937 is
Amplified using barley genomic DNA as a template using a fifth primer set which is a combination of a primer having the base sequence shown by ATCTCGTTCTTGGAGCCGTA (SEQ ID NO: 9) and a primer having the base sequence shown by ACCACAAGCATTGGAGAAGG (SEQ ID NO: 10) This genetic marker is located at a position about 3.4 cM away from the gene locus related to the number of spikelets detected on the 3H chromosome to the short arm side. The primer sequence is designed based on one of the barley EST sequences independently developed by the inventors (EST clone name: BaAL7B16, SEQ ID NO: 33). FIG. 9 shows the entire nucleotide sequence of the EST. The underlined portion is the primer sequence (SEQ ID NO: 9) and the complementary sequence of the primer sequence (SEQ ID NO: 10).

  There is a SNP between the Haruna Nijo amplification product and the H602 amplification product. FIG. 10 shows the base sequence of the portion containing the SNP in the base sequences of both amplification products. The top is the base sequence of H602 (SEQ ID NO: 34), and the bottom is Haruna Nijo base sequence (SEQ ID NO: 35). The base surrounded by □ is SNP. The underlined portion indicates the recognition sequence (CATCC) of the restriction enzyme FokI. As is apparent from FIG. 10, the amplification product of H602 has a restriction enzyme FokI recognition sequence (CATCC) and is thus cleaved with FokI. Since it is mutated (CATAC), it is not cleaved by the restriction enzyme FokI. That is, this genetic marker k06937 is a cleaved amplified polymorphic sequence (CAPS) marker, and the number of spikelets on which the subject individual sits on the 3H chromosome by amplification with the fifth primer set and cleavage of the amplification product FokI. It is possible to discriminate whether the alleles at the gene locus involved in have a Haruna Nijo type genotype or an H602 type genotype.

K02538 is
Amplified with barley genomic DNA as a template using a sixth primer set which is a combination of a primer having the base sequence shown by GAGGCAAGCAGCCAATACACA (SEQ ID NO: 11) and a primer having the base sequence shown by TTTGTGACGGCTTACACCAC (SEQ ID NO: 12) This genetic marker is located at a position about 3 cM away from the gene locus related to the number of spikelets detected on the 3H chromosome on the long arm side. The primer sequence is designed based on one of the barley EST sequences independently developed by the inventors (EST clone name: bags22g10, SEQ ID NO: 36). FIG. 11 shows the entire nucleotide sequence of the EST. The underlined part is the primer sequence (SEQ ID NO: 11) and the complementary sequence of the primer sequence (SEQ ID NO: 12).

  There is a polymorphism between the Haruna Nijo amplification pattern and the H602 amplification pattern, and a fragment of about 450 bp is amplified using the Haruna Nijo genomic DNA as a template, whereas the H602 genomic DNA is used as the template. DNA fragments are not amplified. FIG. 12 shows an electrophoresis image of a fragment amplified by PCR using the sixth primer set. FIG. 12A shows, from the left end, Haruna Nijo, H602, Haruna Nijo and H602 cross F1, and amplified fragments 1 to 21 of the DH population. FIG. 12 (b) shows 22 to 45 amplified fragments of the DH population in order from the left end. FIG. 12 (c) shows 46 to 69 amplified fragments of the DH population in order from the left end. FIG. 12 (d) shows 70 to 93 amplified fragments of the DH population in order from the left end. As is clear from FIG. 12, by confirming an amplification product of about 450 bp, the allele of the locus involved in the number of spikelets that the subject individual sits on the 3H chromosome has a Haruna Nijo type genotype. Or having an H602 genotype.

K03289 is
Barley genomic DNA was amplified as a template using a seventh primer set which is a combination of a primer having the base sequence shown in TGCTCTGCATTTCATTCAGC (SEQ ID NO: 13) and a primer having the base sequence shown in CAGCGTTACAGGCATTCTCA (SEQ ID NO: 14) The genetic marker is located at a position about 2.5 cM on the short arm side from the locus related to the number of spikelets detected on the 4H chromosome. The primer sequence is designed based on one of the barley EST sequences independently developed by the inventors (EST clone name: bags3h19, SEQ ID NO: 37). FIG. 13 shows the entire base sequence of the EST. The underlined portion is the primer sequence (SEQ ID NO: 13) and the complementary sequence of the primer sequence (SEQ ID NO: 14).

  There is a SNP between the Haruna Nijo amplification product and the H602 amplification product. FIG. 14 shows the base sequence of the portion containing the above SNP in the base sequences of both amplification products. The top is the base sequence of H602 (SEQ ID NO: 38), and the bottom is the base sequence of Haruna Nijo (SEQ ID NO: 39). A base surrounded by a square (square) is a SNP. The underlined part shows the recognition sequence (CCGCGG) of the restriction enzyme SacII. As is apparent from FIG. 14, the Haruna Nijo amplification product has a recognition sequence (CCGCCGG) of the restriction enzyme SacII and is cleaved by SacII. Since it is mutated (CCGTGG), it is not cleaved by the restriction enzyme SacII. That is, this genetic marker k03289 is a cleaved amplified polymorphic sequence (CAPS) marker, and the number of spikelets on which the subject individual sits on the 4H chromosome by amplification with the seventh primer set and restriction enzyme SacII cleavage of the amplified product. It is possible to discriminate whether the alleles at the gene locus involved in have a Haruna Nijo type genotype or an H602 type genotype.

K01301 is
Amplified with barley genomic DNA as a template using an eighth primer set that is a combination of a primer having the base sequence shown by ATCAACTATGCACGCAACCA (SEQ ID NO: 15) and a primer having the base sequence shown by AAGGTTTCAGCGTCAGAGA (SEQ ID NO: 16) This genetic marker is located at a position about 4.6 cM away from the gene locus related to the number of spikelets detected on the 4H chromosome on the long arm side. The primer sequence is designed based on one of the barley EST sequences uniquely developed by the inventors (EST clone name: baal39f20, SEQ ID NO: 40). FIG. 15 shows the entire nucleotide sequence of the EST. The underlined portion is the primer sequence (SEQ ID NO: 15) and the complementary sequence of the primer sequence (SEQ ID NO: 16).

  There is a SNP between the Haruna Nijo amplification product and the H602 amplification product. FIG. 16 shows the base sequence of the portion containing the SNP in the base sequences of both amplification products. The top is the base sequence of H602 (SEQ ID NO: 41), and the bottom is Haruna Nijo's base sequence (SEQ ID NO: 42). A base surrounded by a square (square) is a SNP. The underlined part shows the recognition sequence (CCATGG) of the restriction enzyme NcoI. As is clear from FIG. 16, the amplification product of H602 has a restriction enzyme NcoI recognition sequence (CCATGG), so it is cleaved with SacII. Since it is mutated (CCACGG), it is not cleaved by the restriction enzyme NcoI. That is, this genetic marker k01301 is a cleaved amplified polymorphic sequence (CAPS) marker, and the number of spikelets on which the subject individual sits on the 4H chromosome by amplification with the eighth primer set and restriction enzyme NcoI cleavage of the amplified product. It is possible to discriminate whether the alleles at the gene locus involved in have a Haruna Nijo type genotype or an H602 type genotype.

K02321 is
Barley genomic DNA was amplified using a ninth primer set which is a combination of a primer having the base sequence shown in CCAGACTGACGATTTGGGAT (SEQ ID NO: 17) and a primer having the base sequence shown in GTGAAGCAATTCATGCAAGC (SEQ ID NO: 18). This genetic marker is located at a position about 7.6 cM away on the short arm side from the locus related to the number of spikelets detected on the 5H chromosome. The primer sequence is designed based on one of the barley EST sequences independently developed by the inventors (EST clone name: bags19i06, SEQ ID NO: 43). FIG. 17 shows the entire nucleotide sequence of the EST. The underlined portion is the primer sequence (SEQ ID NO: 17) and the complementary sequence of the primer sequence (SEQ ID NO: 18).

  There is a SNP between the Haruna Nijo amplification product and the H602 amplification product. FIG. 18 shows the base sequence of the portion containing the above SNP in the base sequences of both amplification products. The top is the base sequence of H602 (SEQ ID NO: 44), and the bottom is Haruna Nijo's base sequence (SEQ ID NO: 45). A base surrounded by a square (square) is a SNP. The underlined portion indicates the recognition sequence (GTAC) of the restriction enzyme AfaI. As is clear from FIG. 18, since the amplification product of H602 has a recognition sequence (GTAC) of the restriction enzyme AfaI, it is cleaved by AfaI. Since it is mutated (GTAT), it is not cleaved by the restriction enzyme AfaI. That is, this genetic marker k02321 is a cleaved amplified polymorphic sequence (CAPS) marker, and the number of spikelets on which the subject individual sits on the 5H chromosome by amplification with the ninth primer set and restriction enzyme AfaI cleavage of the amplified product. It is possible to discriminate whether the alleles at the gene locus involved in have a Haruna Nijo type genotype or an H602 type genotype.

K00835 is
Amplified using barley genomic DNA as a template using a tenth primer set which is a combination of a primer having the base sequence shown in TCCATGTTCCCAGCTACCA (SEQ ID NO: 19) and a primer having the base sequence shown in AGGAACACATTGGTTCTGGC (SEQ ID NO: 20) This genetic marker is located at a position about 3.9 cM away from the gene locus involved in the number of spikelets detected on the 5H chromosome on the long arm side. The primer sequence is designed based on one of the barley EST sequences independently developed by the inventors (EST clone name: baak46e06, SEQ ID NO: 46). FIG. 19 shows the entire nucleotide sequence of the EST. The underlined portion is the primer sequence (SEQ ID NO: 19) and the complementary sequence of the primer sequence (SEQ ID NO: 20).

  There is a fragment length polymorphism between the Haruna Nijo amplification product and the H602 amplification product, the size of the fragment amplified using the Haruna Nijo genomic DNA as a template is about 890 bp, and the fragment amplified using the H602 genomic DNA as a template The size of is different from about 870 bp. FIG. 20 shows an electrophoresis image of a fragment amplified by PCR using the tenth primer set. Both ends of FIGS. 20A and 20B are molecular weight markers. FIG. 20A shows, in order from the left end (excluding molecular weight markers), Haruna Nijo, H602, Haruna Nijo and H602 cross F1, and 1 to 45 amplified fragments of the DH population. FIG. 20B shows 46 to 93 amplified fragments of the DH population in order from the left end (excluding molecular weight markers). As is clear from FIG. 20, by confirming the size of the amplification product, the allele of the locus involved in the number of spikelets that sits on the 5H chromosome of the target individual has a Haruna Nijo type genotype. , H602 type genotype can be discriminated.

  Here, 1 centmorgan (1 cM) is a unit representing the distance between two loci when crossover occurs at a frequency of 1% between the two loci.

  By the way, genomic DNA used as a template in amplification can be extracted from a plant body by a conventionally known method. Specifically, a general method for extracting genomic DNA from a plant body (see, for example, Murray, M.G. and W.F.Thompson (1980) Nucleic Acids Res. 8: 4321-4325.) Is a suitable example. The genomic DNA can be extracted using any tissue that constitutes a barley plant such as roots, stems, leaves, and reproductive organs. In some cases, it may be extracted from barley callus. The reproductive organs include flower organs (including male and female reproductive organs) and seeds. Extraction of genomic DNA is performed, for example, using the leaves of the barley seedling stage. This is because the tissue is relatively easy to grind, the mixing ratio of impurities such as polysaccharides is relatively small, and can be grown from seeds in a short period of time. Furthermore, it is possible to select individuals at the seedling stage, and the breeding period can be greatly shortened.

  A conventionally known DNA amplification method can be employed as a method for amplification using barley genomic DNA as a template and the combination of the above primers. In general, a PCR method (polymerase chain reaction method) or a modified method thereof is used. The reaction conditions when using the PCR method or its modification method are not particularly limited, and amplification can be performed under the same conditions as usual.

(2) Use of the present invention [Method for isolating a DNA fragment containing a locus involved in the number of spikelets]
As described above, the genetic marker (k03582, k00591) according to the present invention is linked to the locus associated with the number of spikelets detected on the barley 1H chromosome, and the genetic marker according to the present invention (k07732, k07430). Are linked to loci associated with the number of spikelets detected on the barley 2H chromosome, and the genetic markers (k06937, k02538) according to the present invention are linked to the number of spikelets detected on the barley 3H chromosome. The genetic marker (k03289, k01301) according to the present invention is linked to a genetic locus related to the number of spikelets detected on the barley 4H chromosome. Such genetic markers (k02321, k00835) are small molecules detected on the barley 5H chromosome. It is those linked to gene locus involved in the number of stages.

  Therefore, by using the genetic markers k03582 and k00591, it is possible to isolate a DNA fragment containing the locus associated with one spikelet number detected on the barley 1H chromosome, and use the genetic markers k07732 and k07430. Thus, a DNA fragment containing a locus related to the number of spikelets detected on the barley 2H chromosome can be isolated, and spikelets detected on the barley 3H chromosome by using genetic markers k06937 and k02538 A DNA fragment containing a locus related to the number of stages can be isolated, and a DNA fragment containing a locus related to the number of spikelets detected on the barley 4H chromosome by using the genetic markers k03289 and k01301 can be isolated. Of k02321, k00835 The DNA fragment containing the gene locus involved in spikelet number detected on barley 5H chromosome by using a heat transfer markers can be isolated.

  The isolation means that cloning of the target DNA fragment, that is, a DNA fragment containing a locus related to the number of spikelets, is broadly defined by backcrossing from the hybrid F1 population, Isolation includes selection of an individual having a DNA fragment containing a locus related to the number of spikelets in one of the parents, and introducing only the locus region into the target variety.

  A method for isolating a DNA fragment containing a gene locus involved in the number of spikelets using the genetic marker according to the present invention is not particularly limited, and examples thereof include the following method.

  In barley, two types of BAC libraries of genomic DNA have been created, including “Haruna Nijo”, which is being developed by the present inventors, and a plurality of BAC libraries are currently under development. Therefore, using such a BAC library, according to a conventionally known map-based cloning technique, a BAC containing the marker at a locus involved in the number of spikelets and the genetic marker of the present invention linked to the locus. By identifying a clone, creating a BAC contig from the clone, and determining the base sequence, it is possible to finally reach a locus related to the number of spikelets.

  In addition, as described above, one parent is backcrossed to the cross F1 to introduce a DNA fragment containing a gene locus involved in the number of spikelets of the other parent into the target variety (in a broad sense). can do.

  When isolating a DNA fragment containing a locus related to the number of spikelets including the above method, a genetic marker that sits as close as possible to the locus related to the target spikelet number It is preferable to select and use. This is because the probability of recombination between the locus associated with the target spikelet number and the genetic marker is lower, and the fragment containing the locus associated with the spikelet number can be isolated more reliably. .

[Method of producing spikelet stage number modified plant and spikelet stage number modified plant obtained by the production method]
By introducing the DNA fragment containing the locus related to the spikelet number obtained by the method for isolating the DNA fragment containing the locus related to the spikelet number according to the present invention into the genomic DNA of the grass family plant, It is possible to produce a rice plant with modified spikelet number. As the gramineous plant, wheat is preferable, and barley is particularly preferable. In addition, for example, a DNA fragment containing a locus related to the number of spikelets isolated from barley can be introduced into a grass family other than barley, and is limited to isolation and introduction only between the same genera. Is not to be done.

  The method for introducing the DNA fragment is not particularly limited, and a known method can be appropriately selected and used. More specifically, for example, it may be produced by introducing it into the genomic DNA of a gramineous plant using, for example, Agrobacterium or particle gun, thereby obtaining a spikelet-modified variety. For example, the journal The Plant Journal (1997) 11 (6), 1369-1376 discloses a method for transforming barley using Agrobacterium tumefaciens by Sonia Tingay et al. Can produce barley.

  In addition, a DNA fragment containing a locus related to the number of spikelets by crossing a plant individual having a DNA fragment containing a locus related to the target number of spikelets with a plant individual into which the DNA fragment is to be introduced. Can also be introduced into plants. In this method, as long as crossing is possible, it is possible to introduce a DNA fragment containing a gene locus involved in the number of spikelets of plants of other species or genera.

  The spikelet stage number modified plant according to the present invention is obtained by the production method according to the present invention. When the spikelet stage-modified plant is introduced with a DNA fragment containing a locus having a phenotype that increases the spikelet stage number (multi spikelet stage type), the spikelet stage number is higher than the spikelet stage number of the original variety. When a DNA fragment containing a gene locus having a phenotype (small spikelet number type) that reduces the number of spikelets is introduced, a variety having a spikelet number that is less than the spikelet number of the original variety It becomes. However, as described above, from the viewpoint of yield, the former cultivar of the multiple spikelets type is preferable.

[Selection method for the number of small spike stages Gramineae]
The method for selecting the spikelet stage number modified gramineous plant according to the present invention may be any method as long as it is a method for selecting the spikelet stage number modified gramineous plant using the genetic marker according to the present invention as an index, and other steps, conditions, materials, etc. Is not particularly limited. For example, a conventionally known crop breeding method can be used.

  More specifically, for example, a method of extracting a plant genomic DNA produced by crossing or the like and selecting a plant using the genotype of the genetic marker according to the present invention as an index can be mentioned. Examples of means for detecting a genetic marker include, for example, a fragment length or a fragment restriction enzyme for a DNA fragment amplified using any one of the first to tenth primer sets using genomic DNA extracted from a target plant as a template. The observation of digestion patterns can be mentioned.

  The present invention is not limited to the above-described embodiments, and various modifications can be made within the scope of the claims, and the embodiments can be obtained by appropriately combining technical means disclosed in different embodiments. The form is also included in the technical scope of the present invention.

[Used plant]
H1 haploid obtained by cultivating F1 pollen obtained from crossing brewing barley “Hardeum vulgare ssp. Vulgare variety Harunanijo” and wild barley “H602” (Hordeum vulgare ssp. Spontaneum H602) A population consisting of 93 doubled haploids that were grown and naturally doubled was used.

[Create a chain map]
About 120,000 barley EST sequences possessed by the present inventors were base-called again with phred, then trimmed with a quality score of 20, and vector masking was performed to obtain about 60,000 sequences at the 3 ′ end. Unigene consisting of contig 8,753 and singlet 6,686 was prepared from these sequences by phrap. About 11,000 primer sets for amplifying a 150-500 bp cDNA sequence centered on 400 bp were created by the primer creation software Primer3. Among these, about 5,100 primer sets, in order to detect the presence or absence of polymorphism of genomic fragments amplified between Haruna Nijo and H602, each genomic DNA was amplified by PCR and the presence or absence of a band was detected by agarose gel electrophoresis. The number of bands and the band size were investigated, and those that could serve as markers were selected. In addition, when there is no polymorphism in the band size, the nucleotide sequence difference is detected by direct sequencing of the amplified fragment, and markers that can be converted into CAPS (cleaved amplified polymorphic sequence) for 39 types of restriction enzymes are markers. Selected as.

  As described above, a linkage map composed of markers of a total of 499 loci was constructed for the DH population derived from the hybrid F1 of Haruna Nijo and H602. This linkage map has an average marker density of 3.0 cM / locus and a total length of 1,470 cM.

[Determination of genotype]
The genotype of each individual in the DH population was determined using the markers mapped to the linkage map of the DH population. That is, PCR was performed using a primer set designed based on the EST sequence using DNA isolated from fresh leaf tissue of each individual as a template. For the fragment length polymorphism marker, the genotype was determined by electrophoresis of PCR products. For the CAPS (cleaved amplified polymorphic sequence) marker, the PCR product was digested with a restriction enzyme and the genotype was determined by electrophoresis.

[Measurement of the number of spikelets]
For each individual in the DH population, the number of spikelets after ripening was counted and recorded. The distribution of the number of spikelets is shown in FIG. Further, the white arrow indicates Haruna Nijo, and the black arrow indicates the number of spikelets in H602. In FIG. 21, the vertical axis represents the number of individuals and the horizontal axis represents the number of spikelets. The number of spikelets in this DH population was distributed between 18 and 36.

[QTL analysis]
The QTL analysis algorithm uses simple interval mapping (hereinafter abbreviated as “SIM”) and composite interval mapping (hereinafter abbreviated as “CIM”). MAPMAKER / QTL and QTL Cartographer were used. The threshold of the LOD score was set to 2, and when the LOD score exceeded 2, the presence of QTL was estimated at the position with the largest LOD in the two marker sections.

〔result〕
The results are shown in Table 1.

  As is clear from Table 1, five QTLs related to the number of spikelets were detected by SIM and CIM. The QTL present on the 1H chromosome sits at a position between k03582 and k00591, and is located at a distance of about 0 cM from the k03582 to the long arm side and from the k00591 to the short arm side at a distance of about 0 cM. The LOD score is 2.3. This QTL can explain 11.6% of the phenotypic variance. In addition, the presence of this QTL increases the number of spikelets by 2.7.

  The QTL present on the 2H chromosome sits at a position sandwiched by k07732 and k07430, and is located at a distance of about 3.5 cM from the k07732 to the long arm side and from the k07430 to the short arm side at a distance of about 0 cM. The LOD score is 2.2. This QTL can explain 11.4% of the phenotypic variance. In addition, the presence of this QTL increases the number of spikelets by 2.9.

  The QTL present on the 3H chromosome sits at a position sandwiched by k06937 and k02538, and is located at a distance of about 3.4 cM from k06937 to the long arm side and from the k02538 to the short arm side at a distance of about 3.0 cM. . The LOD score is 3.0. This QTL can explain 42.0% of the phenotypic variance. In addition, the presence of this QTL reduces the number of spikelets by 7.3.

  The QTL present on the 4H chromosome sits at a position between k03289 and k01301, and is located at a distance of about 2.5 cM from the k03289 to the long arm side and from the k01301 to the short arm side at a distance of about 4.6 cM. . The LOD score is 2.7. This QTL can explain 13.5% of the phenotypic variance. In addition, the presence of this QTL increases the number of spikelets by 3.6 stages.

  The QTL present on the 5H chromosome sits at a position between k02321 and k00835, and is located at a distance of about 7.6 cM from the k02321 to the long arm side and from the k00835 to the short arm side at a distance of about 3.9 cM. . The LOD score is 8.3. This QTL can explain 39.1% of the phenotypic variance. In addition, the presence of this QTL reduces the number of spikelets by 5.0.

  The genetic marker according to the present invention can be used for breeding of spikelet stage-modified plants, isolation of genes involved in the spikelet stage number, and the like, and is expected to greatly contribute to the efficiency of breeding. Therefore, it can be widely used for agriculture in general and is also effective in the food industry using barley and the like as a raw material. It can also be used for basic research in the biological field, particularly plant genome research.

It is a figure which shows the position of the primer sequence designed based on the base sequence of barley EST clone: bah13o05 and the said sequence. It is a figure which shows the base sequence around SNP and SNP between H602 and Haruna Nijo in genetic marker k03582. It is a figure which shows the position of the base sequence of the barley EST clone: baak36b12 and the primer sequence designed based on the said sequence. It is a figure which shows the base sequence around SNP and SNP between H602 and Haruna Nijo in genetic marker k00591. It is a figure which shows the position of the primer sequence designed based on the base sequence of barley EST clone: BaGS20M01 and the said sequence | arrangement. It is a figure which shows the base sequence around SNP and SNP between H602 and Haruna Nijo in genetic marker k07732. It is a figure which shows the position of the primer sequence designed based on the base sequence of the barley EST clone: baet18F0911 and the said sequence. It is a figure which shows the base sequence around SNP and SNP between H602 and Haruna Nijo in the genetic marker k07430. It is a figure which shows the position of the base sequence of the barley EST clone: BaAL7B16 and the primer sequence designed based on the said sequence. It is a figure which shows the base sequence around SNP and SNP between H602 and Haruna Nijo in genetic marker k06937. It is a figure which shows the position of the base sequence of barley EST clone: bags22g10 and the primer sequence designed based on the said sequence. FIG. 12A is an electrophoretic image showing the fragment length polymorphism between Haruna Nijo, H602, Haruna Nijo and H602 hybrid F1, DH population (1 to 21) in genetic marker k02538, FIG. 12 (b) Is an electrophoretic image showing the fragment length polymorphism between DH populations (22-45) in genetic marker k02538, and FIG. 12 (c) is the fragment length polymorphism between DH populations (46-69) in genetic marker k02538. FIG. 12D is an electrophoresis image showing a fragment length polymorphism between DH populations (70 to 93) in the genetic marker k02538. It is a figure which shows the position of the base sequence of barley EST clone: bags3h19, and the primer sequence designed based on the said sequence | arrangement. It is a figure which shows the base sequence around SNP and SNP between H602 and Haruna Nijo in genetic marker k03289. It is a figure which shows the position of the base sequence of the barley EST clone: baal39f20, and the primer sequence designed based on the said sequence. It is a figure which shows the base sequence around SNP and SNP between H602 and Haruna Nijo in genetic marker k01301. It is a figure which shows the position of the primer sequence designed based on the base sequence of barley EST clone: bags19i06, and the said sequence. It is a figure which shows the base sequence around SNP and SNP between H602 and Haruna Nijo in genetic marker k02321. It is a figure which shows the position of the primer sequence designed based on the base sequence of the barley EST clone: baak46e06. FIG. 20 (a) is an electrophoretic image (first half) showing the fragment length polymorphism between H602 and Haruna Nijo in genetic marker k00835, and FIG. 20 (b) is that of H602 and Haruna Nijo in genetic marker k00835. It is the electrophoresis image (latter half) which shows the fragment length polymorphism between. It is a graph which shows distribution of the number of spikelets of each individual of DH group.

Claims (24)

A genetic marker present in the genomic DNA of a grass family and linked to a locus related to the number of spikelets;
A genetic marker, wherein the genetic marker is located at a distance within a range of 0 to 8 centimorgans from a locus related to the number of spikelets.   The genetic marker according to claim 1, wherein the gramineous plant is wheat.   The genetic marker according to claim 2, wherein the wheat is barley.   The genetic marker according to claim 3, wherein the genomic DNA is a 1H chromosome.   5. The amplification according to claim 1, wherein the amplification is performed using a first primer set which is a combination of a primer having the base sequence shown in SEQ ID NO: 1 and a primer having the base sequence shown in SEQ ID NO: 2. The genetic marker according to any one of claims.   5. The amplification according to claim 1, wherein the amplification is performed using a second primer set which is a combination of a primer having the base sequence shown in SEQ ID NO: 3 and a primer having the base sequence shown in SEQ ID NO: 4. The genetic marker according to any one of claims.   The genetic marker according to claim 3, wherein the genomic DNA is 2H chromosome.   Amplification using a third primer set which is a combination of a primer having the base sequence shown in SEQ ID NO: 5 and a primer having the base sequence shown in SEQ ID NO: 6 or The genetic marker according to 3 or 7.   Amplified using a fourth primer set, which is a combination of a primer having the base sequence shown in SEQ ID NO: 7 and a primer having the base sequence shown in SEQ ID NO: 8, or The genetic marker according to 3 or 7.   The genetic marker according to claim 3, wherein the genomic DNA is a 3H chromosome.   Amplification using a fifth primer set, which is a combination of a primer having the base sequence shown in SEQ ID NO: 9 and a primer having the base sequence shown in SEQ ID NO: 10, or The genetic marker according to 3 or 10.   Amplified using a sixth primer set, which is a combination of a primer having the base sequence shown in SEQ ID NO: 11 and a primer having the base sequence shown in SEQ ID NO: 12, or The genetic marker according to 3 or 10.   The genetic marker according to claim 3, wherein the genomic DNA is a 4H chromosome.   Amplified by using a seventh primer set which is a combination of a primer having the base sequence shown in SEQ ID NO: 13 and a primer having the base sequence shown in SEQ ID NO: 14, or The genetic marker according to 3 or 13.   Amplified by using an eighth primer set which is a combination of a primer having the base sequence shown in SEQ ID NO: 15 and a primer having the base sequence shown in SEQ ID NO: 16 or The genetic marker according to 3 or 13.   The genetic marker according to claim 3, wherein the genomic DNA is a 5H chromosome.   Amplified using a ninth primer set, which is a combination of a primer having the base sequence shown in SEQ ID NO: 17 and a primer having the base sequence shown in SEQ ID NO: 18, or The genetic marker according to 3 or 16.   Amplified using a tenth primer set which is a combination of a primer having the base sequence shown in SEQ ID NO: 19 and a primer having the base sequence shown in SEQ ID NO: 20, or The genetic marker according to 3 or 16.   A method for isolating a DNA fragment, comprising isolating a DNA fragment containing a locus involved in the number of spikelets using the genetic marker according to any one of claims 1 to 18.   A DNA fragment containing a locus related to the number of spikelets obtained by the isolation method according to claim 19 is introduced into the genomic DNA of a grass family plant. Production method.   21. The method for producing a spikelet stage-modified gramineous plant according to claim 20, wherein the gramineous plant is a wheat.   The method according to claim 21, wherein the wheat is a barley.   23. A spikelet stage number modified gramineous plant obtained by the method for producing a spikelet stage number modified gramineous plant according to any one of claims 20 to 22.   A method for selecting a spikelet number-modified gramineous plant using the genetic marker according to any one of claims 1 to 18 as an index.

Images